ID: 1006973383

View in Genome Browser
Species Human (GRCh38)
Location 6:38070823-38070845
Sequence CAGCATTACCAATATTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006973379_1006973383 11 Left 1006973379 6:38070789-38070811 CCTAAGAATGATGTTTGAGAGTG 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1006973383 6:38070823-38070845 CAGCATTACCAATATTAGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006973383 Original CRISPR CAGCATTACCAATATTAGGT GGG Intronic
901498594 1:9637366-9637388 CAACATTACAAAAATTAGCTAGG + Intergenic
907919337 1:58898118-58898140 CAGCATTCCCCATATTAAGTTGG + Intergenic
913410457 1:118545073-118545095 CACCATTGTCAATATTAGGCAGG + Intergenic
923841541 1:237677508-237677530 CAGCAATTTTAATATTAGGTTGG - Intronic
1063385650 10:5614760-5614782 CATCCTTACCAATATTTGGAAGG + Intergenic
1064065487 10:12177556-12177578 CAGCATTGCCAAGAGGAGGTTGG + Intronic
1068568588 10:58603925-58603947 AAGTATTGCCAATATTAGTTAGG + Intronic
1074036300 10:109742298-109742320 CAACATTACAAAAATTAGCTGGG + Intergenic
1074256689 10:111810030-111810052 CAGCATTTCCTATTTTAAGTAGG + Intergenic
1078970095 11:16399579-16399601 GAACATGACCAATATTAGTTGGG + Intronic
1079042770 11:17074025-17074047 CAGAAATAGTAATATTAGGTTGG - Intergenic
1081690555 11:45074975-45074997 CAGCATTGCCAATATGAGGAAGG - Intergenic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1092521298 12:9276040-9276062 CAGCTTTGCTAATATTATGTGGG - Intergenic
1094451233 12:30585027-30585049 CAGCATAAACAATATTACTTAGG + Intergenic
1094701714 12:32876688-32876710 GAGCAATACAAATATTAGCTGGG - Intronic
1095156335 12:38860038-38860060 CAGCAAAAGCAAAATTAGGTGGG + Intronic
1100876777 12:98970387-98970409 CAGACTTGCCAATATTAGGCTGG + Intronic
1105790583 13:23794376-23794398 CAGCGTTAGCAATATGAGGAAGG - Intronic
1105914366 13:24899082-24899104 CAGAACTAACAATATTTGGTGGG + Intronic
1108287473 13:48922859-48922881 TGGCATTATCATTATTAGGTTGG - Intergenic
1109332907 13:60952537-60952559 CAGCATTACAAAAAGTAGGACGG - Intergenic
1110381650 13:74858425-74858447 CAGAATTTCCAATACTATGTTGG + Intergenic
1113030940 13:105993028-105993050 CAAAATTACAAAAATTAGGTGGG - Intergenic
1114961833 14:27901544-27901566 CACAATTACCAAAATTAGGGTGG - Intergenic
1116473136 14:45308426-45308448 CAACATTATCCATATTGGGTAGG + Intergenic
1118519303 14:66563778-66563800 CAGAATTAGCAAGATTAAGTTGG - Intronic
1118829195 14:69413479-69413501 CATTATAACCAAAATTAGGTAGG + Intronic
1125363844 15:38892631-38892653 CAGCAATCCCAATACTGGGTAGG + Intergenic
1125983396 15:44025162-44025184 CACCATCACCATTATTAGGGGGG + Intronic
1128741746 15:70088762-70088784 CAGAATTACCAATATGAGAAAGG + Intronic
1129548872 15:76426926-76426948 CAGCTTTACCAAAAATAAGTTGG - Intronic
1130708973 15:86260796-86260818 AAGCATTACCTGGATTAGGTGGG + Intronic
1131032273 15:89196150-89196172 CAGCATTTCCAAAATTTGCTTGG - Exonic
1131209186 15:90478948-90478970 CAGCATTACCAATATTTGATTGG - Intronic
1132734995 16:1381255-1381277 TAGCATTACTACTTTTAGGTTGG + Intronic
1134584639 16:15399231-15399253 CAGTATTACCAATATTTTGCTGG + Intronic
1140816490 16:78625982-78626004 AAGTAATAACAATATTAGGTTGG - Intronic
1142950421 17:3473846-3473868 CAGCATTACAAATGTTTTGTGGG - Intronic
