ID: 1006972517

View in Genome Browser
Species Human (GRCh38)
Location 6:38061291-38061313
Sequence AAGGGTAATCAGAAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 603}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006972517_1006972521 0 Left 1006972517 6:38061291-38061313 CCTTTTTCCTTCTGATTACCCTT 0: 1
1: 0
2: 5
3: 60
4: 603
Right 1006972521 6:38061314-38061336 AAATTTTTAACATGCGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006972517 Original CRISPR AAGGGTAATCAGAAGGAAAA AGG (reversed) Intronic
901946554 1:12708706-12708728 AAGAGAATTCAGTAGGAAAATGG - Intergenic
902248971 1:15140875-15140897 AGGGGTGAACAGCAGGAAAAGGG + Intergenic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903445025 1:23417324-23417346 AAGGCAAAGAAGAAGGAAAAAGG - Exonic
903911557 1:26730232-26730254 AAAGGTATTCAGAAGCATAAAGG - Intronic
904317080 1:29672510-29672532 AAAGGCAAGCAGGAGGAAAAGGG + Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
904838953 1:33358135-33358157 AGGGTTAATAAGGAGGAAAAAGG + Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905035247 1:34913990-34914012 AGGGAGAATAAGAAGGAAAAAGG + Intronic
905061589 1:35144346-35144368 AAAGAGAATCAGAAGGAAACAGG - Intergenic
905787480 1:40769891-40769913 AGGGGAAAGCAGAGGGAAAAGGG - Intronic
905806300 1:40880176-40880198 AAGGAGAATCAGAAGGGAAGGGG - Intergenic
906176253 1:43775711-43775733 AAGGGTATGCACAAGAAAAAGGG - Intronic
907675383 1:56513168-56513190 AAGAGTAACCTGAAGAAAAATGG + Intronic
907956246 1:59230914-59230936 AAGAGTAATTATAAGGACAATGG - Intergenic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908100296 1:60784183-60784205 AATTGTAAACAGAAGGAACAAGG - Intergenic
909090854 1:71223674-71223696 AAGAGTAATGAGAAGTAACATGG + Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909356776 1:74718638-74718660 AAGGGTAACTAGAAGGAGAGAGG - Intronic
910387108 1:86696462-86696484 AATGTTAATCAGTAAGAAAATGG - Intergenic
911035060 1:93533831-93533853 AAGGGTAATTAGAGAGAAGAGGG - Intronic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
913654338 1:120946908-120946930 ACTGGTAATCAGAATGAAACAGG - Intergenic
914245792 1:145885196-145885218 AAGGGTTAGCAGAAGGCACAGGG + Intronic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
914520027 1:148407039-148407061 ACTGGTAATCAGAATGAAACAGG - Intergenic
914644535 1:149641068-149641090 ACTGGTAATCAGAATGAAACGGG - Intergenic
914814965 1:151056576-151056598 GAGGGAAATCAGGAGGAATAGGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915769690 1:158407321-158407343 AAGGGTAATTTAAAGGAAATGGG + Intergenic
916102936 1:161408268-161408290 AAAGAGAATCAGAAGGAAACAGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916411308 1:164549843-164549865 AAAGTAAATCAGAAGGAAAGGGG - Intergenic
916628316 1:166583781-166583803 AAGGGTAATTACAAGCAAAAAGG + Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
917988237 1:180344199-180344221 AATGGTAATTAGAAGGAATGGGG + Intronic
918091536 1:181299464-181299486 AAAGGTGAACAGAAAGAAAAGGG - Intergenic
918823007 1:189283384-189283406 AGAGGTTATCAGAAAGAAAATGG + Intergenic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
920269958 1:204755330-204755352 AAGAGGAACAAGAAGGAAAAAGG - Intergenic
920586394 1:207166974-207166996 ACAGGGAAACAGAAGGAAAAGGG - Intergenic
920716760 1:208347358-208347380 AAGGGTTATCATAAGGAAGATGG - Intergenic
921266981 1:213429039-213429061 AAGGGTAGTGAGAAGAAAAGGGG - Intergenic
921657830 1:217761941-217761963 AATGGTAATCAGAAGGTGACGGG - Intronic
922032709 1:221818220-221818242 AAGGCCTATCAGAAGAAAAATGG + Intergenic
923235774 1:232031422-232031444 AAGGGAAAGGAGAAGGGAAAAGG + Intronic
923460288 1:234204103-234204125 AATGTTCATCAGAAGGGAAATGG - Intronic
924251436 1:242137065-242137087 AGGGGAAAACAGAAAGAAAAAGG + Intronic
924494597 1:244575142-244575164 AAGGAAAATCAGAAAGAAACAGG - Intronic
924735414 1:246751075-246751097 AAGAGAATTCTGAAGGAAAATGG - Intronic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1063938079 10:11099560-11099582 AAGTGGAAACAGAAGGAAATCGG - Intronic
1064619062 10:17195869-17195891 AAGAGTAACTAGAAGGAAAGAGG + Intronic
1064756362 10:18575055-18575077 AAGAGAATTCAGAATGAAAATGG + Intronic
1065285470 10:24183385-24183407 AAGGACAATCAGAAGAAAAGAGG - Intronic
1066563720 10:36697559-36697581 AAGAGTAATAAGCAGGAAAGGGG + Intergenic
1066594454 10:37034657-37034679 AAGGGGAATGACAAAGAAAATGG - Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068067224 10:52147202-52147224 AAGGGTAGACAAAAGAAAAATGG + Intronic
1068490333 10:57715322-57715344 AAGGATAATTATAAGAAAAAAGG - Intergenic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069224044 10:65919401-65919423 AATTGTAATTAAAAGGAAAATGG - Exonic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071189166 10:83080314-83080336 AAGAGTAATCAACAAGAAAACGG - Intergenic
1071932482 10:90487969-90487991 AAGGGAAATCAGTAGCGAAAAGG - Intergenic
1072096058 10:92181479-92181501 AATGGCAACCAGAAGGAAGACGG + Intronic
1072786151 10:98284171-98284193 AATGGTAATAATAAGGATAATGG - Intergenic
1073657587 10:105434183-105434205 TAAGGAAATCAGAAGGAACAGGG - Intergenic
1073822845 10:107284872-107284894 TAAGCTAATCAGAATGAAAATGG + Intergenic
1074013607 10:109509403-109509425 AAAGCTAATCAGGAGGAAGAGGG - Intergenic
1074427479 10:113364644-113364666 AAAGGAAATCAGAATGCAAAAGG - Intergenic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1076234385 10:128852477-128852499 AAGGGTAGTCAGCTGGAAAATGG + Intergenic
