ID: 1006942470

View in Genome Browser
Species Human (GRCh38)
Location 6:37762170-37762192
Sequence CTGCTAAAGCAGAGCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006942464_1006942470 12 Left 1006942464 6:37762135-37762157 CCAAAGTTAGCAAGTGCCAGAAG No data
Right 1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG No data
1006942463_1006942470 30 Left 1006942463 6:37762117-37762139 CCTGTGGTTCAGTGTTCTCCAAA No data
Right 1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG No data
1006942467_1006942470 -4 Left 1006942467 6:37762151-37762173 CCAGAAGCACCAGGAGGAGCTGC No data
Right 1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006942470 Original CRISPR CTGCTAAAGCAGAGCTTGCA GGG Intergenic
No off target data available for this crispr