ID: 1006952585

View in Genome Browser
Species Human (GRCh38)
Location 6:37836132-37836154
Sequence TTAGATCAGTGATTCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006952583_1006952585 12 Left 1006952583 6:37836097-37836119 CCAAGGGAGCAGGTAGAGTCACA 0: 1
1: 1
2: 3
3: 27
4: 181
Right 1006952585 6:37836132-37836154 TTAGATCAGTGATTCTCTGTGGG 0: 1
1: 0
2: 2
3: 37
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006952585 Original CRISPR TTAGATCAGTGATTCTCTGT GGG Intronic
903032616 1:20474804-20474826 TTAGAGCAGTGCTTCTCAGCTGG - Intergenic
904718578 1:32488507-32488529 GTAGGACAGTGATTCTCAGTTGG + Exonic
904734623 1:32621529-32621551 TGACATCAGTGATCCTCTCTGGG + Exonic
905402909 1:37716333-37716355 CTACATCAGTCATTCTCTGCAGG - Exonic
906369341 1:45239358-45239380 TCAGAACAGTGGTTCTCTCTGGG + Intronic
906831882 1:49041391-49041413 CTAGATCAGGGAAGCTCTGTGGG - Intronic
907981162 1:59482523-59482545 ATAAATCTGTAATTCTCTGTGGG - Intronic
908252728 1:62277797-62277819 TCAGTTCAGTGATTCTCACTTGG - Intronic
908466070 1:64396885-64396907 TTAAATCAGTGGTTCTGTCTTGG + Intergenic
908702082 1:66912904-66912926 GGAGATCAGGGATTCTCTGAAGG - Intronic
909849446 1:80441882-80441904 TTGGAGCAGTGATTCTCAATGGG - Intergenic
911308754 1:96266456-96266478 ATAGATCAGTGGTTGTCTGAGGG + Intergenic
911377269 1:97066408-97066430 TTAGAACACTCATTCCCTGTTGG + Intergenic
912849398 1:113108941-113108963 TTAGATCAGTGTATCTATGTTGG + Intronic
912993892 1:114514249-114514271 TTACATCCTTGATTTTCTGTGGG + Intergenic
913409332 1:118533658-118533680 TGAGTTCTGTGAATCTCTGTGGG - Intergenic
913487716 1:119348757-119348779 GGAGATCAGGGATTCTCTGGAGG + Intergenic
914381717 1:147122175-147122197 GGAGATCAGGGATTCTCTGGAGG - Intergenic
914667634 1:149844263-149844285 TTAGATCAGTGGAACTATGTGGG - Intronic
915725293 1:158013042-158013064 TTAGCTCAGTGGTTCTCACTTGG - Intronic
916623489 1:166527345-166527367 GGAGATCAGGGATTCTCTGGAGG - Intergenic
916624080 1:166534807-166534829 TGAGATCAGAGGTTCTCTGGAGG + Intergenic
917311449 1:173683502-173683524 GGAGATCAGAGATTCTCTGGAGG + Intergenic
917449141 1:175132304-175132326 TTGTATCAGTGATTAGCTGTAGG + Intronic
918215286 1:182388229-182388251 TTAGAGCAGTGGTTTTCTGAGGG + Intronic
918565168 1:185921024-185921046 TTAAATCAGGGATTTCCTGTAGG - Intronic
918724531 1:187902523-187902545 TTCCATCAGTGCTTCTCTGCAGG + Intergenic
918951841 1:191150449-191150471 GGAGATCAGGGATTCTCTGGAGG - Intergenic
919309866 1:195894000-195894022 ATACATCAGGGATCCTCTGTTGG + Intergenic
921678849 1:218007952-218007974 TGATATCAGGGATTCTCTGGAGG - Intergenic
921927408 1:220722960-220722982 TGAGATCAGGGATTGTCTGGAGG + Intergenic
923403465 1:233637861-233637883 TAAGACCAGTGATTCTCAATGGG + Intronic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
1063686958 10:8246091-8246113 TTAGACCAGTGATTCTCAAAAGG - Intergenic
1064060603 10:12133382-12133404 TTACCTCAGTCCTTCTCTGTTGG + Intronic
1064637159 10:17380019-17380041 GGAGATCAGGGATTCTCTGGAGG - Intronic
1065943343 10:30584664-30584686 TCAGATCTGTGATTCTCAATGGG + Intergenic
1067420344 10:46140024-46140046 AAAGATCAGTGATTCTCTGGAGG + Intergenic
1067425677 10:46209495-46209517 AAAGATCAGTGATTCTCTGGAGG - Intergenic