1076464003 10:130666051-130666073 AAGGGTAATCAGAAGTCATGGGG + Intergenic
1076640316 10:131911523-131911545 AAGGGAAAGAAAAAGGAAAAAGG - Intronic
1077383032 11:2255707-2255729 AAGGGAAATCAGTAGAGAAAGGG + Intergenic
1077769370 11:5198351-5198373 AAGGTTAATTTGAAGGATAAAGG - Intergenic
1078464589 11:11540873-11540895 CTGGGTTGTCAGAAGGAAAATGG + Intronic
1078618336 11:12885131-12885153 AAGATTAAACAGAAGGAAACAGG + Intronic
1078652411 11:13207900-13207922 AAGGGCAATCAGCAGGCAGAAGG - Intergenic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079745454 11:24122721-24122743 AAGGGGATTCAGAGAGAAAAAGG - Intergenic
1079801338 11:24873503-24873525 AAGGGTTATCTGAAGGAAAAAGG - Intronic
1080187159 11:29503729-29503751 AAGGGAAATTAAAAGGACAAAGG - Intergenic
1080315063 11:30938505-30938527 AAAGGAAATCAGAAAGAGAAAGG - Intronic
1081101467 11:39007299-39007321 AATGTTAATCATCAGGAAAATGG - Intergenic
1081348475 11:42019556-42019578 AAGGATAATGAGAATAAAAAAGG + Intergenic
1082044908 11:47717436-47717458 AAGGCTGAAGAGAAGGAAAATGG - Exonic
1082976135 11:59074335-59074357 AAGGTTAATCATAAACAAAAAGG - Intergenic
1085816080 11:79738851-79738873 AAGGGGAAGGAGACGGAAAAGGG + Intergenic
1086066420 11:82749962-82749984 AAGAGTATTCAGTAGTAAAAAGG + Intergenic
1086156741 11:83675469-83675491 AGGTTTAATCAGAAGTAAAAAGG + Intronic
1086170586 11:83831924-83831946 AAGGGAAATTAGAAGGAAGGGGG + Intronic
1086477127 11:87189103-87189125 AAGGGAAAGGAAAAGGAAAAGGG - Intronic
1086890249 11:92249254-92249276 AACGATGATCAGAAGGAGAATGG + Intergenic
1086987396 11:93265556-93265578 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1087407096 11:97744186-97744208 AAGGATATTTAGAAGGAAAAAGG + Intergenic
1087491236 11:98829734-98829756 AATAGTAATTAAAAGGAAAATGG - Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1088226842 11:107629895-107629917 AAGGGAAAGCAGAGGGAAAGAGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089917879 11:122176598-122176620 AAGGGTAATCAGGATTTAAAAGG + Intergenic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1091545077 12:1496178-1496200 GAGGGTAGAAAGAAGGAAAAAGG - Intergenic
1091759092 12:3075760-3075782 AAGGGAGATCAGAAGGAAATGGG + Intergenic
1092296512 12:7203401-7203423 AAGGGAAAGCAGATAGAAAAAGG - Intronic
1092625764 12:10326584-10326606 AAGGCTAATCAGAAACAAAAAGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093001214 12:13998657-13998679 TAGAGTAAGCACAAGGAAAAAGG - Intergenic
1093180979 12:15966681-15966703 AGGGGTAATCAGAAACAGAAAGG - Intronic
1093385738 12:18551078-18551100 AATGGTATTTAGAGGGAAAATGG + Intronic
1093406258 12:18808550-18808572 CAGAGTGATCAGCAGGAAAATGG + Intergenic
1093612031 12:21172625-21172647 AAGAAAAATCAGAAGGAAAGGGG - Intronic
1094214266 12:27923748-27923770 AAGTGTATTCACAAGGAAGATGG + Intergenic
1095671545 12:44866377-44866399 AAGGGAAATTAGAAGGAAAGGGG + Intronic
1095861902 12:46926524-46926546 AAGTTTAAAAAGAAGGAAAAAGG + Intergenic
1095993648 12:48059018-48059040 AAGTGCAACGAGAAGGAAAAAGG - Intronic
1096844035 12:54395677-54395699 AAGGGGAATCAGAACTCAAATGG - Exonic
1097278116 12:57826880-57826902 AAGAGTGATTAGAAGGGAAAAGG - Intronic
1097997784 12:65908490-65908512 AAGGGTAATAACAAAGAGAAAGG - Intronic
1098092259 12:66916154-66916176 AAGCCTAATAAAAAGGAAAATGG + Intergenic
1098117812 12:67199092-67199114 AGAGGTTATCAGAAGAAAAATGG - Intergenic
1098839369 12:75460094-75460116 AAGGGTGAGGGGAAGGAAAATGG + Intergenic
1099132270 12:78849611-78849633 AAGGTCAATGAGAATGAAAATGG - Intergenic
1100244666 12:92745166-92745188 AAGCTTAAACAGAAGTAAAAGGG + Intronic
1100315751 12:93442578-93442600 CAGGGTAGGCTGAAGGAAAAGGG + Intergenic
1100346815 12:93739891-93739913 ATTGGTAATGAGGAGGAAAATGG - Intronic
1100559414 12:95733165-95733187 AATGGTAATAAGAGGGAATATGG - Intronic
1100845218 12:98651513-98651535 TAGGGTAATGAGCAGTAAAATGG - Intronic
1100861330 12:98810465-98810487 ACGGGTACTTCGAAGGAAAAGGG - Intronic
1100976320 12:100125929-100125951 AAATGGAATCACAAGGAAAAGGG + Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1101473567 12:105021953-105021975 ATGGGGAATTAGAAGGAAAGTGG + Exonic
1101801078 12:108022397-108022419 ATGGGTAAGCAGATGGGAAATGG - Intergenic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102929672 12:116852519-116852541 AAGGGGAAGCAGAGGGAAATGGG + Intronic
1103670494 12:122610697-122610719 AAGGCAGATCAGAAGGATAATGG - Intronic
1103811163 12:123615048-123615070 TAGGGGAATGACAAGGAAAATGG - Intronic
1103868843 12:124076257-124076279 AAGTGAAATCAGAAGGCCAAGGG - Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104258296 12:127159613-127159635 AAGGCTAATCAGAAAGTCAAAGG - Intergenic
1104499296 12:129269377-129269399 AAGGGAAAGGAGAAGGCAAAGGG - Intronic
1105765602 13:23555467-23555489 AATGGTGACCATAAGGAAAATGG + Intergenic
1106481212 13:30138316-30138338 GAGGGTAAAAAGAGGGAAAAGGG + Intergenic
1107104719 13:36630753-36630775 AAGGGTACTCAGAAGAAATAGGG + Intergenic
1107635835 13:42391815-42391837 AAGGGTCATCAGAAGCCAAGAGG - Intergenic
1107696787 13:43008127-43008149 AAAGGGCAGCAGAAGGAAAAGGG + Intergenic
1109620884 13:64903064-64903086 AGGGGAAAACATAAGGAAAAAGG + Intergenic
1110081466 13:71319254-71319276 AAAGATAAGCAAAAGGAAAAGGG - Intergenic
1110088342 13:71411295-71411317 AAGGGGAATGAGAATGAAAGGGG - Intergenic
1110466359 13:75806702-75806724 ATATGTAATCAGCAGGAAAAAGG - Intronic
