ID: 1006942467

View in Genome Browser
Species Human (GRCh38)
Location 6:37762151-37762173
Sequence GCAGCTCCTCCTGGTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006942467_1006942470 -4 Left 1006942467 6:37762151-37762173 CCAGAAGCACCAGGAGGAGCTGC No data
Right 1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG No data
1006942467_1006942469 -5 Left 1006942467 6:37762151-37762173 CCAGAAGCACCAGGAGGAGCTGC No data
Right 1006942469 6:37762169-37762191 GCTGCTAAAGCAGAGCTTGCAGG No data
1006942467_1006942474 23 Left 1006942467 6:37762151-37762173 CCAGAAGCACCAGGAGGAGCTGC No data
Right 1006942474 6:37762197-37762219 ACACCCAGAGTGTCTGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006942467 Original CRISPR GCAGCTCCTCCTGGTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr