ID: 1006968391

View in Genome Browser
Species Human (GRCh38)
Location 6:38013786-38013808
Sequence AAGTATTTGGAATGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006968388_1006968391 -4 Left 1006968388 6:38013767-38013789 CCTCATACACGTGGAATCAAAGT 0: 1
1: 0
2: 3
3: 16
4: 198
Right 1006968391 6:38013786-38013808 AAGTATTTGGAATGGAAGCCAGG No data
1006968386_1006968391 6 Left 1006968386 6:38013757-38013779 CCAGGTTACACCTCATACACGTG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1006968391 6:38013786-38013808 AAGTATTTGGAATGGAAGCCAGG No data
1006968385_1006968391 13 Left 1006968385 6:38013750-38013772 CCAATGTCCAGGTTACACCTCAT 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1006968391 6:38013786-38013808 AAGTATTTGGAATGGAAGCCAGG No data
1006968384_1006968391 16 Left 1006968384 6:38013747-38013769 CCTCCAATGTCCAGGTTACACCT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1006968391 6:38013786-38013808 AAGTATTTGGAATGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006968391 Original CRISPR AAGTATTTGGAATGGAAGCC AGG Intronic
No off target data available for this crispr