1067505688 10:46846507-46846529 AAAGATCAGTGATTCTCTGGAGG + Intergenic
1067974690 10:51011113-51011135 TTTGCCCAGTGATTCTCAGTGGG - Intronic
1069376825 10:67801491-67801513 TTAGAACAATGATTCCCAGTTGG + Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1071611202 10:87032871-87032893 AAAGATCAGTGATTCTCTGGAGG + Intergenic
1072342145 10:94462495-94462517 TTAGATCAGTAATTCTCAACTGG - Intronic
1072356259 10:94614588-94614610 ATAGATCAGTGATTCTCAGTTGG + Intergenic
1073646283 10:105307692-105307714 TTAGATTATTGAATCACTGTAGG + Intergenic
1074313363 10:112341345-112341367 TTAGAGCAGTGATTCTCCACAGG + Intergenic
1076619690 10:131779263-131779285 TTATAACAGTGATTCTCAGGAGG - Intergenic
1077658433 11:4044824-4044846 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
1079177276 11:18153853-18153875 TTAAATTTGTGGTTCTCTGTGGG + Intronic
1079261558 11:18887317-18887339 TTTAATCTGTGGTTCTCTGTGGG - Intergenic
1081352730 11:42074153-42074175 TTAGTTAAGTCATTCTGTGTGGG - Intergenic
1082942450 11:58722108-58722130 GGAGATCAGGGATTCTCTGGAGG + Intronic
1083055593 11:59816122-59816144 GGAGATCAGGGATTCTCTGGAGG + Intergenic
1083282403 11:61635202-61635224 TTAGATATGTGACTCTCTGGAGG - Intergenic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1085614104 11:77981656-77981678 TTGGATCATTGAATCTCTTTTGG - Intronic
1087027663 11:93666172-93666194 TTAGATCAGTGATACTCAGAAGG - Intronic
1088478938 11:110274300-110274322 TTAGGTTAGTGATTACCTGTTGG - Intronic
1088593374 11:111422070-111422092 ATAGATTAGAGATTCTCTCTTGG - Intronic
1091480832 12:828653-828675 TTAGATAAGTGATTCTCAACAGG - Intronic
1093708582 12:22303254-22303276 GGAGATCAGGGATTCTCTGGAGG - Intronic
1094467726 12:30771382-30771404 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1095281329 12:40354772-40354794 TCAGATCAATGAATCTTTGTAGG + Intronic
1096687541 12:53298817-53298839 TTAACTCAGTGATCCACTGTGGG - Intronic
1097269946 12:57767751-57767773 TAAGTTCAGAGATTGTCTGTGGG + Intronic
1098051165 12:66454811-66454833 TTAGATCACTGATTACCAGTGGG + Intronic
1098408280 12:70150920-70150942 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1098665936 12:73162950-73162972 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1099279194 12:80622369-80622391 TTAGGTCAGTGCTTCTCAGAGGG + Intronic
1099519187 12:83638868-83638890 TTATATCAGGGATTCAATGTTGG - Intergenic
1100001996 12:89848484-89848506 TTAGAGCAGTGATTCTCAATGGG - Intergenic
1100668517 12:96783404-96783426 TTAGAACAGTGGTTGTCTCTGGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102654704 12:114472042-114472064 CTAAAACAGTGATTCTCAGTGGG - Intergenic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1106610163 13:31271182-31271204 GTTGATCAGAGATTCTCTGGGGG + Intronic
1106691885 13:32126349-32126371 TTAGCTCTGTGATTCTGAGTTGG + Intronic
1107263523 13:38523716-38523738 TAAGATCAGTGAGTCTATGATGG - Intergenic
1108146420 13:47482183-47482205 TTAGATCAGTACTTGTCTGAGGG + Intergenic
1108595869 13:51948680-51948702 TTACATCTGTGATTCTCAGTTGG - Intronic
1109482803 13:62978213-62978235 TTAGTTCAGTGATTCTTTAAGGG - Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1110777727 13:79429475-79429497 TTAGAACAGTGGTTGTCTATGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112413718 13:99187211-99187233 AGAGATCAGGGATTCTCTGGAGG + Intergenic
