ID: 1006958489

View in Genome Browser
Species Human (GRCh38)
Location 6:37901128-37901150
Sequence CAGAATGAATTGCCAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 644}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006958489_1006958492 -3 Left 1006958489 6:37901128-37901150 CCAATTTTTGGCAATTCATTCTG 0: 1
1: 0
2: 0
3: 27
4: 644
Right 1006958492 6:37901148-37901170 CTGGTGCTTTCACTGTGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 236
1006958489_1006958495 27 Left 1006958489 6:37901128-37901150 CCAATTTTTGGCAATTCATTCTG 0: 1
1: 0
2: 0
3: 27
4: 644
Right 1006958495 6:37901178-37901200 ACTCAGAAATGAGTAGTAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 212
1006958489_1006958491 -8 Left 1006958489 6:37901128-37901150 CCAATTTTTGGCAATTCATTCTG 0: 1
1: 0
2: 0
3: 27
4: 644
Right 1006958491 6:37901143-37901165 TCATTCTGGTGCTTTCACTGTGG 0: 1
1: 0
2: 1
3: 14
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006958489 Original CRISPR CAGAATGAATTGCCAAAAAT TGG (reversed) Intronic
901959654 1:12815102-12815124 CATACTGAATGGACAAAAATGGG - Intergenic
902762735 1:18594265-18594287 CAGAAGGCATTGCCTACAATAGG - Intergenic
903260807 1:22130853-22130875 CAGAAAGAATTCCCATAAGTAGG - Intronic
904446545 1:30577551-30577573 CATACTGAATGGGCAAAAATTGG - Intergenic
905040727 1:34955698-34955720 CATACTGAATGGGCAAAAATTGG + Intergenic
905051615 1:35056228-35056250 CATACTGAATGGGCAAAAATTGG - Intergenic
906472285 1:46141182-46141204 CATAATGAATTACCACAAACTGG - Intronic
906799608 1:48724680-48724702 TAGAAATTATTGCCAAAAATAGG - Intronic
906839208 1:49118315-49118337 CATACTGAATAGGCAAAAATTGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907815292 1:57912485-57912507 CATACTGAATGGGCAAAAATTGG + Intronic
907876445 1:58493309-58493331 CATACTGAATGGGCAAAAATTGG + Intronic
908794595 1:67818485-67818507 GAAAAGGAACTGCCAAAAATGGG + Intronic
909307504 1:74099949-74099971 CATACTGAATGGGCAAAAATTGG + Intronic
909563914 1:77034073-77034095 CAGAATAAATTATCACAAATCGG + Intronic
909722456 1:78791678-78791700 CACACTGAATGGGCAAAAATTGG + Intergenic
910550955 1:88474321-88474343 CACAATGAATTGGCAGAAACCGG - Intergenic
910632607 1:89371706-89371728 CAGACTGAATGGACAAAAACTGG + Intronic
911110598 1:94180426-94180448 CACCTTGAATTGCCATAAATAGG + Intronic
911848063 1:102779818-102779840 CATACTGAATGGCCAAAAACTGG - Intergenic
912064427 1:105719333-105719355 CATACTGAATGGCCAAAAACTGG + Intergenic
913285357 1:117221642-117221664 CATACTGAATTGGCAAAAACTGG + Intergenic
915763598 1:158340113-158340135 CATATTGAATGGGCAAAAATTGG + Intergenic
916646758 1:166794284-166794306 CTGACTGAATTCCCAAAAGTAGG - Intergenic
916923154 1:169489905-169489927 CAGAATGAATAACCATAAGTAGG - Intergenic
916924306 1:169501727-169501749 CATAATGAATGGGCAAAAACTGG + Intergenic
916974385 1:170060059-170060081 CATAATGAATGGGCAAAAACTGG + Intronic
917026270 1:170646005-170646027 CTCAATGATTCGCCAAAAATTGG - Intergenic
917079193 1:171238508-171238530 CTGAATGAATTGACAGAATTAGG + Intergenic
917463972 1:175258195-175258217 CATACTGAATGGGCAAAAATTGG - Intergenic
918588609 1:186216487-186216509 CATACTGAATGGACAAAAATTGG + Intergenic
918636692 1:186783219-186783241 CAGAATGCATACCCAAAAATAGG + Intergenic
918718636 1:187824388-187824410 CATAATGAATGGGCAAAAACTGG + Intergenic
918733821 1:188033236-188033258 CATAATGAATGGGCAAAAACTGG - Intergenic
918823918 1:189297718-189297740 CATACTGAATGGGCAAAAATTGG - Intergenic
918966100 1:191350723-191350745 CAGAATAGAGAGCCAAAAATTGG + Intergenic
918982578 1:191582507-191582529 CATACTGAATGGCCAAAAGTTGG - Intergenic
920886606 1:209935839-209935861 TAGATAGAATTGCCAAACATGGG + Intergenic
921406277 1:214783201-214783223 CATACTGAATTGGCAAAAACTGG + Intergenic
921417526 1:214907427-214907449 CAGAAAGAAAAGCCACAAATAGG + Intergenic
923081016 1:230655196-230655218 CATACTGAATGGCCAAAAACTGG - Intronic
923266007 1:232314795-232314817 AAGAAAGAATTGGCAAAAATGGG + Intergenic
923645720 1:235818656-235818678 CGGAAAGATATGCCAAAAATTGG - Intronic
923853817 1:237824571-237824593 CATACTGAATGGCCAAAAACTGG + Intronic
924110046 1:240690064-240690086 CATTTTGAATTGGCAAAAATTGG + Intergenic
924793714 1:247276765-247276787 TAGAATAAATTGGAAAAAATGGG + Intergenic
1063883901 10:10558133-10558155 CAGACTGAATGGACAAAAACTGG - Intergenic
1063912903 10:10850398-10850420 AAGAATGAATTGCCAAGACATGG + Intergenic
1063940989 10:11128976-11128998 CATACTGAATGGGCAAAAATTGG - Intronic
1064021458 10:11812675-11812697 AAGGATAAATTGCCTAAAATAGG + Intergenic
1064489256 10:15833070-15833092 CGGAATGGATTGGCCAAAATGGG + Intronic
1064961967 10:20975321-20975343 CAGAATGACATTCCAAAATTAGG - Intronic
1065050079 10:21782943-21782965 CACATTGAATTGACAAAAACTGG + Intronic
1065676997 10:28186924-28186946 CAGCAGGAATTGCCCAAAAAGGG + Intronic
1065994615 10:31046040-31046062 CAGAATGAAGAAACAAAAATGGG - Intergenic
1066032240 10:31440449-31440471 CATACTGAATGGGCAAAAATTGG + Intronic
1066174141 10:32886411-32886433 CACAAAGAACTGACAAAAATTGG + Intergenic
1066411047 10:35169691-35169713 CATACTGAATGGGCAAAAATGGG - Intronic
1066634727 10:37489374-37489396 CAAAATAAATTGGCAGAAATCGG - Intergenic
1066799218 10:39165777-39165799 CATACTGAATGGGCAAAAATTGG + Intergenic
1067540876 10:47151713-47151735 CAGAGAGAATTGTCAAGAATCGG - Intergenic
1067579183 10:47429929-47429951 CATACTGAATTGGCAAAAACTGG - Intergenic
1067903693 10:50268894-50268916 CATAATGAATGGGCAAAAACTGG + Intergenic
1067911770 10:50353481-50353503 CATAATGAATGGGCAAAAACTGG + Intronic
1067996374 10:51278052-51278074 CATAATGAATGGGCAAAAACTGG - Intronic
1068013107 10:51479572-51479594 AAAAATGAATTGAAAAAAATTGG - Intronic
1068085733 10:52371330-52371352 CATACTGAATGGGCAAAAATTGG - Intergenic
1068381736 10:56262766-56262788 CTGAAGGAATTCCCAAAAGTTGG + Intergenic
1068415883 10:56722294-56722316 CTGAGTGAATTCCTAAAAATAGG - Intergenic
1068598626 10:58932396-58932418 CATAATGAATTGCCACAATCTGG - Intergenic
1068728450 10:60329176-60329198 CATATTGAATGGCCAAAAACTGG + Intronic
1069027013 10:63553648-63553670 CTGAATGAATTGCACAGAATAGG + Intronic