1110660588 13:78055938-78055960 AAGGGGAATCCATAGGAAAAGGG - Intergenic
1110700560 13:78542842-78542864 AAAGGGAAAAAGAAGGAAAAAGG + Intergenic
1110773831 13:79382975-79382997 AAAAGTTATCACAAGGAAAAAGG + Intronic
1111648140 13:91057675-91057697 AAGGGAAAGGAAAAGGAAAAGGG + Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112146888 13:96709900-96709922 AAAGGTAATCATAAGAAAGATGG - Intronic
1112601130 13:100856924-100856946 AAGTGTACTGAGGAGGAAAAAGG - Intergenic
1112786053 13:102953012-102953034 AAGGGCTTTCAGAAGGAAAGTGG + Intergenic
1112847362 13:103660502-103660524 AAGGGTATTCACTGGGAAAAAGG - Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1112906821 13:104432921-104432943 CAGGGCAATAAGAAAGAAAATGG - Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113525345 13:110970405-110970427 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1113975044 13:114221313-114221335 AAGGGCCTTCAGGAGGAAAAAGG - Intergenic
1114145949 14:19978773-19978795 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1114607717 14:24011339-24011361 AAGAGAAATCAGAAAGAGAAAGG - Intergenic
1115178727 14:30596905-30596927 GAGGGTACTCAGAAGGAAACAGG - Intronic
1116004547 14:39278318-39278340 TAGGGAAGTCAGAAGTAAAAGGG - Intronic
1116201248 14:41799952-41799974 AAGGGAAAGAAAAAGGAAAAGGG + Intronic
1116537088 14:46045602-46045624 AATGGAAATCAAAAGGAAACAGG - Intergenic
1116695047 14:48164289-48164311 AAGGGTAATCAGAAGAAGCCTGG - Intergenic
1116912081 14:50479209-50479231 AAGGGACAACAGAAGAAAAAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117058023 14:51932807-51932829 AATGTTAATTATAAGGAAAAAGG + Intronic
1117494146 14:56285192-56285214 AATGGTAACCAGAACCAAAATGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118558120 14:67049191-67049213 AAACTTAATCAGCAGGAAAAAGG - Intronic
1120322819 14:82987566-82987588 AAGGTTGATAAGATGGAAAATGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121593267 14:95137174-95137196 AAGGGGAAGGAGAAGGAAAAGGG + Intronic
1121593287 14:95137248-95137270 AGGGGAAATAAAAAGGAAAATGG + Intronic
1121593317 14:95137346-95137368 AAGGGAAAGAGGAAGGAAAAGGG + Intronic
1121593367 14:95137500-95137522 AAGGGGAAGGGGAAGGAAAAGGG + Intronic
1121847849 14:97189566-97189588 GAGAGGAATCAGAAGGAAAAGGG - Intergenic
1122382641 14:101320415-101320437 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1122667130 14:103338377-103338399 AAGGGCAAAGACAAGGAAAATGG + Exonic
1122700421 14:103584736-103584758 ACGGGAAATCAGAAAGACAAAGG - Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124434786 15:29638129-29638151 AAGGGAAATCAAAAGGAATCTGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124637328 15:31373555-31373577 AAGGAGAAGCAGGAGGAAAAGGG - Exonic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1125690165 15:41589656-41589678 AAGAGAATTCAGAAGGAAAGTGG + Intergenic
1125916119 15:43489116-43489138 TAACGTAATCAGAAGGATAAGGG - Intronic
1126107567 15:45156761-45156783 AAGGTTAAGGAGAAGGAAAGGGG - Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126471537 15:49017057-49017079 AAAGTCAATCATAAGGAAAAAGG + Intronic
1127840498 15:62827341-62827363 AAGAGAAATCAGAAGAGAAAAGG + Intronic
1128303610 15:66583097-66583119 AAGGGTGACCAGAAGCAAACTGG - Intronic
1128926713 15:71662934-71662956 AAGGGAAGGCAGAGGGAAAATGG + Intronic
1129541669 15:76354627-76354649 AAAGGTAATTCTAAGGAAAATGG + Intronic
1131150129 15:90042572-90042594 TTGGATGATCAGAAGGAAAAAGG + Intronic
1131355771 15:91744880-91744902 AAGGGTGATGAGAAAGAAAGAGG - Intergenic
1132102297 15:99032959-99032981 AAGGGAAATCAGCAAGAAAGGGG + Intergenic
1132734851 16:1380137-1380159 AAGTGTAAGATGAAGGAAAATGG + Intronic
1133081033 16:3320419-3320441 AAGGCTAGGCAGAATGAAAATGG - Intergenic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133342977 16:5049981-5050003 AAATGAAATCAGAAAGAAAAAGG + Intronic
1133593001 16:7264220-7264242 AAGGTAAATATGAAGGAAAAAGG + Intronic
1133960748 16:10491381-10491403 AAGAGAATTCAGAAAGAAAATGG + Intergenic
1134563329 16:15229516-15229538 AAGGGTAATAGGAATGAAAATGG + Intergenic
1134923856 16:18141144-18141166 AAGGGTAATAGGAATGAAAATGG + Intergenic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1136345980 16:29676328-29676350 TAGGGTACCCAGAAGGAAAAGGG + Intronic
1136594617 16:31239514-31239536 AAGGTTAATCAGAGGAAAAGGGG + Intergenic
1137789213 16:51160656-51160678 AAGTATAATAACAAGGAAAAAGG - Intergenic
1138624920 16:58243821-58243843 AAGGGGTTTAAGAAGGAAAAAGG + Intronic
1138908322 16:61365458-61365480 TAGGGAAATCAGAAGAGAAAGGG - Intergenic
1139002737 16:62533105-62533127 AAGAGTAATCTCTAGGAAAACGG + Intergenic
1139369482 16:66457903-66457925 AATGGTGAACAGAGGGAAAATGG + Intronic
1141208549 16:81955124-81955146 AAGAGTAAGCAGAGGTAAAATGG - Intronic
1141844793 16:86600679-86600701 GATAGTAATCAGAAGGATAATGG - Intergenic
1142485309 17:243937-243959 AAGGGTAATCAGTAGAGGAAGGG - Intronic
1142835522 17:2583178-2583200 AAGTGTAATCAGTAGGTGAAAGG - Intergenic
1143071424 17:4297683-4297705 AATGATAATCAGAAGACAAAGGG - Intronic
1143349653 17:6277943-6277965 AGGGCTCATTAGAAGGAAAAAGG - Intergenic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145296406 17:21596046-21596068 AAGGGAAAGAAAAAGGAAAATGG + Intergenic
1145891056 17:28416082-28416104 AGGGGTAGTGAGAAGGCAAAAGG + Intergenic
1145997770 17:29114414-29114436 GAGAGGATTCAGAAGGAAAATGG - Intronic
1146414491 17:32619467-32619489 AACCATAATCAGAAGGAAAATGG - Intronic