1112447317 13:99476051-99476073 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1112614581 13:100990322-100990344 CTAGACCAGTGATTCTCAATGGG + Intergenic
1114451270 14:22827567-22827589 GAAGATCAGGGATTCTCTGGAGG + Intronic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1115948552 14:38694007-38694029 TGAGATCAGTGATTCTCCTCTGG - Intergenic
1116241056 14:42343469-42343491 TTATATCAGTAATTCAATGTAGG - Intergenic
1118510459 14:66466097-66466119 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1118695649 14:68382353-68382375 TGAGATCAGTGATTCTCATCCGG - Intronic
1118699006 14:68414722-68414744 TAAAATCAGTGATTCTCGGCAGG + Intronic
1118871580 14:69747575-69747597 AGAGATCAGAGATTCTCTGGAGG + Intronic
1119327609 14:73770549-73770571 CTAGATAAGGGATGCTCTGTAGG - Intronic
1122042526 14:98999115-98999137 CTAGAGCAGTGATTCTCTCCAGG - Intergenic
1123496359 15:20831189-20831211 GGAGATCAGGGATTCTCTGCAGG + Intergenic
1123553594 15:21404758-21404780 GGAGATCAGGGATTCTCTGCAGG + Intergenic
1123589839 15:21842144-21842166 GGAGATCAGGGATTCTCTGCAGG + Intergenic
1123992085 15:25691006-25691028 TTCGATCAGTAATGATCTGTTGG - Intronic
1126224715 15:46257705-46257727 TCAGATCATTGGTTGTCTGTGGG + Intergenic
1126450023 15:48796927-48796949 TTAAAGCAGTAATTCTGTGTAGG - Intronic
1129510452 15:76117875-76117897 TTAGGCCAGTGATTCTCAGGTGG + Intronic
1131102235 15:89701828-89701850 TTAGGCCAGTCCTTCTCTGTTGG - Exonic
1132044910 15:98555433-98555455 TGAGTGCAGTGATTCTCTGATGG + Intergenic
1132341767 15:101083350-101083372 TTAAATCAGTGTTTCACTGGAGG + Intergenic
1202961940 15_KI270727v1_random:131980-132002 GGAGATCAGGGATTCTCTGCAGG + Intergenic
1133711639 16:8407262-8407284 TTACACCAGTGATTCTCAGCTGG + Intergenic
1134077959 16:11305394-11305416 TTGGATCAGTGTGTCTCAGTTGG + Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135078643 16:19415333-19415355 TTAGAGCAGTGGTTCTCAGGGGG + Intronic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135597819 16:23756649-23756671 ATAGATCAGTGATTCTCAACTGG + Intronic
1137030513 16:35519547-35519569 TAGGATCAGTGTTTCCCTGTAGG - Intergenic
1137645446 16:50069457-50069479 TTAGAGCAGTGATTCTCAACTGG + Intronic
1137920316 16:52480862-52480884 AAACATCAGTGATTCTCTGCCGG + Intronic
1138369295 16:56512670-56512692 TCAGAACAGTGATTGTCTATGGG + Intronic
1139066371 16:63320176-63320198 TTATACCAGTGATTCTCATTCGG + Intergenic
1139093940 16:63682086-63682108 GTAGATCAGTGACAGTCTGTTGG - Intergenic
1139746026 16:69075343-69075365 TAATTTCAGTGATTCTGTGTAGG - Intronic
1140419674 16:74807866-74807888 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1140684318 16:77418605-77418627 TTAGCTCAGGGTTTCTCAGTCGG - Intronic
1140774826 16:78240053-78240075 TTACATCTGTGATTCTGTGTGGG - Intronic
1140866939 16:79070814-79070836 TTAGATTAGTGATTCTATATTGG + Intronic
1142369815 16:89672633-89672655 GGAGATCAGAGATTCTCTGGAGG - Intergenic
1146256953 17:31397217-31397239 CCAGATCAGTGGTTCCCTGTAGG + Intronic
1146441997 17:32905304-32905326 GGAGATCAGGGATTCTCTGGAGG + Intergenic
