ID: 1006963568

View in Genome Browser
Species Human (GRCh38)
Location 6:37959001-37959023
Sequence CTGGGTCATTACCCATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006963562_1006963568 10 Left 1006963562 6:37958968-37958990 CCTGCCATAGATTTTATCACCAA 0: 1
1: 0
2: 1
3: 6
4: 166
Right 1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG No data
1006963561_1006963568 17 Left 1006963561 6:37958961-37958983 CCAAATTCCTGCCATAGATTTTA 0: 1
1: 0
2: 0
3: 14
4: 263
Right 1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG No data
1006963563_1006963568 6 Left 1006963563 6:37958972-37958994 CCATAGATTTTATCACCAACATC 0: 1
1: 0
2: 3
3: 16
4: 193
Right 1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG No data
1006963566_1006963568 -9 Left 1006963566 6:37958987-37959009 CCAACATCTTTCCTCTGGGTCAT 0: 1
1: 1
2: 0
3: 20
4: 226
Right 1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006963568 Original CRISPR CTGGGTCATTACCCATTTGT TGG Intronic
No off target data available for this crispr