ID: 1006968389

View in Genome Browser
Species Human (GRCh38)
Location 6:38013773-38013795
Sequence ACACGTGGAATCAAAGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006968384_1006968389 3 Left 1006968384 6:38013747-38013769 CCTCCAATGTCCAGGTTACACCT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1006968389 6:38013773-38013795 ACACGTGGAATCAAAGTATTTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1006968385_1006968389 0 Left 1006968385 6:38013750-38013772 CCAATGTCCAGGTTACACCTCAT 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1006968389 6:38013773-38013795 ACACGTGGAATCAAAGTATTTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1006968386_1006968389 -7 Left 1006968386 6:38013757-38013779 CCAGGTTACACCTCATACACGTG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1006968389 6:38013773-38013795 ACACGTGGAATCAAAGTATTTGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006968389 Original CRISPR ACACGTGGAATCAAAGTATT TGG Intronic
900917572 1:5649523-5649545 ACCCGTGGAATCCAAGGATTCGG - Intergenic
902583680 1:17425300-17425322 ACACAAGGAATCAAAGAAGTAGG + Intronic
907577036 1:55535832-55535854 AGACGTGGAATCAAACTAAATGG + Intergenic
910534096 1:88276764-88276786 CCACGTAGAATCAGAATATTTGG + Intergenic
910724468 1:90323993-90324015 ACACGTTCAATGAAAGAATTTGG - Intergenic
915583089 1:156827521-156827543 ACACGTGTAATCTCAGCATTTGG - Intronic
918758017 1:188361367-188361389 ACAGGTGGAACCAAAGTGCTGGG + Intergenic
919369527 1:196706191-196706213 ATACCTGGAATCAGAGTAATCGG - Intronic
919722708 1:200856434-200856456 ATACCTGGAATCCCAGTATTAGG - Intronic
922683561 1:227620989-227621011 ACACCTGGAATCCCAGTATTTGG + Intronic
924369819 1:243335850-243335872 ACAAGTGGGAGCTAAGTATTAGG - Intronic
1063330054 10:5148629-5148651 ACACGTGAAAACAAAGCAGTAGG + Intergenic
1063410518 10:5833316-5833338 AAACGTGGCAACAAAGTACTGGG - Intronic
1068198590 10:53751133-53751155 ACAGGTGGAAACAAGGGATTTGG - Intergenic
1069666230 10:70162076-70162098 ACACCTGGAATCCCAGCATTTGG + Intronic
1073978835 10:109131337-109131359 ACCCATGGGATCAAATTATTGGG + Intergenic
1074380823 10:112978961-112978983 AAAAGTGGAATCATAGCATTAGG - Intronic
1074492234 10:113948425-113948447 ACACGTTGAATGACAATATTTGG + Intergenic
1081287386 11:41287749-41287771 ACAACTGGACTCAAAATATTAGG - Intronic
1082918573 11:58466804-58466826 ACACCTGTAATCCCAGTATTTGG + Intergenic
1085261956 11:75211077-75211099 GCACATGGAATCAAAGCTTTTGG - Intergenic
1086724034 11:90159688-90159710 ACACCTGGAATCCCAGCATTTGG + Intronic
1088468045 11:110163138-110163160 AAACGTGGAATCAAAACACTTGG + Intronic
1092313514 12:7384308-7384330 ACACCCAGAATCCAAGTATTTGG - Intronic
1095840487 12:46686316-46686338 ACACATGGATGCAAATTATTGGG - Intergenic
1098563041 12:71899831-71899853 ACACCTGTAATCCCAGTATTTGG + Intronic
1101505344 12:105341328-105341350 ACACTTGGTGTCAAAGAATTAGG - Intronic
1102047298 12:109837503-109837525 ACACCTGTAATCATAGCATTTGG + Intergenic
1104550752 12:129754994-129755016 AAACTTGGAATCAAAGCAGTTGG + Intronic
1105004715 12:132714276-132714298 ACACGTGTAATCCCAGCATTTGG - Intronic
1111750438 13:92324270-92324292 ACTTGTGGAATGAATGTATTTGG + Intronic
1112275293 13:98012227-98012249 AAACCTGTAACCAAAGTATTGGG - Exonic
1114486811 14:23067753-23067775 TCACCTGGATTCCAAGTATTGGG - Intronic
1117357049 14:54934484-54934506 AAAAGTGGAATCAAAATATGTGG + Intergenic
1117925141 14:60771055-60771077 ATACGTAGAATAAAACTATTAGG + Intronic
1120213681 14:81659339-81659361 ACACGTGGCATCAAAGTTTCTGG + Intergenic