1147010801 17:37445797-37445819 GTAGATCAGTAATTCTCTATTGG + Intronic
1148635608 17:49146858-49146880 TTAGATTAGGGATTCCCTGAAGG + Intronic
1148950031 17:51302662-51302684 AGAGATCAGGGATTCTCTGGAGG - Intergenic
1150141991 17:62737999-62738021 CCAGTTCAGTGATTCTGTGTAGG - Intronic
1150383878 17:64742341-64742363 TCAGATCTGTCATTCTCTTTAGG - Intergenic
1150975004 17:70075354-70075376 CTAGCTCATAGATTCTCTGTGGG + Exonic
1151621151 17:75245816-75245838 TTAAAACAGTGATTCTCAGCAGG - Intronic
1152772014 17:82175950-82175972 GGAGATCAGGGATTCTCTGGAGG - Intronic
1154454272 18:14506876-14506898 GGAGATCAGGGATTCTCTGCAGG + Intergenic
1155176058 18:23302337-23302359 TTAGACCAGTGATTCTCAACTGG + Intronic
1155277328 18:24201048-24201070 ACAGCTCAGTGATTCTCTCTCGG + Intronic
1155906143 18:31454167-31454189 TTAGAAGAATCATTCTCTGTAGG + Intronic
1156474237 18:37395531-37395553 TGAGATCAGTAGTTCTCTCTGGG + Intronic
1157943654 18:51955637-51955659 TAAGATCAGTCATTTTCTGAGGG - Intergenic
1158219803 18:55138977-55138999 TGAGGTCAATGATTATCTGTTGG - Intergenic
1158355836 18:56618191-56618213 TTAAATCTCTGATTCTCTTTAGG + Intronic
1158463187 18:57665117-57665139 CTAGTGCAGTGATTCTCCGTGGG - Intronic
1164014034 19:21236127-21236149 TTAGATCAGGGTTTCCCTGTAGG - Intronic
1166587881 19:43967319-43967341 TTACATCAGTAAGTCTATGTGGG + Exonic
925682287 2:6435071-6435093 TTAGTTTTGTGATTCCCTGTAGG + Intergenic
927534621 2:23845511-23845533 TTAGATTAGTGGTTGGCTGTGGG + Intronic
928241924 2:29593946-29593968 TTAAATCAGTGCTTCTCACTGGG + Intronic
929078633 2:38099376-38099398 TAAGAGCAGTGACTCTCTGGGGG + Intronic
929991689 2:46795352-46795374 GTAGATCAGTGATTGGCTGGAGG + Intergenic
930613564 2:53570161-53570183 TTAGAACAGTGATTGCCTCTGGG - Intronic
931081546 2:58777607-58777629 TTACAACAGTGATTCTCAGTTGG - Intergenic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
932584563 2:73019245-73019267 TCAGAAAAGTGATTTTCTGTCGG + Intronic
932842190 2:75093935-75093957 GTACATCTGTGCTTCTCTGTGGG - Intronic
933003168 2:76953268-76953290 TTAGATCAGTGTTCCTGTGGGGG - Intronic
933084274 2:78035705-78035727 TGAGATCAGTGATTCTGTTTAGG - Intergenic
933178338 2:79201624-79201646 GGAGATCAGGGATTCTCTGGAGG + Intronic
933718844 2:85383645-85383667 GGAGATCAGGGATTCTCTGGAGG + Intronic
933745922 2:85571245-85571267 TTAGAGCAGTGTTTCTCAGAGGG - Intronic
934108883 2:88723515-88723537 GGAGATCAGGGATTCTCTGGAGG + Intronic
934818465 2:97351235-97351257 TTAGTTCATTGATTTTCAGTAGG - Intergenic
935611680 2:105032202-105032224 TTAGACCAGTGATTCTCAAAGGG - Intergenic
936268062 2:111025893-111025915 TTAGGTCTATGATTCTCTTTGGG + Intronic
936416983 2:112324501-112324523 GGAGAACAGTGATTCTCTCTGGG - Exonic
938645677 2:133327820-133327842 ATAGACCAGTGCTTCTCAGTGGG + Intronic
939912428 2:147999602-147999624 TTAGGTCAGTGATTCTCAAGTGG - Intronic
940005604 2:149006996-149007018 TTAGACCAGTGTTTTTCTGCCGG + Intronic
940045879 2:149409354-149409376 TTAGAGCACTGATTTTGTGTTGG + Intronic
940627477 2:156193408-156193430 TTATATCAGTGATTCTCAACCGG - Intergenic
940988292 2:160071979-160072001 GGAGATCAGGGATTCTCTGGAGG + Intergenic
941419980 2:165271731-165271753 TTGGAACAGTGATTGTCTCTGGG - Intronic
