ID: 1006968384

View in Genome Browser
Species Human (GRCh38)
Location 6:38013747-38013769
Sequence AGGTGTAACCTGGACATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006968384_1006968391 16 Left 1006968384 6:38013747-38013769 CCTCCAATGTCCAGGTTACACCT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1006968391 6:38013786-38013808 AAGTATTTGGAATGGAAGCCAGG No data
1006968384_1006968389 3 Left 1006968384 6:38013747-38013769 CCTCCAATGTCCAGGTTACACCT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1006968389 6:38013773-38013795 ACACGTGGAATCAAAGTATTTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1006968384_1006968390 8 Left 1006968384 6:38013747-38013769 CCTCCAATGTCCAGGTTACACCT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1006968390 6:38013778-38013800 TGGAATCAAAGTATTTGGAATGG 0: 1
1: 0
2: 2
3: 29
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006968384 Original CRISPR AGGTGTAACCTGGACATTGG AGG (reversed) Intronic
901263135 1:7888398-7888420 AGGTTGAACCTGGACTCTGGGGG - Intergenic
903537461 1:24076464-24076486 AGATGGAACCTGGTGATTGGTGG - Intronic
903939119 1:26916697-26916719 ACCTGTAATCTGGACTTTGGGGG + Intronic
907744428 1:57198738-57198760 ACGTGTAAGCTGGACTCTGGAGG + Intronic
908696618 1:66849483-66849505 AATTGAAACCTGGACATTTGGGG - Intronic
917146503 1:171897451-171897473 AGGTCTATCCTTGACATTTGTGG - Intronic
919484190 1:198126992-198127014 AGGAGATACCTGAACATTGGTGG - Intergenic
1063875438 10:10472634-10472656 AGTTGTAAACTAGACATTGAAGG + Intergenic
1065518623 10:26550936-26550958 GGGTCTAACCTGGACTTAGGAGG - Intronic
1067085576 10:43236545-43236567 AGGTGTATGCTGGCCAGTGGAGG - Intronic
1068961596 10:62872056-62872078 AGCTTCAACCTGGGCATTGGAGG + Intronic
1072410042 10:95193505-95193527 AGGTGTAACTTGGTTACTGGTGG - Intergenic
1072434250 10:95400994-95401016 AGGTGTAAGCAGGAAGTTGGGGG + Intronic
1078503666 11:11910837-11910859 AATTGAAACCTGGACATTTGGGG - Intronic
1096865250 12:54558726-54558748 AGATGGCACCTGGATATTGGTGG - Intronic
1097430048 12:59494186-59494208 AGCTGAAATCTGGACATTAGTGG + Intergenic
1101881944 12:108631667-108631689 AGGTGTAACTTGGTTCTTGGTGG - Intronic
1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG + Intronic
1111784557 13:92770739-92770761 AGCTGAAACCCGGACATTTGGGG + Intronic
1113034005 13:106028439-106028461 AGGTGTGACCTGTACATAAGGGG - Intergenic
1127250572 15:57232760-57232782 CGATGAAAGCTGGACATTGGTGG - Exonic
1128438855 15:67683674-67683696 AGCTTGAACCTGGGCATTGGAGG + Intronic
1131173167 15:90192448-90192470 AGATGTAGCCTGGACACTGCTGG + Intronic
1131438070 15:92438771-92438793 AGGTACATTCTGGACATTGGAGG - Intronic
1133750484 16:8721410-8721432 AGGTGTGACCTGGGCACCGGGGG - Intronic
1138453678 16:57108487-57108509 AGTTGGAACCTGGCCATTGTTGG + Intronic
1139675083 16:68518018-68518040 AGATGTAATCTGGTCATTGCAGG + Intergenic
1146922759 17:36724384-36724406 AGGTGTTTCCTGGGCATTCGTGG + Intergenic
1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG + Intergenic
1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155202607 18:23530456-23530478 AGGTTTATCCGGGGCATTGGTGG + Exonic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1163904058 19:20135947-20135969 AGGTGTTAACTGCACATTTGTGG + Intergenic
1163936041 19:20444839-20444861 AGGTTTTACCTGCACATTTGTGG - Intergenic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
1164102268 19:22067383-22067405 AGGTGTTACCTGCATATTTGTGG - Intronic
1164140675 19:22459221-22459243 AGGTGGTACCTGCACATTTGTGG - Intronic
1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG + Intronic
1166145668 19:40833200-40833222 AGATGTAACATGGCTATTGGAGG + Intronic
1166149777 19:40864102-40864124 AGATGTAACATGGCTATTGGAGG + Intronic
925435363 2:3832788-3832810 AGGTATACACTAGACATTGGGGG - Intronic
926548882 2:14276495-14276517 AATTGTGACCTGGACATTGTAGG + Intergenic
928000930 2:27522560-27522582 ATGTGCAACCTGGACATGGCAGG - Exonic
934169131 2:89324922-89324944 TGCTCTAACCTGGACATAGGTGG - Intergenic
934198162 2:89857662-89857684 TGCTCTAACCTGGACATAGGTGG + Intergenic
934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG + Intergenic
939743409 2:145938245-145938267 CGCTGTAACATGGAAATTGGAGG - Intergenic
944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG + Intergenic
945367407 2:208972652-208972674 AGGTGAAATCTGGCGATTGGTGG - Intergenic