1146603789 17:34240628-34240650 AAGGGTTCTCAGCAGGGAAATGG + Intergenic
1146606914 17:34268416-34268438 AAGGATTTTCTGAAGGAAAAAGG + Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1148104226 17:45110806-45110828 GAGGATAATCAGAATCAAAAGGG - Exonic
1149399910 17:56285452-56285474 AAGTGGAATAAGGAGGAAAAAGG - Intronic
1150126343 17:62637721-62637743 GAGGGTAATCAGAAGGTCACAGG - Intronic
1150332889 17:64308653-64308675 AAGGGTGATGAGAAGAAGAAGGG - Intergenic
1150893163 17:69178203-69178225 AAGGATAATAAGAAACAAAAAGG + Intronic
1151056179 17:71033879-71033901 AAGGGTGATGAAAAAGAAAAAGG + Intergenic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1152827904 17:82479117-82479139 AAGGTTAAGAAGAAAGAAAAAGG - Intronic
1153563313 18:6394063-6394085 AAGGGTAGTGAGAAGGAGAGGGG - Intronic
1153705356 18:7739556-7739578 ATGGGAAAGCAAAAGGAAAATGG - Intronic
1154463079 18:14616344-14616366 AAGAGAATTTAGAAGGAAAATGG + Intergenic
1155704423 18:28791088-28791110 AAGGATAATCACACGGAGAAAGG + Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156357667 18:36356476-36356498 AATAAAAATCAGAAGGAAAAAGG - Intronic
1156390646 18:36647695-36647717 AAGGGTCATCAGAAGTAGAATGG + Intronic
1156393590 18:36676124-36676146 AAGGGAAATCAAAGGGATAAGGG - Intronic
1156689670 18:39692395-39692417 AAGGGAAAGAAGGAGGAAAAAGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156940226 18:42758486-42758508 AAGGGTTATCAAAAAAAAAAAGG - Intronic
1157645952 18:49271358-49271380 AATGGTAATAAGATGGAAAAAGG + Intronic
1157815337 18:50725814-50725836 AAGGGTCTTGAGAAAGAAAATGG + Intronic
1158762452 18:60405923-60405945 AAGGGGAAGAAGAAAGAAAAGGG + Intergenic
1158786026 18:60712670-60712692 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1159197928 18:65142695-65142717 AAGGATAATTACAAGAAAAAAGG - Intergenic
1159334074 18:67040785-67040807 AAATGTAATCCAAAGGAAAAGGG + Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1160076310 18:75680814-75680836 AAGGGTAATGATAAGGACACAGG + Intergenic
1160131737 18:76231431-76231453 CAGACTAATCAGAAGGAAATGGG - Intergenic
1160676579 19:394395-394417 AAGGATAATGAGAAGGACAATGG + Intergenic
1162151873 19:8651869-8651891 AAGGGTAGTGAGGAGGAAGAGGG - Intergenic
1162267968 19:9591547-9591569 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
1163953655 19:20613996-20614018 AACGGAAATCAGAAAGAAACAGG + Intronic
1164675581 19:30098227-30098249 ATGGGTAATCTGAAGGATCAAGG - Intergenic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165584461 19:36901757-36901779 AAGGGTGGTGAGAAGAAAAAGGG + Intronic
1166264559 19:41670880-41670902 AAGTGCAATGAGAAGGAAATAGG - Intronic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166808733 19:45502408-45502430 ATGAGTAATAAGAAGGAAAGAGG - Intronic
1167859234 19:52269847-52269869 AAGGGTTTTAAGCAGGAAAACGG - Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
925062427 2:903575-903597 AGGGTAAATCAGAAGGAAGAAGG - Intergenic
925285425 2:2712635-2712657 AAGGGTAATTTAAAGGAAAGGGG - Intergenic
925369957 2:3337051-3337073 AAGGGTAAAAAGAAGGGAAGGGG + Intronic
925997843 2:9306580-9306602 AAGGTTGATGAGAAGGAAAATGG + Intronic
926829849 2:16949888-16949910 AAGGGAGATCAAAATGAAAAAGG - Intergenic
927650124 2:24907588-24907610 AAGAGTCATCAGACAGAAAATGG + Intronic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928584988 2:32750464-32750486 ACATGAAATCAGAAGGAAAAGGG + Intronic
929050314 2:37830953-37830975 AAGAGAAATCAGAAAAAAAATGG - Intergenic
929481213 2:42310281-42310303 AAGGGGAATGGGAAGGGAAAGGG - Intronic
929606003 2:43234636-43234658 AAGGGAAAAAAGAAAGAAAAAGG - Intronic
929846071 2:45529298-45529320 AAATGTAGTCAGAAGGAAGATGG + Intronic
929913706 2:46115846-46115868 AAGAGAAAACAGAAGGCAAAGGG - Intronic
930310414 2:49732555-49732577 AAAGTTAATCAGCAAGAAAATGG - Intergenic
931117140 2:59177162-59177184 ATGGGGAATCAGCAGGAAAGAGG - Intergenic
931495013 2:62796111-62796133 AATGGTAATCAGGATAAAAATGG + Intronic
931502206 2:62881473-62881495 AAGGGGAAGGGGAAGGAAAAAGG + Intronic
931506575 2:62934398-62934420 AAAGTTAATCAATAGGAAAAGGG - Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932945636 2:76226627-76226649 AAGGGTAATGAAAAGCAAATGGG + Intergenic
933389626 2:81653448-81653470 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
933473176 2:82754010-82754032 AATGATACTCAGAAGGAAAAGGG + Intergenic
933537914 2:83600553-83600575 AAGATTGATCAGAAGAAAAATGG + Intergenic
933549965 2:83763922-83763944 AAGGGTCATCAGTAGTACAATGG - Intergenic
934043107 2:88146529-88146551 AAGGAAAATGAGGAGGAAAATGG - Intergenic
934506044 2:94895381-94895403 AAGAGTAATCAGAGGTAAAGTGG - Intergenic
934671746 2:96218200-96218222 CAGGGTCATCAGAAAGTAAAGGG - Intergenic
934932774 2:98441810-98441832 ACGGGTAATCAGAATGGAACAGG + Intergenic
936716490 2:115192554-115192576 AAGAGAATTCAGAAGGAAACTGG - Intronic
936719407 2:115232523-115232545 AAGGGAAATCAGAAGGCACAAGG - Intronic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938696069 2:133836768-133836790 AAAGGTATCCAGAAGGAAAAGGG - Intergenic
938929491 2:136074261-136074283 ATGGGATATCAGAAGGGAAAAGG - Intergenic
938952441 2:136267350-136267372 GAAGGTACTCAGAAGGAAAAAGG - Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
939385788 2:141495352-141495374 CATGGTAATGAGCAGGAAAATGG + Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939567290 2:143800066-143800088 AATGCTAATCAGAAGGAAAAGGG + Intergenic