942153512 2:173103333-173103355 TCAGATCAGTGAGGCTCTGTGGG + Intronic
942606541 2:177697895-177697917 TTAGAACAGTGGTTCTCAGCTGG + Intronic
943874528 2:193046795-193046817 TTCTATCAGTATTTCTCTGTTGG + Intergenic
944145914 2:196507379-196507401 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
945868853 2:215205255-215205277 GGAGATCAGAGATTCTCTGGAGG - Intergenic
946031216 2:216706533-216706555 TCTGCCCAGTGATTCTCTGTGGG - Intergenic
946138227 2:217665721-217665743 ATAGAGCAGTGATTCTCATTGGG - Intronic
946266495 2:218547144-218547166 TTAGAACAGTGATTCTCCAATGG + Intronic
948471942 2:238187996-238188018 GTACATCAGTGATTCTCAGCTGG - Intronic
948949785 2:241241804-241241826 TTAGGTCTGTGATTCTTTATTGG - Intronic
949004694 2:241638515-241638537 TTAGCTCATTCATTCTTTGTGGG + Intronic
1169159291 20:3362736-3362758 TTAAGTCAGTGGTTCTCAGTCGG - Intronic
1169546902 20:6659714-6659736 TTAGAACAGTGCTTCTCAATAGG - Intergenic
1169679284 20:8192478-8192500 TAACATCAGTGCTTCTCTGAAGG + Intronic
1170816160 20:19716189-19716211 TTAGAGCAGTGGTTCTCAGAGGG - Intronic
1170913322 20:20596953-20596975 TTAGAGCAGTGATTCTCAATTGG - Intronic
1170934155 20:20795441-20795463 CTAGATCAGTGATTCTCCACTGG - Intergenic
1172101440 20:32485982-32486004 GCAGAGCAGTGATTTTCTGTAGG + Intronic
1172683395 20:36734835-36734857 TTAGAGCAGTGCTTCTCAATTGG - Intronic
1172817101 20:37696027-37696049 TTAAATCAGTGATTGTATGCCGG + Intronic
1174296478 20:49548815-49548837 ATAGATCAATGAATCTATGTTGG + Intronic
1174734992 20:52957349-52957371 TTACATCAGTGGTTCTCAGATGG + Intergenic
1175035560 20:55997148-55997170 TAAGTTCATTGATTCTCTTTTGG + Intergenic
1177535564 21:22422594-22422616 TTGGCTGAGTGATTCTCTGGTGG - Intergenic
1179827630 21:43975867-43975889 TTAGCAAAGTGATTCTCTGACGG + Intronic
1180256616 21:46634286-46634308 GTAGATCAGGGATTCTCTGGAGG + Intergenic
1182175293 22:28279798-28279820 TCAGATCAGTGGTTGTCTTTGGG - Intronic
1182728710 22:32470165-32470187 TTAGAGCAGTGATGCTCTCTTGG + Intergenic
1182929714 22:34161093-34161115 TTTGAGCACTTATTCTCTGTGGG - Intergenic
1183888619 22:40906490-40906512 GTAGGTCAGTGATTCTCAGTGGG + Intronic
949432557 3:3993202-3993224 TTAGATCATTGATTCTCAGATGG + Intronic
950600689 3:14032790-14032812 GGAGATCAGGGATTCTCTGGAGG + Intronic
950671949 3:14532592-14532614 ATAGAGCAATGGTTCTCTGTTGG - Intronic
951581850 3:24173027-24173049 TTAGGTCAGTGATTCTCAAATGG + Intronic
952049278 3:29363375-29363397 TTGGATTAGAGAGTCTCTGTAGG - Intronic
953575888 3:44112872-44112894 TGCAATCAGTGATTCTCTGCTGG - Intergenic
953620732 3:44530509-44530531 CAAGAGGAGTGATTCTCTGTTGG + Intergenic
954571188 3:51642282-51642304 CTAGATCATGCATTCTCTGTTGG + Intronic
955248540 3:57253086-57253108 TTAGATTAGTGAGGCTCTTTGGG + Intronic
955279744 3:57582911-57582933 TTAGAACAGTGGTTCTCAGCAGG + Intronic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
956199332 3:66690100-66690122 TTAGATCAGAAAATCTCTGAAGG - Intergenic
958522796 3:95212694-95212716 GGAGATCAGGGATTCTCTGGAGG - Intergenic
958813106 3:98885762-98885784 TTAGAGCAGTGATTCTCAAAAGG + Intronic
959680165 3:109086707-109086729 GTACATCAGTACTTCTCTGTTGG - Intronic
963896369 3:150689129-150689151 GGAGATCAGGGATTCTCTGGAGG - Intronic