1069110286 10:64438460-64438482 CACAATGAATGGGCAAAAACTGG - Intergenic
1069370566 10:67743544-67743566 CATAATGAATGGGCAAAAACTGG + Intergenic
1072032400 10:91533675-91533697 CATACTGAATGGGCAAAAATTGG + Intergenic
1072384513 10:94910688-94910710 CATAATGAATGGGCAAAAACTGG + Intergenic
1072408286 10:95175345-95175367 CATAATGAATGGGCAAAAACTGG - Intergenic
1072997271 10:100256517-100256539 CAGAATGAAAAGCCATCAATAGG + Intronic
1073961383 10:108933715-108933737 CAGAATGAATTTCCACAGAATGG - Intergenic
1074014226 10:109517171-109517193 CAAAATGATTTGCAAAAATTAGG + Intergenic
1074017640 10:109550333-109550355 CATACTGAATGGGCAAAAATGGG + Intergenic
1075773094 10:124957375-124957397 CAAAATAAATTGCAAAAAAAAGG - Intronic
1078029806 11:7738363-7738385 CATACTGAATTGGCAAAAACTGG + Intergenic
1078111784 11:8400512-8400534 CATAATGAATGGGCAAAAACTGG + Intronic
1078392515 11:10948364-10948386 CATACTGAATGGGCAAAAATTGG - Intergenic
1079421111 11:20289549-20289571 CAGAATGAATAGCCCTTAATTGG - Intergenic
1079421415 11:20293020-20293042 TAGAAGGAAGTGCCCAAAATTGG + Intergenic
1079784720 11:24657470-24657492 CATAATGAATGGGCAAAAACTGG + Intronic
1080077161 11:28163651-28163673 CAGAATCAATTGCCCCAAAATGG + Intronic
1080176662 11:29370894-29370916 CATATTGAATGGGCAAAAATTGG - Intergenic
1080348754 11:31357480-31357502 CATACTGAATGGGCAAAAATGGG + Intronic
1081754725 11:45536414-45536436 CATAACAAATTACCAAAAATGGG + Intergenic
1082133222 11:48516271-48516293 CATAATGAATGGGCAAAAACTGG - Intergenic
1082146681 11:48679039-48679061 CACAATGAATGGGCAAAAACTGG - Intergenic
1082589528 11:54988748-54988770 CATAATGAATGGACAAAAACTGG - Intergenic
1083368715 11:62160817-62160839 CATACTGAATGGGCAAAAATTGG + Intergenic
1085952656 11:81351107-81351129 AAGAATGAATTGCTAAAATATGG - Intergenic
1086580725 11:88395200-88395222 CATACTGAATAGGCAAAAATTGG - Intergenic
1086614697 11:88802577-88802599 CATACTGAATGGGCAAAAATTGG + Intronic
1086615374 11:88811608-88811630 TAGAATGAATTCTCAAAATTAGG + Intronic
1086980643 11:93194565-93194587 AAAAAAGAATTTCCAAAAATGGG - Intronic
1087363843 11:97194822-97194844 CATACTGAATGGGCAAAAATTGG - Intergenic
1087609162 11:100412954-100412976 CATACTGAATGGCCAAAAACTGG + Intergenic
1087612929 11:100455763-100455785 CATACTGAATGGCCAAAAACTGG + Intergenic
1087821814 11:102720822-102720844 CTAAATGAATTTCCAAAAAATGG + Intronic
1087950336 11:104213144-104213166 CATACTGAATGGGCAAAAATTGG + Intergenic
1088521184 11:110702428-110702450 CATACTGAATGGGCAAAAATTGG + Intronic
1088559131 11:111095230-111095252 CAGAATCAAGTGGCAAAATTGGG - Intergenic
1089885864 11:121823388-121823410 CAGACTGAATGGGCAAAAACTGG - Intergenic
1090515859 11:127425923-127425945 CAGAAAGAAGGGCTAAAAATAGG + Intergenic
1090883922 11:130859660-130859682 CAGTATGAAATCCCAAAAAGGGG - Intergenic
1091462124 12:651510-651532 CAAAAGGAACTGCCATAAATAGG - Intronic
1091604830 12:1941499-1941521 GAGAATGAATTGACAGAAGTAGG - Intergenic
1091861350 12:3787508-3787530 CATAATGAATGGGCAAAAACTGG - Intergenic
1092707599 12:11301562-11301584 CAGACTGAATGGGCAAAAACTGG + Intergenic
1093135290 12:15442388-15442410 CATACTGAATGGGCAAAAATTGG + Intronic
1094240966 12:28224321-28224343 CAAAAATAATTTCCAAAAATAGG - Intronic
1094398783 12:30038188-30038210 CATAATGAATGGGCAAAAACTGG - Intergenic
1094584124 12:31761548-31761570 AAGAATGAAAGGACAAAAATGGG + Intergenic
1094715753 12:33013556-33013578 CAGACTGAATGGACAAAAACCGG + Intergenic
1094724914 12:33104383-33104405 CAGACTGAATGGTCAAAAACTGG - Intergenic
1095222730 12:39636319-39636341 AAGTATGAATTACCAAAAAAAGG - Intronic
1095346872 12:41160304-41160326 CATACTGAATTGGCAAAAACTGG - Intergenic
1097131326 12:56812721-56812743 TAGCCTGAATTGTCAAAAATAGG + Intergenic
1097514371 12:60586089-60586111 CATACTGAATGGGCAAAAATTGG + Intergenic
1097551563 12:61078039-61078061 CATACTGAATGGACAAAAATTGG + Intergenic
1098241263 12:68469355-68469377 CAGAATACATTTCTAAAAATAGG - Intergenic
1098371494 12:69765236-69765258 CATACTGAATGGACAAAAATTGG - Intronic
1098642270 12:72853449-72853471 CATACTGAATTGGCAAAAACTGG - Intergenic
1098691939 12:73500132-73500154 CATAATGAATGGGCAAAAACTGG - Intergenic
1099061056 12:77909849-77909871 CAAAATGAATGTCTAAAAATGGG + Intronic
1099829251 12:87818690-87818712 CTAAATGGAATGCCAAAAATAGG + Intergenic
1099919498 12:88940014-88940036 CATAATGAATGGGCAAAAACCGG + Intergenic
1100056191 12:90513531-90513553 TAGAATGATTTGCCAAAATATGG + Intergenic
1100766313 12:97869591-97869613 CATACTGAATGGGCAAAAATTGG + Intergenic
1100907438 12:99317763-99317785 CATACTGAATGGACAAAAATTGG - Intronic
1106617615 13:31344453-31344475 CATACTGAATGGGCAAAAATTGG + Intergenic
1107837986 13:44427611-44427633 TAGAATCCATTGGCAAAAATTGG - Intergenic
1108031851 13:46240044-46240066 CATACTGAATGGGCAAAAATTGG + Intronic
1108265257 13:48700559-48700581 CATACTGAATGGGCAAAAATTGG + Intronic
1108807620 13:54179095-54179117 TAGAATGATTTGCCAAATATAGG + Intergenic
1109020287 13:57082434-57082456 CATACTGAATGGGCAAAAATTGG - Intergenic
1109020894 13:57091621-57091643 CAGAATGGATTTTTAAAAATAGG - Intergenic
1109034222 13:57233962-57233984 CATACTGAATGGCCAAAAACTGG + Intergenic
1110418451 13:75278008-75278030 CATACTGAATGGGCAAAAATTGG + Intergenic
1110457901 13:75710897-75710919 CATAATGAATGGGCAAAAACTGG - Intronic
1110459496 13:75729726-75729748 CATAATGAATGGGCAAAAACTGG - Intronic
1111214724 13:85127099-85127121 CATACTGAATGGCCAAAAACTGG + Intergenic
1111290957 13:86169019-86169041 CATACTGAATGGCCAAAAACTGG - Intergenic
1111601228 13:90477405-90477427 GAGTCTGAATTGCTAAAAATAGG + Intergenic
1112089544 13:96068476-96068498 CACCAAGAATTGCCAAAACTAGG + Intergenic
1112252051 13:97791247-97791269 CAAAATGAATTGAAAAAAAAAGG - Intergenic
1112997217 13:105588775-105588797 CAGAATACATTCCCAAAATTTGG + Intergenic
1113190572 13:107741183-107741205 CAGAATGAAATGTAAATAATAGG - Intronic
1113191014 13:107745960-107745982 CAGAATGAAATGTAAATAATAGG - Intronic
1114048331 14:18896608-18896630 CATAATGAATGGGCAAAAACTGG + Intergenic
1114114182 14:19505038-19505060 CATAATGAATGGGCAAAAACTGG - Intergenic