1120625125 14:86816007-86816029 ACAAGTGGAATCTAAACATTGGG + Intergenic
1120810109 14:88793876-88793898 ACTCCTGTAATAAAAGTATTGGG + Intergenic
1122216744 14:100209504-100209526 ACACCTGTAATCCAAGCATTTGG - Intergenic
1125989128 15:44088509-44088531 ACACATGGAATCAAAACATGTGG - Intronic
1127435387 15:58952357-58952379 ACACCTGTAATCACAGCATTTGG + Intronic
1128904971 15:71459022-71459044 ACACTTGGATTGAAAATATTTGG + Intronic
1129013712 15:72446686-72446708 ACACCTGTAATCACAGTATTTGG - Intergenic
1131533640 15:93215755-93215777 ACACGTGGCTTTAAAGTGTTGGG + Intergenic
1138253945 16:55535672-55535694 ACAGGTAGTATGAAAGTATTTGG + Intronic
1139077608 16:63471858-63471880 TGACTTGGAATCAAAGTCTTTGG - Intergenic
1147338749 17:39741584-39741606 ACACGTGGAGGCAAAGGAGTGGG + Intronic
1147913650 17:43873418-43873440 ACACCTGGAAGCACAGGATTGGG + Intergenic
1154300671 18:13188781-13188803 AAAGGTGAAATCCAAGTATTAGG + Intergenic
1155556893 18:27029783-27029805 ATACGTGGATTTAAAATATTTGG - Intronic
1157738421 18:50071083-50071105 ACACCTGTAATCTCAGTATTTGG - Intronic
1158954586 18:62525589-62525611 ACCCGTGGAATCAATGGATTTGG + Intronic
1159702560 18:71647511-71647533 ACATGTAGAATCAAACTATTAGG + Intergenic
1159814901 18:73060758-73060780 ACACTTGGACTCAAATTCTTAGG + Intergenic
1159896237 18:73999097-73999119 ACACATGGAGTCAAAATAATAGG - Intergenic
1161876417 19:6914601-6914623 AGAGGTGGAAATAAAGTATTTGG + Intronic
1162627791 19:11899387-11899409 ACAAGTGGAATCCAGGCATTTGG - Intronic
1162640231 19:12002771-12002793 ACACCTGTAATCCAACTATTTGG + Intergenic
1165211445 19:34239171-34239193 ACACCTGGAAGCAATATATTTGG - Intergenic
1165783152 19:38445456-38445478 AGACTTGGGGTCAAAGTATTGGG - Intronic
926046063 2:9710531-9710553 ACAGGTGGAAACTAAGTACTAGG + Intergenic
926429517 2:12772014-12772036 ACACGTGTAATCCCAGCATTTGG + Intergenic
928376739 2:30781075-30781097 ACCTGTGAAATCAAAGTAGTGGG - Intronic
929531127 2:42753570-42753592 ACACGTGGAGACACAGGATTTGG - Exonic
939506226 2:143050921-143050943 AACCTGGGAATCAAAGTATTAGG + Exonic
942833793 2:180267747-180267769 ACAAGTGGAAACTAAATATTGGG - Intergenic
943336919 2:186626670-186626692 ACAGGTAGGATCAAAGTGTTGGG - Intronic
943849960 2:192706817-192706839 ACACATGAGAGCAAAGTATTTGG - Intergenic
946137758 2:217662075-217662097 ACCCCAGGAAGCAAAGTATTTGG - Intronic
1173461378 20:43246035-43246057 ACACGTTGAATGACAGAATTGGG + Intergenic
1174576350 20:51540557-51540579 ACACGGGGAAACAGGGTATTGGG + Intronic
1183164554 22:36137916-36137938 ACACTAGGAATCAAAGTGTGTGG + Intergenic
1183170856 22:36187066-36187088 ACACTAGGAATCAAAGTGTGTGG + Intergenic
1185059154 22:48597066-48597088 ACACCTGGAATCCCAGCATTTGG - Intronic
950049086 3:9972642-9972664 ACACCTGTAATCCAAGTACTCGG + Intronic
951194712 3:19811416-19811438 CAATGTGGAATCAAAATATTGGG + Intergenic
956356681 3:68401344-68401366 ACAAGTGTATTCAAAGTATCAGG - Intronic
957576036 3:82009785-82009807 CCTGGTGGAATCAAAGTGTTGGG + Intergenic
959307446 3:104687509-104687531 ACAGGTGGAACCTAAGTGTTTGG - Intergenic
963766245 3:149339002-149339024 ATAAGTGGAAACTAAGTATTAGG - Intergenic
966119753 3:176508665-176508687 AGAGGTAGAAACAAAGTATTTGG + Intergenic
968603891 4:1522482-1522504 AGACCTGGACTCAAAGTATTTGG - Intergenic
970694874 4:18665524-18665546 GCATATGGAATCAAAGTCTTAGG - Intergenic
972163320 4:36252055-36252077 ACAAGTGGAAGCTAAGCATTGGG + Intergenic
974237364 4:59199257-59199279 ACACCTGTAATCCCAGTATTTGG - Intergenic
976603811 4:86963920-86963942 ACACCTGTAATCATAGCATTTGG - Intronic
976768695 4:88627067-88627089 ACACATGGAATTAAAGTTTGTGG - Intronic