940352648 2:152706375-152706397 AAGAGAATTCAGAAGGAAAACGG + Intronic
940439136 2:153693632-153693654 AAGGGCAAGCAGGAGGATAAGGG + Intergenic
940614287 2:156030761-156030783 AAGGTTAAGGAGAAGGATAATGG + Intergenic
940833337 2:158492733-158492755 AAAGGTACGCAGGAGGAAAATGG - Intronic
940833387 2:158493459-158493481 TAGGGTAACCACATGGAAAATGG - Intronic
940839759 2:158566697-158566719 AAGAGGTATCACAAGGAAAATGG - Intronic
941958105 2:171225447-171225469 AAGGGGAAAAAAAAGGAAAAAGG + Intronic
942423725 2:175837064-175837086 AAGAGTAATCAAAAGAAGAATGG + Intergenic
942942232 2:181631778-181631800 AAGGGGAAAGAGAAGGAAATGGG + Intronic
943406453 2:187493467-187493489 AATGTTAATCACCAGGAAAATGG - Intronic
943627376 2:190215701-190215723 AAAGGAAATCAGAAAGATAAAGG + Intronic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
943957172 2:194207452-194207474 AAGGGTGATTATAAGGAAACAGG - Intergenic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945778891 2:214142510-214142532 AAGGGTAAGCACAAAGAAAGAGG - Intronic
946340401 2:219062941-219062963 AAGGATAATCAGCAGGATAATGG - Intergenic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946554952 2:220845962-220845984 AAGGGAAATGGAAAGGAAAAGGG + Intergenic
946990110 2:225318863-225318885 AAAGATAATCAGAAGACAAATGG - Intergenic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948201365 2:236131892-236131914 AAGGTAAATCAGAGAGAAAAGGG + Intergenic
948321231 2:237071507-237071529 AAGGGTTATCAGGAAGAACATGG + Intergenic
948834084 2:240616185-240616207 AGAGGCAAACAGAAGGAAAAAGG - Intronic
1168822939 20:788176-788198 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1169617078 20:7460276-7460298 AAGGCAGATCAGAAGGCAAAAGG - Intergenic
1169762784 20:9114565-9114587 AGTAGTAATTAGAAGGAAAAAGG - Intronic
1170494461 20:16911838-16911860 AAGGGTAGCCAGAGAGAAAAAGG - Intergenic
1170657012 20:18297198-18297220 AAGTGAAATAAGAAGTAAAAAGG - Intronic
1170721191 20:18880355-18880377 AAGGGTAATCAATAGGAAACAGG - Intergenic
1170795213 20:19541234-19541256 AATGGTAATAACAAGGATAATGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1172089214 20:32415760-32415782 AAGAGTAAGGGGAAGGAAAAAGG - Intronic
1172163922 20:32887156-32887178 ATGGATAATCAGAAGGGATAGGG - Intronic
1172609578 20:36240061-36240083 AAGGCTAATCCGAAGGAAGTAGG + Exonic
1172675774 20:36670676-36670698 AAATGTTATCTGAAGGAAAATGG - Intronic
1172911713 20:38414446-38414468 AAGTGAAATAAGAAGGAAAGAGG - Intergenic
1173061175 20:39662769-39662791 AAAGGTAAGCTGATGGAAAAAGG - Intergenic
1173787391 20:45804336-45804358 AAGGATGAACAGAAGGAAATAGG - Intronic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174515010 20:51085071-51085093 TAAGGTACTCAGAAGTAAAAAGG + Intergenic
1174940765 20:54924034-54924056 AAGGGTATGAAGAGGGAAAAGGG + Intergenic
1175591359 20:60194428-60194450 AAAGGTAATGAGAGGGAAAATGG - Intergenic
1175614997 20:60390466-60390488 AAAGGGAAGCAGAAGGGAAACGG - Intergenic
1176739386 21:10585962-10585984 AAGACTACTCAGAAGAAAAAAGG - Intronic
1176811446 21:13542027-13542049 AAGAGAATTTAGAAGGAAAATGG - Intergenic
1177211283 21:18075007-18075029 AAATGTAATCACAAAGAAAAGGG + Intronic
1177301326 21:19249278-19249300 TTGGGTACTCAGGAGGAAAAGGG - Intergenic
1178234398 21:30824532-30824554 AAGGAAAATCACAAAGAAAAAGG + Intergenic
1178267806 21:31160300-31160322 AAGGGTATCCAGAGGGTAAAAGG + Intronic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183610578 22:38901307-38901329 AAGGGATTTAAGAAGGAAAAAGG - Intergenic
1183611207 22:38907619-38907641 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1184064498 22:42109743-42109765 AAGAAAACTCAGAAGGAAAATGG - Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
949133936 3:539440-539462 CATGTTGATCAGAAGGAAAAAGG + Intergenic
949610048 3:5694613-5694635 AAGAGAATTCACAAGGAAAATGG - Intergenic
950846305 3:16019131-16019153 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
950867736 3:16202756-16202778 AATGGGAATCAGATGGGAAATGG - Intronic
952688142 3:36173011-36173033 AATGATTATCAGAAGGAGAAAGG - Intergenic
954850162 3:53593388-53593410 AATGGTAAGCAAAAGGAATATGG + Intronic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957477173 3:80739751-80739773 AAGGTTAATCACCAAGAAAATGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958014367 3:87920937-87920959 AAGGATAGTCAGAAAGAAAGAGG - Intergenic
958439226 3:94135211-94135233 AAAGGAAACCAGAAGGGAAAAGG - Intergenic
958584078 3:96062784-96062806 AAGGGGAAGGAGAAGGACAAGGG - Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959118295 3:102204249-102204271 AAATGCAATCAGAAGGAAAAAGG - Intronic
959679140 3:109072792-109072814 AAAGGTATTTAGAAGGAAACAGG - Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960396062 3:117138893-117138915 AAGAGTACTCAGAAGTAGAAAGG + Intronic
960540731 3:118859485-118859507 AATGGTAATAAGACAGAAAAGGG - Intergenic
960631767 3:119739462-119739484 ATGGGTCACCAGAAGGAAATGGG - Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961234772 3:125357031-125357053 AAGAGGAATAAGAAGAAAAACGG + Intronic
961377820 3:126478519-126478541 AAGGGGACTGAGAAAGAAAAAGG + Intergenic
961414500 3:126747596-126747618 AAGTGCCATCAGAAGTAAAATGG - Intronic
961591481 3:127984910-127984932 AAGGGGATTCTGAAGGAGAATGG - Exonic
961612370 3:128151368-128151390 AATGGTAATGAAAAGAAAAAAGG - Intronic
962557085 3:136564700-136564722 AAAGGTAGTCAAAAGAAAAATGG + Intronic
962727768 3:138250123-138250145 AAGTGTAGACAGAAGAAAAAAGG + Intronic