1114115881 14:19622790-19622812 CATAATGAATGGGCAAAAACTGG - Intergenic
1114425414 14:22617729-22617751 CATAATGAATGGGCAAAAACTGG - Intergenic
1114762249 14:25329295-25329317 CATAATGAATGGGCAAAAACTGG + Intergenic
1115097516 14:29655292-29655314 AAGAATGATTTTTCAAAAATAGG + Intronic
1115115074 14:29871080-29871102 CAGGATGTTTTGCCAAACATAGG + Intronic
1115578943 14:34739303-34739325 CATACTGAATGGCCAAAAACTGG - Intergenic
1115717388 14:36121282-36121304 CATACTGAATGGGCAAAAATTGG - Intergenic
1115893339 14:38057289-38057311 CATACTGAATGGGCAAAAATTGG - Intergenic
1115977125 14:39009008-39009030 CAGAATACATTAACAAAAATGGG + Intergenic
1116772745 14:49146054-49146076 CATACTGAATGGGCAAAAATTGG - Intergenic
1116793083 14:49360622-49360644 CATACTGAATGGGCAAAAATTGG + Intergenic
1117082015 14:52161732-52161754 CATACTGAATGGGCAAAAATTGG + Intergenic
1117310167 14:54513536-54513558 CGGAAAGACTTGCTAAAAATTGG + Intronic
1117689960 14:58296728-58296750 TAGAATGAAATCCCAAAATTAGG - Intronic
1117716982 14:58591494-58591516 CATACTGAATGGCCAAAAACTGG + Intergenic
1118168775 14:63364182-63364204 CAAAATTATTTACCAAAAATTGG + Intergenic
1120406848 14:84101651-84101673 CATAATGAATGGGCAAAAAGTGG + Intergenic
1124040917 15:26102779-26102801 CAAAAGGAATTGCAACAAATCGG - Intergenic
1124797772 15:32799127-32799149 CAAACTGATTTGCCAAAAAATGG + Intronic
1125109737 15:36017660-36017682 TAGCATCAATTGCCAACAATAGG + Intergenic
1125346090 15:38720567-38720589 CTGAATGAAGTGCTTAAAATAGG + Intergenic
1126361838 15:47854456-47854478 CAGAGAGAGTTGCCAAAATTAGG - Intergenic
1126951782 15:53889651-53889673 CATACTGAATGGGCAAAAATTGG - Intergenic
1127664174 15:61128776-61128798 CAGGATGCATTGCCAATATTTGG - Intronic
1128182621 15:65617829-65617851 CATAATGAATGGGCAAAAACTGG - Intronic
1128853498 15:70986733-70986755 CAGACTGAATGGGCAAAAACTGG - Intronic
1128877320 15:71213028-71213050 CATAATGAATTACCACAAACTGG + Intronic
1128895492 15:71369380-71369402 CAGACTGAATGGGCAAAAACTGG - Intronic
1129076492 15:73001099-73001121 TAGGATGAATTACCAGAAATAGG + Intergenic
1129526501 15:76219404-76219426 AAGAATCCATTGCCAAATATTGG - Intronic
1129800860 15:78413173-78413195 CACACTGATTCGCCAAAAATGGG - Intergenic
1129967213 15:79747189-79747211 CATACTGAATGGGCAAAAATTGG - Intergenic
1130625843 15:85513646-85513668 CAGTATGTATTTCCTAAAATAGG + Intronic
1131339303 15:91581601-91581623 CATACTGAATGGGCAAAAATTGG - Intergenic
1131409760 15:92197634-92197656 AAGAAAGAAATGCCAAAAATGGG + Intergenic
1131620302 15:94061183-94061205 CAGAATGAATTCCTAATAAAAGG + Intergenic
1131670559 15:94615255-94615277 CAGAAGGCATTGTCAAGAATAGG + Intergenic
1134273897 16:12758745-12758767 TAGAAGGAATTGCCACAAACTGG + Intronic
1134341049 16:13346467-13346489 CCAAAGGAATTGTCAAAAATTGG - Intergenic
1134758180 16:16688021-16688043 CATAATGAATGGGCAAAAACTGG - Intergenic
1134987891 16:18671156-18671178 CATAATGAATGGGCAAAAACTGG + Intergenic
1135515454 16:23128781-23128803 CAGAAAGTTTTGCCAAAAAGAGG + Intronic
1135723902 16:24839766-24839788 CAGAATCTACTGCCATAAATAGG + Intergenic
1137356532 16:47771267-47771289 CATAATGAATGGACAAAAACTGG - Intergenic
1138783179 16:59813335-59813357 CATACTGAATGGGCAAAAATTGG + Intergenic
1138943474 16:61818671-61818693 TATTATGAGTTGCCAAAAATTGG - Intronic
1139618065 16:68113078-68113100 AAGAATGAATTGACAGAAGTAGG - Intronic
1140402226 16:74680948-74680970 CAGTGTCACTTGCCAAAAATAGG - Intronic
1140861096 16:79018746-79018768 CAGAACCACTTGCCGAAAATAGG - Intronic
1145856731 17:28166414-28166436 AAGAGGGGATTGCCAAAAATTGG + Intronic
1147435221 17:40408359-40408381 CAGAATAACTTGTTAAAAATCGG - Intronic
1148510461 17:48164756-48164778 CAGAATGAAGGGCTAAAAACTGG + Intronic
1149193310 17:54089657-54089679 CAGACTGAATGGACAAAAACAGG + Intergenic
1149253413 17:54796251-54796273 CAGTAGGAATTACCAAAAAGAGG - Intergenic
1149473461 17:56939175-56939197 CAAAATGAAGTGCCTAAACTGGG - Intronic
1149823012 17:59798260-59798282 CAGAGTGTTGTGCCAAAAATAGG - Intronic
1203191583 17_KI270729v1_random:195262-195284 CTGAATGAATGGTCAAAAACTGG + Intergenic
1154401237 18:14039687-14039709 CAGAGTGAATGGGCAAAAACTGG - Intergenic
1154478371 18:14790488-14790510 CATACTGAATTGGCAAAAACTGG - Intronic
1156079911 18:33320135-33320157 CATACTGAATGGCCAAAAACTGG + Intronic
1157150258 18:45209965-45209987 CAGTATGAATGCCCACAAATGGG + Intergenic
1157899316 18:51498826-51498848 CAGAAGGAATTGCCAAATTCTGG + Intergenic
1157919775 18:51702703-51702725 CATACTGAATGGGCAAAAATTGG - Intergenic
1159132598 18:64296511-64296533 CAGAATGCATTGCAAATCATAGG + Intergenic
1159270344 18:66141144-66141166 AAGATTGAATTGACAAAAATAGG - Intergenic
1159313441 18:66739326-66739348 CATACTGAATTGGCAAAAACTGG - Intergenic
1164487949 19:28677637-28677659 CATAATGAATGGGCAAAAACTGG + Intergenic
1164555959 19:29251725-29251747 CATACTGAATGGGCAAAAATTGG - Intergenic
1164870875 19:31641600-31641622 CAGAATCTATTGCCAAAAGGAGG - Intergenic
1165376535 19:35446895-35446917 CTGAATGAATGGCAAACAATAGG + Intronic
1165549072 19:36567740-36567762 AAGAATCCATTGCCAAATATAGG - Intronic
1166018461 19:40002341-40002363 AAGAAAAAAATGCCAAAAATTGG + Intronic
925117443 2:1392114-1392136 CATACTGAATGGGCAAAAATTGG - Intronic
925244930 2:2373308-2373330 CATAATGAATGGGCAAAAACTGG - Intergenic
925642698 2:6001928-6001950 CTTAATGTTTTGCCAAAAATTGG + Intergenic
925848627 2:8057902-8057924 CATAATGAATCGCCACAAAATGG + Intergenic
926711371 2:15884536-15884558 TAGGATGAATTTCTAAAAATTGG - Intergenic
927221582 2:20715423-20715445 CACACTGAATGGGCAAAAATTGG + Intronic
927224233 2:20746809-20746831 TAGAATGAATTGGCTAACATGGG - Intronic
927614213 2:24574307-24574329 AAGAATTAACTGGCAAAAATTGG - Intronic
927998414 2:27503093-27503115 CAGAATGTATTCCCACAAATGGG + Intronic
929511078 2:42566701-42566723 CACAATGAATTAACAAAAACAGG + Intronic
930323689 2:49886232-49886254 CATACTGAATGGGCAAAAATTGG + Intergenic
930623133 2:53665565-53665587 CATACTGAATTGGCAAAAACTGG + Intronic
931015676 2:57977548-57977570 CAGAATTAATGTACAAAAATCGG - Intronic