964504837 3:157387870-157387892 ATAGACCAGTGATTCTCCTTTGG - Intronic
966463392 3:180202781-180202803 TTGGTTCAGTCATTCTCTGAGGG - Intergenic
967336727 3:188352382-188352404 TTAGATCAGCTATTTTCTGAAGG + Intronic
967397896 3:189027034-189027056 TTAGATGAGTCAATATCTGTAGG + Intronic
967633645 3:191776287-191776309 TTATATCAGGGGTTCACTGTTGG + Intergenic
968571160 4:1341526-1341548 TTAGAGCAATGATTTTGTGTAGG - Intergenic
969417699 4:7071733-7071755 TGAGATCAGAGATTATCTGGTGG + Intergenic
970373139 4:15429053-15429075 TAAGAACATTGATACTCTGTGGG - Intronic
970854593 4:20637464-20637486 GGAGATCAGGGATTCTCTGAAGG + Intergenic
971465339 4:26952324-26952346 TTAGATCAGTGATTATCAGCTGG + Intronic
971955342 4:33410530-33410552 GGAGATCAGGGATTCTCTGGAGG - Intergenic
972176353 4:36411484-36411506 TTCCATCAGGGGTTCTCTGTGGG - Intergenic
973304838 4:48634718-48634740 TAAGAACAGGGATTCTCTTTTGG + Intronic
973843126 4:54882818-54882840 TTAGAACAGTGGTTGCCTGTAGG - Intergenic
974077928 4:57184582-57184604 TTAGGTGAGTCACTCTCTGTGGG + Intergenic
974091693 4:57317754-57317776 TTAGCTCAGTGGTTTTCTGAAGG + Intergenic
974258233 4:59489810-59489832 TTAGAAGAGTTTTTCTCTGTGGG + Intergenic
975334267 4:73157622-73157644 ATAGAAAAGTGATTATCTGTAGG - Intronic
975573161 4:75838141-75838163 GGAGATCAGGGATTCTCTGGAGG - Intergenic
976778857 4:88736703-88736725 ATAGATCAGTGTGTCTCTGTGGG - Intronic
977042952 4:92037291-92037313 GGAGATCAGGGATTCTCTGGAGG + Intergenic
977065036 4:92304171-92304193 GAAGACCAGTGATTCTCTGCGGG + Exonic
977143551 4:93407162-93407184 TTTGATCAATGCTTCTCTATTGG - Intronic
980270221 4:130574563-130574585 GGAGATCAGGGATTCTCTGGAGG + Intergenic
981039422 4:140209785-140209807 TTGGCTCAATGATTCCCTGTAGG - Intergenic
981435064 4:144710622-144710644 CTAGAACAGTGATTCTCAATGGG + Intronic
982194492 4:152896875-152896897 TTAGATGATTAATTCTGTGTTGG + Intronic
983425953 4:167583334-167583356 GGAGATCAGGGATTCTCTGGAGG + Intergenic
984010576 4:174366691-174366713 GGAGATCAGGGATTCTCTGGAGG - Intergenic
986732203 5:10643403-10643425 TTATATCAGTGGTTCTCGATGGG - Intronic
987987177 5:25162470-25162492 GGAGATCAGAGATTCTCTGGAGG + Intergenic
988192453 5:27956887-27956909 CTAGATCTGTGATTCTATCTTGG - Intergenic
988653182 5:33176289-33176311 TTAGCTGAGTGATTCTGTTTAGG - Intergenic
989012741 5:36891876-36891898 ATAGTTTAGTGATTCTATGTAGG + Intronic
989371733 5:40717669-40717691 TTAGACCAATGATTCTCACTTGG - Intronic
990027031 5:51205005-51205027 TTAGATAATTGATTCTTTATAGG + Intergenic
991463130 5:66880307-66880329 TTAGAACAGTGGTTCTCTCTGGG + Intronic
995303393 5:110612718-110612740 TTAAATCAGTTATTTTGTGTTGG + Intronic
998553128 5:143096854-143096876 TTAGGACAGTGGTTCTCTGTTGG - Intronic
999626681 5:153528609-153528631 TTAGCTCAGTGATTCTCAAAAGG - Intronic
1000336720 5:160246766-160246788 TTATATCAGTGATTCTCAACAGG - Intergenic
1001257243 5:170193344-170193366 TTATGTCAGTGCCTCTCTGTGGG - Intergenic
1001871140 5:175157015-175157037 TTAGCTCAGTTTTTCTCTCTGGG - Intergenic
1002703457 5:181143597-181143619 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1002958936 6:1896302-1896324 TTAGCTCAGTGCTTCTCTAAAGG - Intronic
1005676365 6:28159758-28159780 TGAGATTAGTGGTTCTCTTTGGG + Intergenic
