ID: 1006947006

View in Genome Browser
Species Human (GRCh38)
Location 6:37791367-37791389
Sequence CCCTGGGTCTACAGGAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006947006_1006947015 22 Left 1006947006 6:37791367-37791389 CCTGTTCTCCTGTAGACCCAGGG No data
Right 1006947015 6:37791412-37791434 GAATATGCAGCAGCCAGGCAGGG No data
1006947006_1006947016 23 Left 1006947006 6:37791367-37791389 CCTGTTCTCCTGTAGACCCAGGG No data
Right 1006947016 6:37791413-37791435 AATATGCAGCAGCCAGGCAGGGG No data
1006947006_1006947013 17 Left 1006947006 6:37791367-37791389 CCTGTTCTCCTGTAGACCCAGGG No data
Right 1006947013 6:37791407-37791429 GCAAAGAATATGCAGCAGCCAGG No data
1006947006_1006947014 21 Left 1006947006 6:37791367-37791389 CCTGTTCTCCTGTAGACCCAGGG No data
Right 1006947014 6:37791411-37791433 AGAATATGCAGCAGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006947006 Original CRISPR CCCTGGGTCTACAGGAGAAC AGG (reversed) Intergenic
No off target data available for this crispr