931194552 2:60038886-60038908 CAGACTGAATGGGCAAAAACTGG + Intergenic
931199919 2:60087571-60087593 CAGACTGAATGGGCAAAAACTGG + Intergenic
931481381 2:62644468-62644490 CATACTGAATTGACAAAAACTGG - Intergenic
931560600 2:63556554-63556576 ATGAATGAATTGACAGAAATAGG - Intronic
932106357 2:68946490-68946512 TAAAATAAATTGACAAAAATTGG + Intronic
932379291 2:71267605-71267627 CATACTGAATTGACAAAAACTGG - Intergenic
932989233 2:76765760-76765782 CAGAATGAAATACCACAGATGGG - Intronic
933092684 2:78140829-78140851 CAAAATGAATTTACACAAATAGG + Intergenic
933876326 2:86624076-86624098 CAAAATCAATTGCTAAACATTGG - Intronic
934891639 2:98075674-98075696 CAGACTGAATGGGCAAAAACTGG + Intergenic
935021181 2:99233864-99233886 CATACTGAATGGCCAAAAACTGG + Intronic
935879596 2:107550396-107550418 CAGAAATAACTCCCAAAAATGGG + Intergenic
935959277 2:108408562-108408584 AAGAATGAAGTGAGAAAAATGGG - Intergenic
936167515 2:110136215-110136237 CATAATGAATGGACAAAAACTGG + Intronic
936562171 2:113549522-113549544 CAGAATGAACTGACACAAACAGG - Intergenic
936672396 2:114672470-114672492 CAGAAAGTATTGACACAAATAGG - Intronic
937193363 2:120126249-120126271 GAAAATGAAATGCCACAAATTGG - Intronic
937507601 2:122554709-122554731 CATAATGAATGGGCAAAAACTGG + Intergenic
938748540 2:134305423-134305445 TAGTATAAATTGCCCAAAATAGG - Intronic
939132757 2:138257470-138257492 CATACTGAATAGCCAAAAACTGG + Intergenic
939157317 2:138540841-138540863 CATACTGAATGGCCAAAAACTGG - Intronic
939159967 2:138576190-138576212 CATAATGAATGGGCAAAAACTGG - Intergenic
939996322 2:148923881-148923903 CAGTATGAAATGTCAGAAATGGG + Intronic
940644095 2:156372361-156372383 CATACTGAATGGGCAAAAATTGG - Intergenic
941517991 2:166503685-166503707 CATACTGAATTGGCAAAAACTGG - Intergenic
941534366 2:166704827-166704849 CATACTGAATTGGCAAAAACTGG - Intergenic
941602695 2:167562349-167562371 CATACTGAATTGGCAAAAACTGG + Intergenic
941611271 2:167665061-167665083 CATACTGAATTGGCAAAAACTGG - Intergenic
941626794 2:167839070-167839092 CATACTGAATTGGCAAAAACTGG + Intergenic
942474796 2:176307997-176308019 CATACTGAATAGGCAAAAATGGG - Intronic
943178058 2:184503662-184503684 CAGACTGAATGGGCAAAAACTGG + Intergenic
944117610 2:196206269-196206291 CAGCATGATTTCCCAAAGATGGG - Intronic
944968298 2:204961430-204961452 AAGGATGAATTGCCATTAATTGG + Intronic
945351720 2:208788312-208788334 CATACTGAATGGGCAAAAATTGG + Intronic
945595310 2:211783466-211783488 CATACTGAATGGCCAAAAACTGG - Intronic
945615301 2:212058833-212058855 CATACTGAATGGCCAAAAACTGG + Intronic
945673164 2:212826380-212826402 CATAATAAATTACCACAAATTGG - Intergenic
945998307 2:216458725-216458747 CATACTGAATTGGCAAAAACTGG + Intronic
946141241 2:217692421-217692443 AAGAATGCATTGCCTAAACTAGG - Intronic
946594186 2:221287985-221288007 CAGAGAGAATTTTCAAAAATGGG + Intergenic
947068153 2:226254111-226254133 CATACTGAATAGGCAAAAATTGG + Intergenic
947765897 2:232637063-232637085 CTGAATGAAATGCCACAAAGTGG + Intronic
948031737 2:234823354-234823376 CAGAGTGAAGTGCCATAACTTGG + Intergenic
948325327 2:237114690-237114712 CTGAATGAATTGCCATAGATAGG + Intergenic
1169725918 20:8730939-8730961 CGGAATGTACTGCAAAAAATAGG - Intronic
1169947345 20:11003313-11003335 CAGAAGGAATTGCTGAATATAGG - Intergenic
1170335437 20:15265465-15265487 AAGACTGAATTGCCAAGAAAGGG - Intronic
1170494262 20:16909527-16909549 CATACTGAATGGGCAAAAATTGG - Intergenic
1170674403 20:18466397-18466419 CAGACTGTATTCTCAAAAATGGG + Intronic
1171842304 20:30229319-30229341 GTGAATTAATGGCCAAAAATAGG - Intergenic
1171898376 20:30832433-30832455 CATACTGAATGGGCAAAAATTGG - Intergenic
1172791584 20:37509581-37509603 CAGAAAGAACTGGCAAAAATAGG - Intronic
1173772235 20:45670771-45670793 CATAATGAATTGACAAAAGCTGG + Intergenic
1173812741 20:45966194-45966216 AATAATGAATTTCAAAAAATTGG + Intronic
1173848856 20:46205205-46205227 CAGAATGAAAGGGAAAAAATGGG + Intronic
1176323020 21:5352652-5352674 CATACTGAATGGCCAAAAACTGG + Intergenic
1176480674 21:7284272-7284294 CATACTGAATGGCCAAAAACTGG + Intergenic
1176986144 21:15439065-15439087 CAGAATGTATTGATAAAACTTGG + Intergenic
1176990766 21:15493767-15493789 CAGGGTGATTTGCCAAAAAAGGG + Intergenic
1177584442 21:23072037-23072059 CAGACTGAATGGGCAAAAATTGG - Intergenic
1177665371 21:24150210-24150232 CAGAATATATAGCCAAAATTGGG - Intergenic
1177781137 21:25623467-25623489 GAGAATGCATGGCCCAAAATAGG + Intergenic
1178102556 21:29285443-29285465 AAGAATGAATTACTAAATATAGG - Intronic
1178224745 21:30702278-30702300 CAGATTGCATTGGCAAGAATTGG + Intergenic
1178455897 21:32750735-32750757 CATGATGAATTCTCAAAAATAGG - Intronic
1179895713 21:44361514-44361536 CAGAATGTATTTAAAAAAATAGG - Intronic
1181445588 22:22971051-22971073 CATACTGAATGGCCAAAAACTGG + Intergenic
1182152352 22:28037560-28037582 CATACTGAATGGCCAAAAACTGG + Intronic
1182157380 22:28087554-28087576 CATACTGAATGGCCAAAAACTGG + Intronic
1182165375 22:28167713-28167735 CATACTGAATGGCCAAAAACTGG + Intronic
1182179869 22:28335937-28335959 CATACTGAATGGCCAAAAACTGG - Intronic
1184189486 22:42885415-42885437 TAGAAAGAATTGCAATAAATAGG - Intronic
1184705831 22:46212689-46212711 CTTTATTAATTGCCAAAAATTGG - Intronic
949201453 3:1385031-1385053 CAGAATGCATTGCAAAGAAGTGG - Intronic
950295089 3:11822809-11822831 CATAATGAATCGCCCAAAAGTGG - Intronic
950299525 3:11864081-11864103 CATACTGAATGGCCAAAAACTGG - Intergenic
951288281 3:20842690-20842712 CAGTATTAGTTGCCAAACATAGG - Intergenic
951326547 3:21308884-21308906 CATACTGAATGGGCAAAAATTGG + Intergenic
951446456 3:22786671-22786693 CAGAATAAATTTTAAAAAATGGG + Intergenic
951795014 3:26528912-26528934 CAGACTGAATGGGCAAAAGTTGG - Intergenic
951812864 3:26720087-26720109 CAGAATGAATTGTCAAGAGTGGG + Intergenic
951818931 3:26787006-26787028 CATACTGAATGGGCAAAAATTGG + Intergenic
952807396 3:37369575-37369597 CTAAATAAACTGCCAAAAATGGG + Intergenic
953029277 3:39167482-39167504 GGGAATGAATATCCAAAAATAGG - Intergenic
955085403 3:55697813-55697835 CAGAATGAATGGCCAAAGTGGGG + Intronic
956328410 3:68078409-68078431 CATACTGAATGGGCAAAAATTGG - Intronic
956394826 3:68814209-68814231 CATACTGAATGGGCAAAAATGGG + Intronic
