ID: 1006942463

View in Genome Browser
Species Human (GRCh38)
Location 6:37762117-37762139
Sequence TTTGGAGAACACTGAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006942463_1006942466 5 Left 1006942463 6:37762117-37762139 CCTGTGGTTCAGTGTTCTCCAAA No data
Right 1006942466 6:37762145-37762167 CAAGTGCCAGAAGCACCAGGAGG No data
1006942463_1006942465 2 Left 1006942463 6:37762117-37762139 CCTGTGGTTCAGTGTTCTCCAAA No data
Right 1006942465 6:37762142-37762164 TAGCAAGTGCCAGAAGCACCAGG No data
1006942463_1006942469 29 Left 1006942463 6:37762117-37762139 CCTGTGGTTCAGTGTTCTCCAAA No data
Right 1006942469 6:37762169-37762191 GCTGCTAAAGCAGAGCTTGCAGG No data
1006942463_1006942470 30 Left 1006942463 6:37762117-37762139 CCTGTGGTTCAGTGTTCTCCAAA No data
Right 1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006942463 Original CRISPR TTTGGAGAACACTGAACCAC AGG (reversed) Intergenic
No off target data available for this crispr