963165828 3:142202353-142202375 AAGGCTAGTCTGAAGCAAAATGG - Intronic
963390161 3:144651735-144651757 AATGATAATCAGAAGATAAATGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
964892405 3:161552746-161552768 AAATGCAATCACAAGGAAAATGG + Intergenic
964897162 3:161612557-161612579 AATGTTAATCAGAAAGACAATGG + Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965189236 3:165506728-165506750 AATGTTAATCACCAGGAAAATGG - Intergenic
965323116 3:167271490-167271512 AAGAAAACTCAGAAGGAAAATGG + Intronic
965630128 3:170724594-170724616 AAGGGCAGTGAGAAGAAAAAGGG + Intronic
966387921 3:179421337-179421359 AAGGATTATCAAAAGGAAGACGG + Intronic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970404451 4:15748809-15748831 AATGGTAATCATAAGGAATGTGG - Intergenic
970974208 4:22024250-22024272 AAGGGTAATCAGTCAGAGAAAGG + Intergenic
971142474 4:23939116-23939138 AAGGAAAAGAAGAAGGAAAAAGG + Intergenic
971363010 4:25954029-25954051 AAGGTTACTCAGCAGGCAAAGGG - Intergenic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
971823287 4:31587351-31587373 GAGGCTGACCAGAAGGAAAACGG + Intergenic
973926479 4:55743522-55743544 AAGGGTAATCAAAAGAAAACAGG + Intergenic
973956060 4:56064637-56064659 AAGGATATTCATAATGAAAAGGG - Intergenic
974331868 4:60489858-60489880 AAGGTTCATCAGGAGGAGAAAGG + Intergenic
974356642 4:60821074-60821096 AAGAGTAATCAGATTGAAGATGG - Intergenic
974380798 4:61137558-61137580 AAAGAAAATCAGAAGAAAAAAGG + Intergenic
974435462 4:61852115-61852137 AAGGGTTCTAAGAAGTAAAAGGG - Intronic
974873361 4:67672361-67672383 TAAGATAATCAGAATGAAAAAGG + Intronic
975174591 4:71273192-71273214 AAGGGCATTCAGCAGGTAAATGG + Intronic
975363642 4:73502431-73502453 AAGGGTAGTCAGGGAGAAAAGGG + Intronic
976297418 4:83486050-83486072 AAAGATGAACAGAAGGAAAAGGG + Intronic
976298764 4:83498433-83498455 AAGGAAAAAAAGAAGGAAAATGG + Intronic
976637266 4:87299294-87299316 AAGAGCCATCAGAAGGAAAGAGG + Intergenic
976698497 4:87943768-87943790 AAGAGTAACCTGAAGAAAAAAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977348602 4:95850253-95850275 AACCCTATTCAGAAGGAAAAGGG - Intergenic
977809343 4:101341605-101341627 AAGGATAATCAAATGGGAAATGG - Intronic
978066462 4:104409508-104409530 TAGGTTAATCAGAATGAATACGG + Intergenic
978909916 4:114050768-114050790 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
979091399 4:116487646-116487668 AAGGATAATGAGGAGGAAATTGG - Intergenic
979231783 4:118354827-118354849 AAAGCTAGTCAGAAAGAAAAAGG - Intergenic
980065037 4:128178155-128178177 AAGGGAAAGCAGGAGGGAAATGG + Intronic
980125110 4:128766632-128766654 AAGGGTCATCACAAAAAAAAGGG + Intergenic
980391774 4:132156233-132156255 AATGGTAATCATCAGGAAAATGG - Intergenic
980841057 4:138261880-138261902 AAGAGGAAGAAGAAGGAAAAAGG - Intergenic
981026302 4:140080129-140080151 AAGGTTAATCTGCAGGAAACGGG + Intronic
981071196 4:140540819-140540841 AATGGAAATCAGAAAGAAAAAGG - Intronic
981417664 4:144512002-144512024 AAGCGAAATCAGAAGGGTAAAGG + Intergenic
981588644 4:146332049-146332071 AAGGGTAGTTAGAAAGAAAGTGG + Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982565092 4:156975998-156976020 AATGGTAATCAAAAAGAAGAGGG + Intergenic
982597193 4:157401539-157401561 GAGGGAAAACAGAAGGCAAATGG + Intergenic
983123064 4:163912587-163912609 AATGGTAATAACCAGGAAAATGG - Intronic
983770066 4:171538082-171538104 AAAGGCAATAAAAAGGAAAATGG - Intergenic
984112799 4:175641313-175641335 AAGGGTAAATAGAAGCGAAATGG - Intronic
984334679 4:178375651-178375673 AATGGTTATGAGAAGGAAGAGGG + Intergenic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984835321 4:184014249-184014271 AAGGGTATGTAGAAGGAAAAAGG + Intronic
987182579 5:15384031-15384053 AAGATAAATCAGAAGTAAAAGGG - Intergenic
988663875 5:33303374-33303396 AAGGCATATCAGAAGGCAAAAGG + Intergenic
989010885 5:36871545-36871567 AAAGGTAATCTTAAGGCAAAGGG - Intergenic
989613694 5:43318783-43318805 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
990870820 5:60430239-60430261 AAGGGTGATGAGAAGAAGAAGGG - Intronic
991350186 5:65713282-65713304 AAGGGGAAGGAGAAGGGAAAGGG - Intronic
991468706 5:66944122-66944144 AAAGATATTCAGAAGGAAATAGG - Intronic
991524220 5:67538396-67538418 ATGTGTACTCAGAAGTAAAAAGG + Intergenic
992144163 5:73828623-73828645 AAGGAGAAACAAAAGGAAAAAGG - Intronic
992145142 5:73839401-73839423 AAGGGGAAAAAGAAGCAAAAGGG - Intronic
993170119 5:84408733-84408755 AAGGAGAATCAGTAGAAAAATGG + Intergenic
993583567 5:89695037-89695059 TGGGATTATCAGAAGGAAAATGG + Intergenic
993816031 5:92546626-92546648 AAGGGTAGTCAAATGGACAATGG - Intergenic
994202989 5:97000173-97000195 AAGGGAAATGAGAATGACAAAGG + Intronic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
995146682 5:108794998-108795020 AAGAGTAATTAGAATTAAAAAGG - Intronic
995367909 5:111384639-111384661 AAGGAGAATCTAAAGGAAAAGGG - Intronic
995569399 5:113463405-113463427 TAGGGTAATCATAAGGGAGATGG + Intronic
996523333 5:124451097-124451119 AGGGGTAATCAAAAGGTAGATGG - Intergenic
997259209 5:132453132-132453154 AAAAGAAAGCAGAAGGAAAAAGG - Intronic
997293918 5:132757912-132757934 AAGAGTACTCAGTGGGAAAAAGG - Intronic
997866919 5:137471987-137472009 AAGGGTGAGCAGAAATAAAAGGG + Intronic
998060911 5:139118144-139118166 AAGGGTAAGCACGAGCAAAAGGG - Intronic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
998754711 5:145364112-145364134 ATGGGTTATCAGAAGAAAATAGG + Intergenic
999505950 5:152196445-152196467 ATGGGTGAACAGAAGGGAAAGGG + Intergenic