957466315 3:80597619-80597641 CATACTGAATGGGCAAAAATTGG + Intergenic
957959572 3:87231855-87231877 CAGAAAGAAATGCCACAAAAGGG - Intronic
958114193 3:89193390-89193412 CAAATTGAATTGTGAAAAATAGG - Intronic
958167707 3:89898631-89898653 CATACTGAATGGGCAAAAATAGG - Intergenic
958200533 3:90309171-90309193 CATACTGAATGGGCAAAAATTGG - Intergenic
958428012 3:94001898-94001920 CAGAATGATTTTCCAGAAATAGG - Intronic
958924796 3:100145891-100145913 CAGAATGTATGACCAAATATCGG + Intronic
959163306 3:102744587-102744609 CAGACTGAATTGCTGAAAAGGGG + Intergenic
959170492 3:102838350-102838372 CATAGTGAATGGCCAAAAACTGG - Intergenic
959182160 3:102994990-102995012 CAGAATAAATGTACAAAAATTGG + Intergenic
959792292 3:110376448-110376470 AAGAATTAATTGCATAAAATAGG + Intergenic
959939797 3:112068921-112068943 CATACTGAATGGGCAAAAATTGG - Intronic
959946259 3:112128650-112128672 CAGAATGAATAGCCAAGGACAGG + Intronic
960779608 3:121304316-121304338 CAGAACAAATAGACAAAAATTGG + Intronic
961553388 3:127681412-127681434 CAGAATGAAGACCCAAAGATGGG + Intergenic
962341109 3:134584275-134584297 CATACTGAATGGGCAAAAATTGG - Intergenic
962619765 3:137166137-137166159 CAGAATAAATTAGTAAAAATTGG + Intergenic
964228569 3:154435679-154435701 CATAATGAATGGGCAAAAACTGG - Intergenic
964390556 3:156192615-156192637 CTGATAGAATTGCCAAAAAAAGG - Intronic
964543013 3:157800620-157800642 CATACTGAATTGGCAAAAACTGG - Intergenic
965010417 3:163080943-163080965 CAGAATGAATAGGCAAAAGCTGG + Intergenic
965081416 3:164037608-164037630 CATAATGAATGGGCAAAAACTGG + Intergenic
965219019 3:165902444-165902466 CATATTGAATGGGCAAAAATTGG - Intergenic
965271980 3:166628828-166628850 CATACTGAATGGCCAAAAACTGG - Intergenic
965889950 3:173500150-173500172 CATAATGAATGGACAAAAACTGG - Intronic
965989947 3:174804565-174804587 CAGACTGAATGGGCAAAAACTGG - Intronic
966032552 3:175367954-175367976 CATAATGAATGGGCAAAAACTGG - Intronic
967205970 3:187121878-187121900 GAGAAAGAGTTGCCAAAAAAGGG - Intronic
967569546 3:191012642-191012664 CATACTGAATGGGCAAAAATTGG - Intergenic
967737448 3:192967949-192967971 CACAATGAATGGGCAAAAACTGG - Intergenic
967804749 3:193705353-193705375 CAGAATGAAATATCTAAAATGGG + Intergenic
968376181 4:43861-43883 CAAAATGAATTGCATAAAATCGG + Intergenic
969357208 4:6636257-6636279 CATAATGAATGGGCAAAAACTGG + Intergenic
970755225 4:19417755-19417777 CATACTGAATGGGCAAAAATGGG - Intergenic
971175269 4:24276642-24276664 AAGAATGAATTGCTAATTATGGG - Intergenic
973048264 4:45564062-45564084 AAGAGTGTATTGCAAAAAATGGG - Intergenic
973139780 4:46752517-46752539 CATACTGAATTGGCAAAAACTGG - Intronic
973678915 4:53295735-53295757 CATAATGAATGGGCAAAAACTGG - Intronic
973771547 4:54211723-54211745 GAGAATGAATTGCCAAAGGCAGG + Intronic
974321496 4:60355645-60355667 CAGACTGAATGGGCAAAAACTGG + Intergenic
974370925 4:61015671-61015693 CAGACTGAATGGTCAAAAACTGG + Intergenic
974530982 4:63107650-63107672 CAGAAGGAAAAGCCTAAAATTGG - Intergenic
974658920 4:64861242-64861264 CAGACTGAATGGGCAAAAACTGG - Intergenic
974741206 4:66010303-66010325 CATATTGAATTGGCAAAAGTTGG - Intergenic
974766607 4:66355191-66355213 GAAAATGAATTGCCATAAAAGGG - Intergenic
974774249 4:66459429-66459451 CATACTGAATGGGCAAAAATTGG - Intergenic
974824870 4:67115531-67115553 CATACTGAATAGGCAAAAATTGG + Intergenic
975059035 4:69974340-69974362 CATAATGAATGGCCAAAAACTGG - Intergenic
975524653 4:75335562-75335584 CACACTGAATTGGCAAAAGTTGG + Intergenic
975803410 4:78087317-78087339 CATACTGAATGGACAAAAATTGG + Intronic
975960011 4:79891021-79891043 CATACTGAATGGGCAAAAATTGG - Intergenic
976106400 4:81623582-81623604 CAGAGTGAATTTATAAAAATTGG + Intronic
976925599 4:90491615-90491637 CATACTGAATGGCCAAAAACTGG - Intronic
977227995 4:94416403-94416425 CAAAATTAATATCCAAAAATCGG - Intergenic
977906322 4:102481938-102481960 CATACTGAATGGCCAAAAACTGG + Intergenic
978013106 4:103711536-103711558 CATAATGAATGGGCAAAAACTGG + Intronic
978517444 4:109583661-109583683 CATACTGAATGGGCAAAAATTGG - Intronic
978942374 4:114452066-114452088 CAGAGTGAATGGGCAAAAGTTGG + Intergenic
978957132 4:114627995-114628017 TAGAAATAGTTGCCAAAAATAGG + Intronic
979227854 4:118310422-118310444 TAGAATGAATGGCTAAAATTAGG - Intronic
979510358 4:121546787-121546809 CATACTGAATGGGCAAAAATTGG - Intergenic
979770553 4:124519913-124519935 AAAGATGAATTGTCAAAAATAGG + Intergenic
979911924 4:126378454-126378476 CATACTGAATGGGCAAAAATTGG - Intergenic
980171724 4:129297475-129297497 CAGACTGAATGGGCAAAAACTGG - Intergenic
980340828 4:131544488-131544510 AAGAATGAATTACCCAATATGGG + Intergenic
980415616 4:132484138-132484160 CATACTGAATGGGCAAAAATTGG - Intergenic
980653374 4:135749922-135749944 CATACTGAATGGGCAAAAATGGG - Intergenic
981039687 4:140211662-140211684 CAGAATGAAGGGCTAGAAATAGG - Intergenic
981082357 4:140647962-140647984 CAGAATTAAATGCTAAAAATAGG + Intronic
981325961 4:143447886-143447908 CATACTGAATGGGCAAAAATTGG - Intronic
981479668 4:145225179-145225201 CATACTGAATGGCCAAAAACTGG - Intergenic
981671182 4:147288743-147288765 CATCATGAATTGCCTAAACTGGG - Intergenic
982059373 4:151588718-151588740 CAGAATAAATGGCCAAAATGTGG + Intronic
982298582 4:153855809-153855831 CATACTGAATGGGCAAAAATGGG - Intergenic
982734249 4:158988778-158988800 CATACTGAATGGCCAAAAACTGG + Intronic
982972497 4:162007215-162007237 AAGGATGAATTGCCTAAATTTGG - Intronic
983010960 4:162546517-162546539 CAAAATGAATTGGCAAAAGTGGG - Intergenic
983362753 4:166747527-166747549 CATACTGAATGGCCAAAAACTGG + Intronic
983457568 4:167984131-167984153 CATACTGAATGGGCAAAAATTGG - Intergenic
983464327 4:168068301-168068323 CATAATGAATGGGCAAAAACTGG + Intergenic
983582338 4:169321729-169321751 CAGACTGAATGGGCAAAAACTGG + Intergenic
983964189 4:173789934-173789956 CATAATGAATGGGCAAAAACTGG + Intergenic
984014862 4:174413998-174414020 CATACTGAATGGGCAAAAATTGG - Intergenic
985228400 4:187788182-187788204 TAGAGAGAATTGACAAAAATGGG + Intergenic
985473438 5:62200-62222 CATAATGAATGGGCAAAAACTGG - Intergenic
986013254 5:3736275-3736297 CAGACTGAAGTTCAAAAAATAGG - Intergenic