948511629 2:238470002-238470024 AGTTGTATCCTGGACATTTTGGG + Intergenic
1170947695 20:20906356-20906378 TGATGTCACCTTGACATTGGAGG - Intergenic
1173422881 20:42918286-42918308 AGCTGTTACCTGGAGATGGGGGG - Intronic
1174209057 20:48862489-48862511 AGGCAGAACCTGCACATTGGTGG + Intergenic
1174961127 20:55158685-55158707 AGTTGAAACCTGGCCATTTGGGG + Intergenic
1178864953 21:36319827-36319849 AGGTTTCACATGGACACTGGTGG + Intergenic
1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG + Intergenic
1181908029 22:26215274-26215296 AGGTGTTACATGCACAATGGTGG + Intronic
1181939687 22:26465517-26465539 AGGGATAATCTGGACATTCGGGG + Exonic
1183591140 22:38779944-38779966 AGATGTAACCTGGACAAGCGGGG + Intronic
950340132 3:12236220-12236242 AGGTTAAACCTGGATATTAGGGG + Intergenic
958663329 3:97101601-97101623 AGGTGTATCCCTGACATTGGAGG - Intronic
961187736 3:124930707-124930729 AGGTGTGCCCTGGACAGGGGTGG - Intronic
963853979 3:150235433-150235455 AGGTGTAAGCTGGACCTTGGAGG + Intergenic
965783683 3:172314493-172314515 AGGGGATACCTGGACATTAGTGG - Intronic
966657063 3:182371194-182371216 AGGTGCAGCCTGGGCATTGTGGG - Intergenic
967229842 3:187327133-187327155 AGGTGTATCCCTGACAGTGGAGG + Intergenic
967724377 3:192848005-192848027 AGCTGTAACATTAACATTGGTGG + Intronic
969254682 4:5993967-5993989 AGGTGTCACCTGGGAAGTGGGGG + Intergenic
974233688 4:59152243-59152265 ACTTGTAACCTAGCCATTGGAGG + Intergenic
977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG + Intronic
978655904 4:111065038-111065060 AGGGGAAAACAGGACATTGGTGG + Intergenic
978863558 4:113480451-113480473 AGGTGCAACATGGACTTTGTAGG - Intronic
990149804 5:52803580-52803602 AGCTGCAACCTGGACACTGAGGG - Exonic
991666703 5:69006577-69006599 TGGTGCAACCTGGACCTTGCTGG - Intergenic
998228293 5:140343511-140343533 AGCTATAAACAGGACATTGGGGG - Intronic
1001686244 5:173597009-173597031 AGGGTGCACCTGGACATTGGTGG - Intergenic
1003422197 6:5968632-5968654 GGGTGTGGCCTGGGCATTGGGGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007694246 6:43721975-43721997 AGGTCTATCCTGGGCATTGTAGG + Intergenic
1008248691 6:49210181-49210203 AGATGTAACCTGAATATTGTGGG + Intergenic
1010734592 6:79429428-79429450 AGGGGAAACCTAGACACTGGAGG - Intergenic
1012931422 6:105321452-105321474 CGGTTTAACCTGGACATTCCAGG + Intronic
1021968567 7:25945858-25945880 AGGTGCCAGCTGGATATTGGAGG - Intergenic
1024707148 7:51972888-51972910 AGGTTTAACCTGGAAGCTGGGGG - Intergenic
1025803137 7:64806483-64806505 AGGTGTCATCTGTACATTGTGGG - Intronic
1025866113 7:65382741-65382763 AAGTGTTACCTGCACATTTGTGG - Intronic
1026497655 7:70917584-70917606 AGGTGTGAACTGGATATTGGAGG - Intergenic
1029860077 7:103561689-103561711 AGGTGTGACCGGGGCTTTGGTGG - Exonic
1030195549 7:106849769-106849791 ATGTGTCACCTAGACAATGGCGG + Intergenic
1033652393 7:143352875-143352897 GGGAGTAACCTGGACACTGGAGG - Intergenic
1035067706 7:156120438-156120460 ACGTGTAACCTGGACTCAGGTGG + Intergenic
1036411875 8:8509578-8509600 AGGTATAACTTGGTAATTGGTGG + Intergenic
1037223319 8:16552943-16552965 CGGGGTAACCTGGACATTCTAGG + Intronic
1038891770 8:31733624-31733646 AGGTGTAACCTGGACTTTTCTGG - Intronic
1044290888 8:90468023-90468045 AGTTGACCCCTGGACATTGGTGG - Intergenic
1049642523 8:143721977-143721999 AGATTTGAACTGGACATTGGAGG - Intronic
1053345658 9:37376500-37376522 ATAGGTAACCTAGACATTGGGGG - Intergenic
1056924836 9:90825639-90825661 AAGGGTAGCCTGGACAGTGGAGG + Intronic
1057210650 9:93199297-93199319 AGGACTATCCTTGACATTGGGGG - Intronic
1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG + Intronic
1060043024 9:120317918-120317940 AGGAATAATCTGAACATTGGGGG - Intergenic
1060543473 9:124447196-124447218 AGGTGTAACCTGGGTGCTGGGGG + Intergenic
1061193101 9:129093703-129093725 AGGTGTAGCCCAGACAATGGAGG - Intergenic
1203548682 Un_KI270743v1:151125-151147 AGGTGAAATCTGGAGATGGGTGG + Intergenic
1185737442 X:2503991-2504013 GGGTGCAACCTGCACACTGGGGG - Intergenic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1189680738 X:43513406-43513428 AGGTGCAACCTGGAAATATGGGG + Intergenic
1190447789 X:50546959-50546981 AGTTGAAACTTGGACATTTGGGG - Intergenic
1190447820 X:50547221-50547243 AGTTGAAACTTGGACATTTGAGG - Intergenic
1193483700 X:82059875-82059897 ATGTTGAACCTGGACACTGGAGG + Intergenic
1194575579 X:95610496-95610518 AGGTGGAACATGGAAATTGGTGG - Intergenic
1199795597 X:151192301-151192323 AGGTGCCACCTGGACAGTGTTGG - Intergenic