ID: 1006942464

View in Genome Browser
Species Human (GRCh38)
Location 6:37762135-37762157
Sequence CTTCTGGCACTTGCTAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006942464_1006942469 11 Left 1006942464 6:37762135-37762157 CCAAAGTTAGCAAGTGCCAGAAG No data
Right 1006942469 6:37762169-37762191 GCTGCTAAAGCAGAGCTTGCAGG No data
1006942464_1006942470 12 Left 1006942464 6:37762135-37762157 CCAAAGTTAGCAAGTGCCAGAAG No data
Right 1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006942464 Original CRISPR CTTCTGGCACTTGCTAACTT TGG (reversed) Intergenic
No off target data available for this crispr