986489829 5:8277946-8277968 CAGAATGAATTTCCCAACCTTGG - Intergenic
986685268 5:10270845-10270867 CAGAATGAAGGGCCAGAAACAGG - Intergenic
987423870 5:17751701-17751723 CATACTGAATGGGCAAAAATTGG - Intergenic
987635150 5:20529781-20529803 CATAATGAATGGGCAAAAGTTGG + Intronic
987779713 5:22418544-22418566 CATACTGAATGGGCAAAAATTGG - Intronic
987995258 5:25268769-25268791 CATATTGAATGGGCAAAAATTGG - Intergenic
988068039 5:26247887-26247909 AAGAATGTATTGTCCAAAATTGG - Intergenic
988175974 5:27725164-27725186 AAAAATAAATTGCCAAAAACAGG - Intergenic
988328280 5:29799616-29799638 CATAATGAATGGGCAAAAACTGG - Intergenic
988402469 5:30779462-30779484 CATACTGAATTGGCAAAAACTGG + Intergenic
988632889 5:32950076-32950098 CAAAATGAATTTCCAAAAAACGG - Intergenic
988667907 5:33350260-33350282 CATACTGAATGGGCAAAAATTGG - Intergenic
988798484 5:34674434-34674456 AAGAATGAATTGCCAGAAGTTGG - Intronic
988971642 5:36474367-36474389 CATAATGAATGGGCAAAAACTGG + Intergenic
989299435 5:39871902-39871924 CATAATGAATGGGCAAAAACTGG - Intergenic
989344933 5:40419300-40419322 CATAATGAATGGGCAAAAACTGG - Intergenic
989509339 5:42265926-42265948 CATAATGAATGGGCAAAAACTGG - Intergenic
991565511 5:68000142-68000164 GAGTATTAATTGCCAAATATTGG - Intergenic
991634984 5:68695611-68695633 CATACTGAATGGGCAAAAATTGG + Intergenic
991652443 5:68869311-68869333 CAGACTGAATGGGCAAAAACTGG + Intergenic
992356137 5:75985571-75985593 CTTAATGATTTGCCAGAAATGGG + Intergenic
992755981 5:79906332-79906354 CATACTGAATGGGCAAAAATTGG + Intergenic
992815315 5:80431481-80431503 CATACTGAATTGGCAAAAACTGG + Intronic
993043753 5:82844163-82844185 CATACTGAATTGGCAAAAACTGG - Intergenic
993266278 5:85730613-85730635 CATACTGAATGGTCAAAAATTGG - Intergenic
993390620 5:87316313-87316335 CAGAATGCATTTTAAAAAATGGG + Intronic
993420599 5:87696569-87696591 CATACTGAATGGGCAAAAATGGG + Intergenic
993435226 5:87884677-87884699 CATATTGAATGGGCAAAAATGGG - Intergenic
993494896 5:88596936-88596958 CTGACTGAATTGCCACAAAAAGG - Intergenic
994495205 5:100503477-100503499 CATACTGAATTGGCAAAAACTGG + Intergenic
994606597 5:101975211-101975233 CAAAATGCATTGATAAAAATGGG + Intergenic
994635333 5:102339227-102339249 CAACATAATTTGCCAAAAATGGG - Intergenic
995736374 5:115304466-115304488 CAGAATAATTTGCTGAAAATGGG + Intergenic
996593254 5:125172331-125172353 AAGAAAGAAGAGCCAAAAATAGG + Intergenic
996953845 5:129160099-129160121 CATACTGAATGGACAAAAATTGG - Intergenic
997185214 5:131875036-131875058 CATACTGAATGGCCAAAAACTGG + Intronic
997186784 5:131889810-131889832 CATACTGAATGGCCAAAAACTGG - Intronic
997187306 5:131894998-131895020 CATACTGAATGGGCAAAAATTGG - Intronic
997252672 5:132402134-132402156 CATAATGAATGGGCAAAAACTGG + Intergenic
999556164 5:152744845-152744867 CATACTGAATGGCCAAAAACTGG + Intergenic
999557840 5:152764760-152764782 CATACTGAATGGCCAAAAACTGG - Intergenic
1000411985 5:160943175-160943197 CATAATGAATGGGCAAAAACTGG - Intergenic
1000437915 5:161235894-161235916 AACATTGAATAGCCAAAAATAGG - Intergenic
1000704388 5:164492409-164492431 CATACTGAATGGGCAAAAATGGG - Intergenic
1000937437 5:167319909-167319931 CAGAATGAATGGTCAAAGATTGG - Intronic
1001072050 5:168594644-168594666 CATAATGAATGGGCAAAAACTGG - Intergenic
1004257110 6:14074649-14074671 CATAATGGATTGTCATAAATGGG + Intergenic
1004842534 6:19603845-19603867 CAGCATCAATTGCCAGCAATGGG - Intergenic
1005379800 6:25222401-25222423 CAGAAGGGAATGCCAGAAATTGG - Intergenic
1006958489 6:37901128-37901150 CAGAATGAATTGCCAAAAATTGG - Intronic
1007951147 6:45873492-45873514 CAAAATGAAGTAACAAAAATAGG - Intergenic
1008452446 6:51668644-51668666 CATACTGAATGGGCAAAAATTGG - Intronic
1008977584 6:57446066-57446088 CAGAGTGAATTACCAAGAAATGG - Intronic
1009165725 6:60339020-60339042 CAGAGTGAATTACCAAGAAATGG - Intergenic
1009191194 6:60631886-60631908 CATACTGAATTGGCAAAAACTGG - Intergenic
1009304597 6:62072439-62072461 CATAATGAATGGGCAAAAATTGG - Intronic
1009696625 6:67113664-67113686 CAACATGGAATGCCAAAAATAGG + Intergenic
1010139050 6:72592013-72592035 AAGAATCAATTACCAAAAATAGG - Intergenic
1010491907 6:76486864-76486886 CATACTGAATGGGCAAAAATGGG - Intergenic
1010718099 6:79253397-79253419 CATACTGAATGGACAAAAATTGG - Intergenic
1010728707 6:79364987-79365009 CAGACTGAATGGGCAAAAACTGG - Intergenic
1010848964 6:80748262-80748284 CATACTGAATGGGCAAAAATTGG + Intergenic
1010944168 6:81955137-81955159 CATAATGAATGGGCAAAAACTGG - Intergenic
1011086170 6:83543507-83543529 CATACTGAATGGGCAAAAATTGG - Intergenic
1011296457 6:85831472-85831494 CATAATGAATGGACAAAAACTGG - Intergenic
1011858564 6:91726083-91726105 CATAATGAATGGACAAAAACTGG - Intergenic
1011964015 6:93129972-93129994 CAGAATGAGATGTCAAAAACTGG + Intergenic
1012129739 6:95475476-95475498 CATAATGAATGGGCAAAAACTGG + Intergenic
1012578011 6:100827601-100827623 AAGACTTAATTGCCAAAACTTGG - Intronic
1012584909 6:100910219-100910241 CATACTGAATGGGCAAAAATTGG - Intergenic
1013154140 6:107476970-107476992 TAGAATGAATTGCTATAAAGTGG - Intergenic
1013302263 6:108815185-108815207 CATACTGAATGGGCAAAAATTGG - Intergenic
1013714600 6:112944188-112944210 CTGATTGAAATTCCAAAAATTGG - Intergenic
1014113733 6:117649571-117649593 CATACTGAATGGACAAAAATTGG + Intergenic
1014170219 6:118270356-118270378 CAGAATGATGTGCCAGGAATAGG + Intronic
1014220916 6:118797789-118797811 CATACTGAATGGGCAAAAATTGG + Intergenic
1014573420 6:123040149-123040171 AAGAATGATTTGTCAATAATTGG + Intronic
1014936701 6:127394155-127394177 AAAAAAGAAATGCCAAAAATTGG - Intergenic
1014954339 6:127597180-127597202 CATACTGAATTGGCAAAAACTGG + Intergenic
1015056349 6:128907733-128907755 CATACTGAATTGGCAAAAACTGG - Intronic
1015218028 6:130772710-130772732 GAGAATGAATTGGAAAATATAGG - Intergenic
1016125607 6:140399064-140399086 CTGAATGACTTGCCAAATAAAGG - Intergenic
1016333536 6:142979461-142979483 CATACTGAATGGGCAAAAATTGG - Intergenic
1016334666 6:142991602-142991624 GAGTATAAATTGCTAAAAATTGG + Intergenic
1016335230 6:142997787-142997809 CATACTGAATGGGCAAAAATTGG + Intergenic
1016621920 6:146120536-146120558 CATACTGAATTGGCAAAAACTGG - Intronic