1000112343 5:158120931-158120953 AAGGTGACTCAGAAGGAATAGGG + Intergenic
1000463570 5:161549028-161549050 AAAGGTTATCAGAAGGTAAGTGG - Intronic
1000488680 5:161881546-161881568 AAGGATAATCAGTAGAAAAGAGG + Intronic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002681894 5:180971096-180971118 AACGGTAATCAAAAGAAAATAGG + Intergenic
1003203760 6:3988640-3988662 AAGGATATTCAGAAGTAAAGGGG + Intergenic
1003355961 6:5370250-5370272 AGAGGTAAACAGAAAGAAAAAGG - Intronic
1003756667 6:9128619-9128641 ATGGGTAATTATAAGGAAAGGGG - Intergenic
1003827014 6:9964346-9964368 AAGGGTAATCAAAGGGAAACTGG - Intronic
1003833288 6:10038907-10038929 AAGAGTAACCAGAAAGCAAAAGG + Intronic
1004299863 6:14447521-14447543 GGGAGAAATCAGAAGGAAAAGGG + Intergenic
1004875836 6:19953176-19953198 AAAGGCAATTAGAAAGAAAAGGG - Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005132051 6:22520535-22520557 AAGGGTAGAAAGAAGGAAAGAGG + Intergenic
1005604374 6:27461321-27461343 AAAGAGGATCAGAAGGAAAAGGG - Intronic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009760877 6:68003776-68003798 AAGGGTGAGAAAAAGGAAAATGG - Intergenic
1010013629 6:71078912-71078934 GAGGGAAATGAGAAGAAAAAAGG - Intergenic
1010752859 6:79634184-79634206 TAGGGGAATCAGAAGAAAACAGG - Intronic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011300160 6:85865248-85865270 AAGGGAAATCAGAAAGAAACAGG - Intergenic
1011579798 6:88848461-88848483 AATGTTCATCAAAAGGAAAAAGG + Intronic
1012242764 6:96892753-96892775 AAGGGTAAGCAAAAGGAAAAGGG - Intronic
1012664640 6:101952263-101952285 AAGGTTACTCAGCAGTAAAAAGG - Intronic
1013313858 6:108922863-108922885 ATTGGTAACCAGAAGCAAAATGG + Intronic
1013800475 6:113936436-113936458 AAGGATAATCTCAAGAAAAATGG - Exonic
1014368113 6:120570886-120570908 CAGGTTCATAAGAAGGAAAAAGG + Intergenic
1014536217 6:122616128-122616150 ACATGGAATCAGAAGGAAAATGG + Intronic
1015264140 6:131273173-131273195 AAAGGTAATAATACGGAAAAAGG - Intronic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1015676327 6:135754062-135754084 AAGGGAATTCAAAAGAAAAATGG + Intergenic
1015920998 6:138266349-138266371 AAGGGAAAACGGAAGGGAAAAGG + Intronic
1015921004 6:138266368-138266390 AAGGGAAAGGAGAAGGGAAAGGG + Intronic
1016008655 6:139115507-139115529 AAGGATAAAGGGAAGGAAAAGGG - Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016434840 6:144025270-144025292 AAGGGTCATCAAAAGAAAAAAGG + Intronic
1016630169 6:146220619-146220641 ATGGGTAAGAGGAAGGAAAAAGG - Intronic
1016701189 6:147056042-147056064 ACGGGGAAGAAGAAGGAAAAAGG + Intergenic
1017143662 6:151214719-151214741 AAGGGTATGCAGGTGGAAAAGGG + Intergenic
1019128207 6:169855546-169855568 ATGGGAATTCAGAAGGAAATGGG - Intergenic
1020745258 7:12071822-12071844 AAGAGAATTCAGAAGAAAAATGG + Intergenic
1021071347 7:16245418-16245440 AGGTGGTATCAGAAGGAAAAAGG + Intronic
1021338237 7:19430783-19430805 AACGTTAATCAGAAGAAAGATGG + Intergenic
1021407596 7:20290896-20290918 AATTATAATCACAAGGAAAAGGG + Intergenic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1023161519 7:37301247-37301269 AAAAACAATCAGAAGGAAAAGGG + Intronic
1023404775 7:39821600-39821622 AAAGGAAATGAAAAGGAAAAGGG - Intergenic
1023815002 7:43942995-43943017 ACGGGTAATCTGTAGGAAAGTGG - Exonic
1023966774 7:44966958-44966980 AAGGGAAATCAGCAGAACAAGGG + Intronic
1024550165 7:50556102-50556124 AATGGTAACCAGAAAGAGAAAGG + Intronic
1024737657 7:52323279-52323301 AAGGGGAAGCAAAGGGAAAATGG - Intergenic
1024836643 7:53527662-53527684 AAGGGTAATCTGAAGTCATACGG + Intergenic
1026047198 7:66914596-66914618 AAGGGTGGTGAGAAGAAAAAGGG + Intergenic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026595728 7:71732932-71732954 AAGGATAAAAAGAAAGAAAAGGG + Intergenic
1026672277 7:72400831-72400853 GAGAGTTATCAGAAGTAAAAAGG - Intronic
1027171814 7:75878254-75878276 CAGGGTTATCAGCAGAAAAAGGG + Intronic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1027828503 7:83148139-83148161 AAGGGTACTAAGAAAGGAAAGGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028973768 7:96889576-96889598 AATGGTAATCAGATGGGAAGAGG + Intergenic
1028976721 7:96923017-96923039 AAAGCTAAACAGAAAGAAAACGG - Intergenic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1031428208 7:121633795-121633817 AACAGAAATCAGGAGGAAAAGGG - Intergenic
1031476912 7:122234546-122234568 AAGGGTGATGAGAAGAAAAAGGG + Intergenic
1031582191 7:123490219-123490241 AACAGTGATCAAAAGGAAAATGG + Intronic
1031731052 7:125300841-125300863 AAGGGTGGCCAGAAGAAAAACGG - Intergenic
1031792578 7:126126617-126126639 TAGGGTAATCAGAAGTAAGATGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032577840 7:133074290-133074312 AATGGAAATAAGATGGAAAAGGG + Intronic
1032928181 7:136633900-136633922 TAATTTAATCAGAAGGAAAAGGG - Intergenic
1033097691 7:138445164-138445186 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1033707796 7:143905576-143905598 AAGGGAAATGAGCAGTAAAAGGG + Intergenic
1033804327 7:144937422-144937444 AAGGGTAAGGAGAAGGGGAAGGG - Intergenic
1034975478 7:155446856-155446878 AAGGGGAAGGGGAAGGAAAAGGG + Intergenic
1036104572 8:5826003-5826025 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1037286743 8:17309653-17309675 AAGGGGAAACCGAAGGAAAGAGG + Intronic
1037344413 8:17883787-17883809 AAGGGGAAGGGGAAGGAAAAGGG - Intronic
1037872826 8:22515109-22515131 AAGGGTAGTAAGAGGGGAAATGG - Intronic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1038627302 8:29206620-29206642 AATGACTATCAGAAGGAAAAAGG - Intronic