1006952585 6:37836132-37836154 TTAGATCAGTGATTCTCTGTGGG + Intronic
1007003990 6:38342634-38342656 TCATATCAGTGATTCTCAGGAGG + Intronic
1008877061 6:56340616-56340638 TAAATTCAGAGATTCTCTGTTGG + Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009762626 6:68027553-68027575 TCAGATCAGAGATGTTCTGTAGG - Intergenic
1010316175 6:74453306-74453328 TTATAACAGTGCTTCTCTGTGGG + Intergenic
1010744029 6:79540853-79540875 TTAGAACAGTTATTGACTGTGGG + Intergenic
1011286544 6:85730640-85730662 GGAGATCAGGGATTCTCTGGAGG + Intergenic
1011574753 6:88783866-88783888 TTAGATCAGTGATTCTCAACTGG - Intronic
1012642774 6:101640796-101640818 CTAGATCAGTGATTCTCAAGTGG - Intronic
1012742606 6:103037364-103037386 TTAAATCAGTGTTTCTGTGGTGG + Intergenic
1014110221 6:117612444-117612466 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1015301466 6:131657346-131657368 TCAGAACAGTGATTGTCTTTGGG - Intronic
1015814299 6:137192326-137192348 AGAGATCAGGGATTCTCTGGAGG + Intergenic
1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG + Intronic
1016348707 6:143144262-143144284 TTAAATCAGTGATTATTTGTGGG + Intronic
1016592478 6:145761852-145761874 CTAGAGCAGTGATTCTCAATAGG - Intergenic
1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG + Intergenic
1021107273 7:16652493-16652515 ATAAATGAATGATTCTCTGTAGG + Intronic
1022074968 7:26959237-26959259 TTAGAACTGTGATTGACTGTGGG + Intronic
1022080108 7:27012110-27012132 TGGGATCAGTGATTCTCTTCTGG - Intergenic
1022457260 7:30568457-30568479 GGAGATCAGGGATTCTCTGGGGG - Intergenic
1022904480 7:34842538-34842560 TTAGAGCAGTGATTCTCCATTGG - Intronic
1023410118 7:39881868-39881890 GGAGATCAGGGATTCTCTGGGGG - Intergenic
1024524674 7:50337762-50337784 TTAGGTCACTGTTTCTCAGTGGG + Intronic
1024821630 7:53337463-53337485 GGAGATCAGAGATTCTCTGGAGG - Intergenic
1024938872 7:54741237-54741259 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1028062192 7:86335729-86335751 TTAGATCTGTGATTCACTTATGG - Intergenic
1028125140 7:87104298-87104320 CTAGATCAGTGATTCTCAAAGGG - Intergenic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1029713770 7:102314590-102314612 GTGGATCAGGGATTCTCTGACGG - Exonic
1030076813 7:105744161-105744183 ATAGATCATTGTTTCTGTGTGGG - Intronic
1030835053 7:114273918-114273940 TTAGACCATTGATATTCTGTTGG + Intronic
1031120809 7:117719580-117719602 TTGGATCAGAGACTCTCTCTGGG - Exonic
1031631709 7:124050930-124050952 AAAGATCAGTGGTTCTCTTTGGG + Intergenic
1033389503 7:140913011-140913033 TTAGTTCAAAGATTCTGTGTCGG - Intronic
1034825271 7:154256730-154256752 TTAGATTCTTGATTCTCAGTAGG + Intronic
1035627749 8:1085319-1085341 TTACCTCATTGATTCTTTGTTGG + Intergenic
1036957697 8:13207656-13207678 TTAGAGTAGTGGTTCTCAGTTGG + Intronic
1037573824 8:20181720-20181742 CTACATCAGTGTTTCTCAGTGGG - Intronic
1039601998 8:38847164-38847186 TTAGATCAGTGGTTTGCAGTTGG + Intronic
1040045589 8:42960504-42960526 TTACAATAGTGTTTCTCTGTAGG - Intronic
1041452413 8:58020609-58020631 TTAGATCTTTGATTTCCTGTTGG + Intronic
1042225204 8:66509871-66509893 TAAGATCAGTGTGTCTATGTAGG - Intronic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1043006280 8:74822772-74822794 TTAGATGAGAAACTCTCTGTAGG - Intronic