1017547051 6:155463672-155463694 CCAAAAGAATTGCTAAAAATAGG - Intergenic
1017973083 6:159329826-159329848 CATAATGAATGGGCAAAAACTGG - Intergenic
1018011495 6:159674639-159674661 CAGACTGAATGGGCAAAAACTGG + Exonic
1018015408 6:159708161-159708183 CATACTGAATGGGCAAAAATTGG + Intronic
1018031797 6:159847025-159847047 CAGAATCGATAGCCAACAATTGG - Intergenic
1018500715 6:164408620-164408642 CTGTATGACTTGCCAAAAATAGG + Intergenic
1019072921 6:169364567-169364589 CAAAATGAAATCTCAAAAATTGG + Intergenic
1021481926 7:21127611-21127633 CAGAATATTTTGCCAAAAAGAGG - Intergenic
1022151955 7:27617518-27617540 CAGAAAGAAGAGCCAAAATTAGG + Intronic
1022432564 7:30340346-30340368 CATAATGAATTGGCAAAAGCTGG - Intronic
1023509051 7:40931020-40931042 CATACTGAATGGCCAAAAACTGG - Intergenic
1023568474 7:41548500-41548522 CAACATAATTTGCCAAAAATGGG - Intergenic
1023645190 7:42304829-42304851 TAGAATGAATTCCTAGAAATGGG + Intergenic
1024817134 7:53284423-53284445 CATACTGAATGGGCAAAAATTGG - Intergenic
1025570119 7:62551931-62551953 CATACTGAATGGGCAAAAATTGG + Intergenic
1028312688 7:89358826-89358848 CAAAATGAAGTGACAGAAATAGG + Intergenic
1028507587 7:91587178-91587200 CATACTGAATGGGCAAAAATTGG + Intergenic
1028801028 7:94966415-94966437 CATAATCAATGGCCAAAAATTGG - Intronic
1030129362 7:106184452-106184474 AAGAATGAAAGGCCAGAAATCGG - Intergenic
1030202834 7:106922844-106922866 CATACTGAATGGACAAAAATTGG + Intergenic
1030647398 7:112078287-112078309 CAGAATGTATTGAGAGAAATGGG - Intronic
1030732647 7:113008257-113008279 CACACTGAATGGGCAAAAATTGG - Intergenic
1030937055 7:115597626-115597648 CATAATGAATAGGCAAAAACTGG + Intergenic
1031673501 7:124580646-124580668 CATAATGAATGGGCAAAAACTGG - Intergenic
1032258838 7:130318308-130318330 CAGTATAAACTGCCAAAACTGGG + Intronic
1032312183 7:130798423-130798445 CATACTGAATGGGCAAAAATGGG - Intergenic
1032704121 7:134407309-134407331 TAGAATGAACTTCAAAAAATAGG + Intergenic
1033763264 7:144460289-144460311 AATAATGAATTGCCAAAAGCAGG + Intronic
1034156037 7:148956856-148956878 CAGATTAAATAGCCAACAATAGG - Intergenic
1034402369 7:150871467-150871489 CAGAAATCATTGCCTAAAATTGG - Intergenic
1034744652 7:153513252-153513274 CAGAATTATTTGGCAAAGATTGG - Intergenic
1036211772 8:6847182-6847204 CATACTGAATGGACAAAAATTGG - Intergenic
1036235021 8:7031988-7032010 AAGAATCCATTGCCAAACATAGG - Intergenic
1036504595 8:9343941-9343963 CATAATGAATTACCACAAACTGG - Intergenic
1038090832 8:24251226-24251248 TAGAATGATTTTCAAAAAATTGG + Intergenic
1038110039 8:24486254-24486276 CAGAATTAATTTCCAAAAAGAGG - Intronic
1040403756 8:47079541-47079563 CATACTGAATTGGCAAAAACTGG + Intergenic
1040443340 8:47467749-47467771 CATACTGAATGGACAAAAATGGG + Intronic
1041156158 8:54989045-54989067 CATACTGAATTGGCAAAAACTGG + Intergenic
1041204137 8:55480444-55480466 CATACTGAATGGGCAAAAATTGG + Intronic
1041311726 8:56524262-56524284 CAGTCTGACTTCCCAAAAATAGG - Intergenic
1041973205 8:63767149-63767171 CATACTGAATGGGCAAAAATTGG - Intergenic
1042005409 8:64174443-64174465 TAGAATGCAATGCCAGAAATAGG - Intergenic
1042630671 8:70812334-70812356 CAGACTGAATGGGCAAAAACTGG + Intergenic
1043442719 8:80290515-80290537 AAGAAGCAACTGCCAAAAATAGG + Intergenic
1043929863 8:86078359-86078381 CATACTGAATTGGCAAAAACTGG + Intronic
1044469505 8:92550234-92550256 TAGATGGAATTGCCAACAATCGG - Intergenic
1045108240 8:98914662-98914684 CAGAATGGATTTCTAAACATGGG + Intronic
1045530864 8:102984172-102984194 CAGAATGAATTAACAGAAAAGGG - Intergenic
1045619298 8:103955643-103955665 CATACTGAATTGTCAAAAACTGG + Intronic
1046007333 8:108502396-108502418 CATACTGAATGGACAAAAATTGG - Intergenic
1046255357 8:111689920-111689942 CATACTGAATGGGCAAAAATTGG - Intergenic
1046429339 8:114103628-114103650 CAGACTGAATGGGCAAAATTTGG + Intergenic
1047538426 8:125740790-125740812 CATACTGAATGGGCAAAAATTGG - Intergenic
1047736621 8:127771237-127771259 CATACTGAATGGCCAAAAACTGG - Intergenic
1048312333 8:133335135-133335157 CACAAAGTAATGCCAAAAATAGG + Intergenic
1048597916 8:135885993-135886015 CATACTGAATTGGCAAAAACTGG - Intergenic
1048913683 8:139161560-139161582 CATACTGAATGGGCAAAAATTGG - Intergenic
1049890509 9:65805-65827 CAGAATGAACTGACACAAACAGG + Intergenic
1050009193 9:1169027-1169049 CTGAATGAATTGCCCTAACTAGG + Intergenic
1050329894 9:4535100-4535122 CATACTGAATGGGCAAAAATTGG + Intronic
1050590715 9:7157452-7157474 CATAATGAATGGACAAAAACTGG - Intergenic
1050954351 9:11636047-11636069 CATACTGAATGGGCAAAAATTGG - Intergenic
1050956178 9:11663638-11663660 ATGAATTAATTGCCAAGAATTGG - Intergenic
1050968214 9:11835354-11835376 CAGAGAGGGTTGCCAAAAATGGG - Intergenic
1050989758 9:12135335-12135357 CACAATGAATGGACAAAAGTTGG + Intergenic
1051102834 9:13541638-13541660 CATAATGAATGGGCAAAAACTGG - Intergenic
1051141480 9:13984172-13984194 CAGTGTGAATTACCAAAAAATGG + Intergenic
1051808244 9:21021271-21021293 CATACTGAATTGGCAAAAACTGG + Intronic
1052155058 9:25177079-25177101 TATAATAAATTGCCACAAATTGG - Intergenic
1052290611 9:26836050-26836072 CATACTGAATGGGCAAAAATTGG + Intergenic
1052667642 9:31515485-31515507 CATAATGAATGGGCAAAAACTGG - Intergenic
1053533093 9:38900878-38900900 CAGATTGAATTAGAAAAAATTGG + Intergenic
1053731973 9:41066988-41067010 CAGAATGAACTGACACAAACAGG + Intergenic
1054205319 9:62125307-62125329 CAGATTGAATTAGAAAAAATTGG + Intergenic
1054633042 9:67463063-67463085 CAGATTGAATTAGAAAAAATTGG - Intergenic
1054696483 9:68364730-68364752 CAGAATGAACTGACACAAACAGG - Intronic
1054953167 9:70876695-70876717 CAGAATGAATTTCTGATAATCGG + Intronic
1054958108 9:70936474-70936496 CAGGCTGCATTGCTAAAAATGGG + Intronic
1056274533 9:84981015-84981037 AAGAATGAGTTACCAAAATTGGG - Intronic
1056449260 9:86699644-86699666 AAGAATGATTTGGCAAAATTTGG + Intergenic
1056773147 9:89494182-89494204 CAAAATGAATTTTCAAAAAGTGG - Intronic
1057151122 9:92797004-92797026 CAGATTGAATTAGAAAAAATTGG - Intergenic
1057272140 9:93657404-93657426 CAGAAGGAAGTGCCCAAGATGGG + Intronic
1057857207 9:98610814-98610836 CAGAACAAATTGCCACAAACAGG - Intronic
1058075631 9:100647793-100647815 CATACTGAATGGGCAAAAATTGG + Intergenic