1038902684 8:31861701-31861723 AAGGGGAAGAAGAAGGAAAGAGG - Intronic
1039065644 8:33605232-33605254 CAGGTAAATCAGTAGGAAAATGG - Intergenic
1040066809 8:43151982-43152004 TATGTTAATCAGAAAGAAAAGGG + Intronic
1040690947 8:49937708-49937730 AAGGGAAACCAGAGGTAAAAAGG + Intronic
1041179859 8:55236245-55236267 AAAGGTAAGGAGAAGAAAAAAGG - Intronic
1041362607 8:57068662-57068684 AAGGGGCACCAGAAGGAACAAGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041718619 8:60955552-60955574 AAGGGTCATCCCATGGAAAAAGG - Intergenic
1042317715 8:67441849-67441871 AAGGATGATGTGAAGGAAAAGGG - Intronic
1042364626 8:67922582-67922604 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1042382541 8:68134558-68134580 GAAGGTCATCAGAAGAAAAAGGG + Intronic
1042819225 8:72911929-72911951 AAGGGGAAACAGAAAGACAATGG - Intronic
1043012529 8:74899234-74899256 AAGGGTATTCTGATGGAAATAGG - Intergenic
1043284414 8:78511887-78511909 TAGGGAAACCAGAAAGAAAAGGG - Intergenic
1043596402 8:81891244-81891266 GAAGTTAATCATAAGGAAAAAGG - Intergenic
1043806797 8:84681833-84681855 CAGGGCAATCAGGCGGAAAAAGG - Intronic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044816016 8:96113814-96113836 CAGGTTAATCACCAGGAAAATGG - Intergenic
1045132380 8:99168343-99168365 AACTGTACTCAGAAGGAAATTGG - Intronic
1045697892 8:104831275-104831297 ACGAGGAAACAGAAGGAAAAGGG + Intronic
1046186610 8:110729735-110729757 AAGGGAGAAAAGAAGGAAAATGG + Intergenic
1046831952 8:118756044-118756066 AAGGGGAATGAGAAGAGAAAGGG + Intergenic
1047439259 8:124861910-124861932 AAGGATAATCAGGATGATAAAGG + Intergenic
1048338247 8:133519044-133519066 AAGGGTAAGCAGAAGAGACATGG + Intronic
1048799341 8:138181757-138181779 AAGAGTCATCAGAAGCAATATGG - Intronic
1048803096 8:138212415-138212437 AAAGGAAATAAGAGGGAAAAAGG + Intronic
1050218705 9:3361166-3361188 AATGTGAAACAGAAGGAAAAAGG + Intronic
1052180548 9:25521220-25521242 GAGAGTAGTCAGAAAGAAAATGG - Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052588480 9:30459774-30459796 AAGGGCATTCATAAGGACAAAGG + Intergenic
1053605638 9:39655809-39655831 AAGGGGTTTAAGAAGGAAAAAGG + Intergenic
1053863557 9:42412439-42412461 AAGGGGTTTAAGAAGGAAAAAGG + Intergenic
1054247905 9:62686606-62686628 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1054562019 9:66721131-66721153 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1054858801 9:69928843-69928865 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1055015275 9:71610262-71610284 AGGAGTAAATAGAAGGAAAACGG + Intergenic
1055251403 9:74311377-74311399 AAGGGTAATACCAAGTAAAATGG - Intergenic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1055964040 9:81847845-81847867 AAAAGTAAGCAGAGGGAAAAAGG + Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1057991842 9:99778575-99778597 AAGGATGAACAGAAAGAAAATGG - Intergenic
1058751227 9:108040228-108040250 AAGGGTGGTGAGAAGAAAAAGGG + Intergenic
1059396255 9:114035817-114035839 AAGGAAAACAAGAAGGAAAAGGG - Intronic
1059783539 9:117555145-117555167 AAGGGTGAACTGAAGTAAAAAGG + Intergenic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1060064435 9:120490918-120490940 AAGGGTACTCCTAAAGAAAAAGG + Intronic
1060676982 9:125523961-125523983 AATGGTTATTAGAAGGAAGATGG - Intronic
1061718560 9:132537240-132537262 AAGGGTAATCAGATGTGAAGGGG + Intronic
1062199034 9:135291183-135291205 AAGGGAAATCGGAAAGAGAAAGG + Intergenic
1062644663 9:137541365-137541387 ATGGGTTATTAGAAGGGAAAGGG - Intronic
1186470588 X:9818994-9819016 AAGGGCAAAGACAAGGAAAATGG - Intronic
1186474597 X:9847525-9847547 AACTCTAATCAGAGGGAAAAGGG + Intronic
1187066532 X:15844719-15844741 TATGGTAATTAGAAAGAAAAGGG + Intronic
1187678017 X:21737309-21737331 AAGGATGATCAGAAAGAGAATGG + Intronic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188012888 X:25076067-25076089 AAGGATAATCAGGAAGAGAATGG - Intergenic
1188746910 X:33856257-33856279 AAGGTCAATCAGGAGGAAAAAGG + Intergenic
1190124930 X:47695874-47695896 AAGTGAAATCAGAAGGCAGAAGG - Intergenic
1190927137 X:54920671-54920693 AGGGGTAGTAAGAAGAAAAAGGG + Intronic
1191767375 X:64712979-64713001 AATGGTCATCAGCAGAAAAATGG - Intergenic
1193121448 X:77827016-77827038 CAGGGTTATTAGAAGGTAAATGG + Exonic
1193416491 X:81230482-81230504 AAAGGAAATAAGAAGGAAACAGG + Intronic
1194127547 X:90038969-90038991 AAGAAAAATAAGAAGGAAAATGG + Intergenic
1194178222 X:90679221-90679243 AAGGAGAAAGAGAAGGAAAAGGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1196707116 X:118726544-118726566 AAGGGTATTTATAAGGGAAAAGG + Intergenic
1196974823 X:121147838-121147860 AAGGGAAAAAGGAAGGAAAAAGG + Intergenic
1198156779 X:133968401-133968423 AAGAGTAATCATTAGGAACATGG + Intronic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198589930 X:138167142-138167164 AGGGGTTATGAGAAGGCAAAGGG - Intergenic
1198693247 X:139307381-139307403 AAGGTTAATCAGGAAGACAATGG + Intergenic
1199200827 X:145087483-145087505 AATGTTAATCAGCAAGAAAAAGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200837170 Y:7743795-7743817 AAGAGTCTTCAGAAAGAAAAAGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1202166185 Y:21991455-21991477 AAATGTAATGAGAAAGAAAAGGG - Intergenic
1202225173 Y:22594918-22594940 AAATGTAATGAGAAAGAAAAGGG + Intergenic
1202317941 Y:23600743-23600765 AAATGTAATGAGAAAGAAAAGGG - Intergenic
1202552825 Y:26069315-26069337 AAATGTAATGAGAAAGAAAAGGG + Intergenic