1045815697 8:106273385-106273407 TTAGAGCAGTGATTCTCCACTGG + Intronic
1046050734 8:109019157-109019179 TTTGTTCAGTGTTCCTCTGTTGG + Intergenic
1046221951 8:111228069-111228091 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1047040500 8:120989476-120989498 TTAGATAAGTGCTTCTCTATTGG - Intergenic
1047119282 8:121882452-121882474 TTATATCAGTGGTTGTCTATAGG + Intergenic
1047945396 8:129872110-129872132 ATAGTTCAGTGATACTCTCTTGG - Intronic
1048077508 8:131088573-131088595 TTAGGTCAGTGTTTCTCAATTGG + Intergenic
1050447189 9:5737454-5737476 TCAGATTAGTGATACTCTGGTGG - Intronic
1050765300 9:9125651-9125673 TTAGATCAGTGATTCTCACCTGG - Intronic
1052085203 9:24256555-24256577 TTGGACCAGTGATTCTCAATGGG + Intergenic
1052212313 9:25920322-25920344 TTAAATCAGTGTTTCTCTGGGGG - Intergenic
1053079281 9:35161291-35161313 GGAGATCAGGGATTCTCTGGAGG + Intergenic
1053250067 9:36566961-36566983 TGAGAGCTGTGCTTCTCTGTTGG - Intergenic
1056697060 9:88867757-88867779 TGAGATCAGTGATTCCCTAATGG - Intergenic
1057426390 9:94953541-94953563 TTATTTCAGTTATTCTCTGCAGG + Intronic
1057910207 9:99014456-99014478 GGAGATCAGGGATTCTCTGGAGG + Intronic
1060905882 9:127305095-127305117 TTAGGACAGTGGTTCTCTTTTGG + Intronic
1186019539 X:5238538-5238560 GTAGATCCGTGGATCTCTGTAGG - Intergenic
1186173651 X:6903042-6903064 TTAGAGCAGTGATTCTCAAGTGG - Intergenic
1187737225 X:22317156-22317178 TTAAATCAGTGGTTCTCAGCTGG - Intergenic
1187816179 X:23234590-23234612 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1188146212 X:26617024-26617046 TTAAAGCAGTGATTCTTAGTTGG + Intergenic
1188939395 X:36218272-36218294 TTACATCAGTTGTTCTCTTTGGG + Intergenic
1190023941 X:46904698-46904720 TTAAATCAGTGTTCCTCTATAGG - Intergenic
1190102654 X:47534050-47534072 TTAGTTTAGTGATAGTCTGTTGG - Intergenic
1190842844 X:54162005-54162027 TTAGTTCAGTGATTCTTAATTGG - Intronic
1193318973 X:80097914-80097936 GTAGATCAGGGATTCTCTTGTGG - Intergenic
1193384628 X:80855841-80855863 GGAGACCAGAGATTCTCTGTAGG + Intergenic
1194437198 X:93882252-93882274 TTACCTCATTGTTTCTCTGTTGG - Intergenic
1194668261 X:96699377-96699399 TTAGACCAGTGATTTTCAGTGGG + Intronic
1194998890 X:100622759-100622781 TTTAATCAGTGATCCTCTCTGGG + Intergenic
1195150287 X:102060935-102060957 GGAGATCAGGGATTCTCTGGAGG - Intergenic
1195220606 X:102742610-102742632 GGAGATCAGGGATTCTCTGGAGG + Intronic
1196382744 X:115109837-115109859 GGAGATCAGGGATTCTCTGGAGG + Intergenic
1196709408 X:118746819-118746841 ATAGATCAGTGATTCTCAATTGG - Intronic
1196884403 X:120229059-120229081 GGAGATCAGGGATTCTCTGAAGG - Intergenic
1197319837 X:125014691-125014713 ATAGACCACTGATTCTCAGTTGG + Intergenic
1197964243 X:132040246-132040268 TTACATCAGCAATTCTCAGTCGG - Intergenic
1198865210 X:141115154-141115176 CTAAATCAGTGATTTTCTGGCGG - Intergenic
1199516172 X:148677934-148677956 TAAGATCAGTGAATTTCTGGTGG + Intronic
1199887866 X:152040222-152040244 GCAGATCAGAGATTCTCTGGAGG + Intergenic
1200226522 X:154420651-154420673 TCAGCACAGTGATTTTCTGTGGG - Exonic
1201375679 Y:13316245-13316267 GGAGATCAGGGATTCTCTGGAGG - Intronic
1202587258 Y:26444677-26444699 TTAGTTCAGTGATTTTTGGTGGG + Intergenic