1059076676 9:111200566-111200588 CAGACTGAATGGGCAAAAACTGG + Intergenic
1059369518 9:113815772-113815794 AAGAATGAATTCCCAGAAAAAGG - Intergenic
1059616670 9:115958931-115958953 CATACTGAATGGCCAAAAACTGG - Intergenic
1059818320 9:117943750-117943772 AAGATGGAATTGCCAAAAAAAGG + Intergenic
1060036141 9:120257378-120257400 GAGAAGGAATTCCCAACAATTGG + Intergenic
1060673219 9:125488844-125488866 CAGAAAGAAGTGCCTAAAAATGG + Intronic
1061045211 9:128161075-128161097 CAGAATTAAATGCAAAAAAAAGG + Intronic
1062720034 9:138036022-138036044 CAGAATCAACTGCAAAACATAGG - Intronic
1203573044 Un_KI270744v1:150289-150311 CAAAATGAATTGCATAAAATCGG - Intergenic
1185920273 X:4083671-4083693 CAGAAAGCATGGCCAAAAACAGG - Intergenic
1187020795 X:15379352-15379374 ATGAATGAATTGTCAAATATTGG + Intronic
1187231056 X:17423622-17423644 CAGATAGAATTGCCAGAAACTGG - Intronic
1187431740 X:19231272-19231294 CATACTGAATGGCCAAAAACTGG + Intergenic
1187436505 X:19275460-19275482 CATACTGAATGGCCAAAAACTGG - Intergenic
1187705046 X:22001537-22001559 CATACTGAATGGCCAAAAACTGG - Intergenic
1188319843 X:28722690-28722712 CATACTGAATGGCCAAAAACTGG - Intronic
1188470752 X:30536645-30536667 CATACTGAATTGGCAAAAGTTGG + Intergenic
1188860450 X:35249583-35249605 AAGAATGAATTGACAGAAGTAGG + Intergenic
1189205658 X:39236447-39236469 CAGAATGTATTTCCAAGAGTAGG - Intergenic
1191063551 X:56323681-56323703 CATAATGAATGGGCAAAAACTGG + Intergenic
1191063881 X:56327059-56327081 CATAATGAATGGGCAAAAACTGG - Intergenic
1191073372 X:56426153-56426175 CATACTGAATGGGCAAAAATGGG - Intergenic
1191124475 X:56939988-56940010 CATAATGAATGGGCAAAAACTGG - Intergenic
1191125632 X:56950835-56950857 CATAATGAATGGGCAAAAACTGG - Intergenic
1191180788 X:57561405-57561427 CACACTGAATGGGCAAAAATTGG + Intergenic
1191756970 X:64603543-64603565 CATACTGAATTGGCAAAAACTGG - Intergenic
1191798873 X:65055184-65055206 CATACTGAATGGGCAAAAATTGG - Intergenic
1191809649 X:65173520-65173542 CATACTGAATGGCCAAAAGTTGG - Intergenic
1192243556 X:69354784-69354806 CATAATGAATAGGCAAAAACTGG + Intergenic
1192532319 X:71899171-71899193 CAGACTGAATGGGCAAAAACTGG - Intergenic
1192613270 X:72589470-72589492 CATACTGAATGGGCAAAAATTGG + Intronic
1192692464 X:73378708-73378730 CATACTGAATGGCCAAAATTTGG + Intergenic
1192851133 X:74957286-74957308 CAGACTGAATGGGCAAAAACTGG + Intergenic
1192857877 X:75033329-75033351 CACAATGAATGGGCAAAAACTGG - Intergenic
1192927531 X:75771039-75771061 CATACTGAATAGCCAAAAACTGG - Intergenic
1193064826 X:77248175-77248197 CATACTGAATTGGCAAAAACTGG + Intergenic
1193343403 X:80378965-80378987 CATAATGAATGGGCAAAAACTGG - Intronic
1193588953 X:83363795-83363817 CATAATGAATGGGCAAAAACTGG - Intergenic
1193611621 X:83638818-83638840 CATAATGAAGTGCCACAAACTGG + Intergenic
1193906606 X:87252887-87252909 GAGAAAGAATTGCCAAAATGAGG - Intergenic
1193944953 X:87723660-87723682 CAGTATGTATAGTCAAAAATAGG - Intergenic
1194246192 X:91514646-91514668 CAGACTGAATGGGCAAAAACGGG + Intergenic
1194673124 X:96759908-96759930 CAGATTAAAATGCAAAAAATTGG + Intronic
1194952114 X:100138847-100138869 CATAATGAATGGGCAAAAACTGG + Intergenic
1194963255 X:100259518-100259540 CATAATGAATGGGCAAAAACTGG + Intergenic
1195293890 X:103456646-103456668 CATACTGAATGGCCAAAAACTGG - Intergenic
1195718955 X:107847463-107847485 CGGAAAGAATTGACAAAACTTGG + Intronic
1195768102 X:108318266-108318288 CATAATGAATGGGCAAAAACTGG + Intronic
1195947806 X:110233872-110233894 CATAATGAATGGGCAAAAACTGG + Intronic
1195970620 X:110469196-110469218 CATAATGAATGGGCAAAAACTGG - Intergenic
1195978105 X:110549686-110549708 CATAATGAATGGGCAAAAACTGG + Intergenic
1195995510 X:110727823-110727845 TAGAATGAATTCTTAAAAATAGG - Intronic
1196063470 X:111436690-111436712 CAAGAAAAATTGCCAAAAATTGG + Intergenic
1196394384 X:115243651-115243673 CATAATGAATGGGCAAAAACTGG - Intergenic
1196418820 X:115501670-115501692 AAGAATGAAAAGCCAAAAACAGG - Intergenic
1196468472 X:115996731-115996753 CATAATGAATTGGCAAAAGTTGG - Intergenic
1196853938 X:119965245-119965267 CAGACTGAATGGGCAAAAACTGG + Intergenic
1197008546 X:121533304-121533326 CATACTGAATGGGCAAAAATGGG - Intergenic
1197469430 X:126849442-126849464 CATACTGAATGGACAAAAATTGG + Intergenic
1197582577 X:128302394-128302416 CATAATGAATTGGCAAAAGCTGG + Intergenic
1197618648 X:128722049-128722071 CAGACTGCATTGCCAAATTTGGG - Intergenic
1197672336 X:129291976-129291998 CATACTGAATGGGCAAAAATTGG + Intergenic
1197868648 X:131045077-131045099 CAGAAAGAATCCCCAAAAATGGG - Intergenic
1197928062 X:131667862-131667884 CATAATGAATGGGCAAAAACTGG + Intergenic
1199167365 X:144692764-144692786 CATACTGAATGGCCAAAAGTTGG - Intergenic
1199306697 X:146275463-146275485 CACAATGAATGGGCAAAAGTTGG - Intergenic
1199809416 X:151334228-151334250 CAGACTGAATGGGCAAAAACTGG + Intergenic
1200431915 Y:3094057-3094079 CAGAAGAAATTGCAAAACATTGG + Intergenic
1200492838 Y:3849710-3849732 CCTAAAGAATTTCCAAAAATAGG - Intergenic
1200732229 Y:6754772-6754794 CATACTGAATGGACAAAAATTGG - Intergenic
1200743560 Y:6881487-6881509 CATACTGAATGGCCAAAAACTGG + Intergenic
1200759582 Y:7025688-7025710 CAGAATCAATTACTAAAATTAGG - Intronic
1200839218 Y:7763221-7763243 CATACTGAATGGCCAAAAATTGG + Intergenic
1200905382 Y:8476572-8476594 CATACTGAATGGGCAAAAATTGG - Intergenic
1201309187 Y:12579668-12579690 CATACTGAATGGGCAAAAATGGG - Intergenic
1201350633 Y:13037095-13037117 CATAATGAATGGGCAAAAACTGG + Intergenic
1201778377 Y:17691453-17691475 CATACTGAATGGACAAAAATTGG - Intergenic
1201823179 Y:18214539-18214561 CATACTGAATGGACAAAAATTGG + Intergenic
1201939048 Y:19439055-19439077 CATACTGAATGGGCAAAAATTGG + Intergenic
1202034389 Y:20616951-20616973 CATAATGAATGGGCAAAAACTGG - Intergenic
1202091959 Y:21200614-21200636 CATAATGAATAGGCAAAAACTGG - Intergenic
1202241840 Y:22778957-22778979 CATACTGAATTGGCAAAAACTGG + Intergenic
1202394824 Y:24412701-24412723 CATACTGAATTGGCAAAAACTGG + Intergenic
1202475960 Y:25257391-25257413 CATACTGAATTGGCAAAAACTGG - Intergenic
1202525988 Y:25760139-25760161 CATACTGAATTGGCAAAAACTGG + Intergenic