977545455 4:98371373-98371395 ACACCTGGAATCCCAGGATTTGG - Intronic
980835418 4:138186123-138186145 TAACGTGGAATCAAATTATTAGG - Intronic
982187016 4:152812918-152812940 ACAACTGGAATCAAAGTTGTGGG - Intronic
987177425 5:15329103-15329125 ACACATAGAATCAAAGAACTTGG + Intergenic
988721904 5:33887538-33887560 ACAAGGCAAATCAAAGTATTTGG - Intronic
989735879 5:44705267-44705289 ACACGTGCAAACAAAGTAGGAGG + Intergenic
989762714 5:45038132-45038154 ACACTTGGAATAGAAGTGTTCGG + Intergenic
990166456 5:52999066-52999088 ACAAGATGAATGAAAGTATTAGG + Intronic
990190179 5:53250790-53250812 TCTCCTGGAATCAAGGTATTTGG - Intergenic
993390907 5:87319059-87319081 AGACATGGAATCAAAGGATATGG - Intronic
993621009 5:90167788-90167810 ACACCTGTAATCAGAGTTTTTGG + Intergenic
994711921 5:103276081-103276103 ACACATGGACTCTAACTATTTGG + Exonic
994950109 5:106451092-106451114 ACACTTGTAATCACAGTATTTGG - Intergenic
995046943 5:107661234-107661256 ACATGTTGAATAAAATTATTGGG + Intronic
1000388719 5:160700932-160700954 AAAAGAGGAATCAAAGTCTTGGG - Intronic
1001175623 5:169466056-169466078 ACACATGGAATCAGATAATTTGG - Intergenic
1002305835 5:178282331-178282353 ACCCCTGGTATCAAAGTGTTAGG - Intronic
1002989034 6:2220913-2220935 ACACCTGGAATCCAAGCATTTGG + Intronic
1003230946 6:4253290-4253312 GCACGTGGAAGCAGAGAATTAGG + Intergenic
1003790059 6:9536125-9536147 ACACCTGTAATCCCAGTATTTGG - Intergenic
1006336449 6:33423504-33423526 ATACGGGGAATGAACGTATTGGG - Exonic
1006968389 6:38013773-38013795 ACACGTGGAATCAAAGTATTTGG + Intronic
1008506808 6:52238517-52238539 GAACGTGGAAGCAAAATATTAGG + Intronic
1010301461 6:74265107-74265129 AAATGTGGAATCCAGGTATTAGG - Intergenic
1013011799 6:106127310-106127332 ACACGTGTAATCTCAGCATTTGG + Intergenic
1014388545 6:120831948-120831970 ACACCTGTAATCCCAGTATTTGG + Intergenic
1014914245 6:127126222-127126244 ACACCTGGGATTAGAGTATTAGG + Intronic
1015753121 6:136581198-136581220 ATAAGTGGAATTACAGTATTTGG + Intronic
1017705018 6:157114260-157114282 ACACCTGTAATCCCAGTATTTGG + Intronic
1020536872 7:9409745-9409767 ACATCTAGGATCAAAGTATTGGG - Intergenic
1021640594 7:22732826-22732848 AAACATGCAATCAAAGTCTTTGG + Intergenic
1022202638 7:28132392-28132414 ACTCGTGGGAACAAAGTATCAGG + Intronic
1026156758 7:67833093-67833115 ATAAGTGGAATAAAAGTTTTAGG - Intergenic
1026217776 7:68364826-68364848 ACACCTGGAATCTCAGTACTTGG - Intergenic
1029567173 7:101346766-101346788 ACACCTGTAATCCCAGTATTTGG + Intergenic
1030717579 7:112828052-112828074 AGATGTGGAATCCAAGTATATGG + Intronic
1036824933 8:11968567-11968589 AGACCTTGAATCAAAGTCTTTGG - Intergenic
1036994237 8:13636350-13636372 ACTCACTGAATCAAAGTATTTGG + Intergenic
1037199000 8:16226866-16226888 ACAACTGGAAGCAAAATATTTGG - Intronic
1050990666 9:12147687-12147709 ACACTAGGAATAAAAGTATAGGG + Intergenic
1056282291 9:85053292-85053314 AAACAGGGAATCAAAGTCTTGGG - Intergenic
1058288371 9:103208127-103208149 AGAAGTGAAACCAAAGTATTGGG + Intergenic
1186441193 X:9588058-9588080 AACCGTGGATTGAAAGTATTTGG + Intronic
1187851894 X:23599258-23599280 ACAAGTGAAGTCAAAGTCTTGGG + Intergenic
1188830423 X:34890240-34890262 ACACCTGTAATCCCAGTATTTGG + Intergenic
1189666732 X:43363642-43363664 ACACCTTGAATTAAAGTAGTAGG - Intergenic
1189956391 X:46278826-46278848 AGATGTGAAATAAAAGTATTTGG + Intergenic
1190633213 X:52409670-52409692 ACAGGCGGAAACAAAATATTAGG - Intergenic
1192754101 X:74028018-74028040 ACACATGGACTGAAAGTAATGGG + Intergenic
1195428018 X:104757251-104757273 ACAAAAGGAATCAAAGTTTTGGG + Intronic
1198543428 X:137665565-137665587 AGACTTCCAATCAAAGTATTTGG + Intergenic