1142986625 17:3698907-3698929 CAGCATTAAAAAAAATAGGTTGG + Intergenic
1150057597 17:62032987-62033009 TAGCATTACAAAAATTAGGTGGG + Intronic
1150168877 17:62970779-62970801 CAGAATCACCAATGTTAGCTGGG + Intergenic
1150895446 17:69204965-69204987 CAAAATTACCAAAATTAGCTGGG + Intronic
1159705787 18:71685106-71685128 CAGCAATAGCAATACTAGGAGGG + Intergenic
1164252380 19:23491317-23491339 AAGCATTACCAATATGAAGAGGG - Intergenic
927227389 2:20782132-20782154 CAGCAGCACCAATATTACCTGGG + Intronic
927574191 2:24187728-24187750 CAGGATTAAGAATGTTAGGTTGG + Intronic
930944224 2:57052057-57052079 CAGGATTACCTATCTTGGGTAGG + Intergenic
936431529 2:112468199-112468221 CAGAATTTCCAGTATTATGTTGG - Intergenic
941501451 2:166283466-166283488 CTGCATTACCAATATCAGCAAGG - Intronic
946557273 2:220872624-220872646 CAGCATCACCAATTCTAGGAAGG - Intergenic
1170147258 20:13189782-13189804 CAGCAATCCCATTATTAGATAGG + Intergenic
1170916788 20:20634216-20634238 CTACCTTACAAATATTAGGTGGG - Intronic
1177377467 21:20291946-20291968 TAGCATTATCAATTTTATGTAGG + Intergenic
1177986174 21:27978046-27978068 CAAAATTACAAATATTAGCTGGG - Intergenic
950755121 3:15164301-15164323 CATCAGTACCAATATTAGATTGG + Intergenic
951564074 3:23995144-23995166 CAGCATTTCCTAGATTAGGGAGG - Intergenic
954901958 3:54027451-54027473 CAGCATTACCATGATTTGGGTGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
957793961 3:84978440-84978462 AATCATTACTAATATTAAGTAGG - Intronic
962578065 3:136772735-136772757 CAGCAATACCAGCATTAGGATGG - Intergenic
964470697 3:157051585-157051607 CAGCATTACCAATTTTCTTTTGG - Intergenic
973001713 4:44960317-44960339 CAGTAATACCAATATTTGATAGG + Intergenic
979232366 4:118359870-118359892 CAGGATTAAAAATATTATGTTGG + Intergenic
979387277 4:120082270-120082292 CAGAATTACAAATGTTAGGTTGG - Intergenic
979672928 4:123380234-123380256 CAGGATTAGCAATATTTGATTGG + Intergenic
982962844 4:161862350-161862372 CATCACTACCAAAATTAGGCAGG + Intronic
982976421 4:162067672-162067694 CAGAACTTCCAATATTATGTTGG - Intronic
986742477 5:10716039-10716061 GAGCAATGCCAATATGAGGTGGG - Intronic
987019681 5:13856984-13857006 CAGAACTACCAATACTATGTTGG - Intronic
988039110 5:25864944-25864966 CAGAATTAAAAATGTTAGGTTGG - Intergenic
989950277 5:50289195-50289217 CAGCATTAGCAATTTTATTTTGG - Intergenic
1004145459 6:13061939-13061961 CTACTTTACCTATATTAGGTGGG - Intronic
1005436881 6:25821539-25821561 CACCCTTACCCATATCAGGTGGG + Intronic
1006973383 6:38070823-38070845 CAGCATTACCAATATTAGGTGGG + Intronic
1007490106 6:42214173-42214195 TAGCAGTACCAATATGAAGTGGG - Exonic
1008651879 6:53572415-53572437 CAGCAATCCCACTAGTAGGTGGG + Intronic
1009670960 6:66748921-66748943 CAGTATTAGCTATATTTGGTTGG + Intergenic
1015745264 6:136503268-136503290 CAGCATCAATACTATTAGGTGGG - Intronic
1016860036 6:148708301-148708323 CAGCATTCCCAAAATTCTGTGGG + Intergenic
1020475108 7:8585074-8585096 GAGCAGTAAAAATATTAGGTAGG - Intronic
1024941623 7:54768863-54768885 CAGCACTATCAGTCTTAGGTGGG - Intergenic
1030219812 7:107086425-107086447 TAGCATTACTAATATTAGTAGGG + Intronic
1031833879 7:126658746-126658768 CAGAAATCCCAATATTAGATTGG + Intronic
1037001170 8:13720892-13720914 CACTATTATCAATATTTGGTTGG + Intergenic
1038297286 8:26306010-26306032 CAGAATTACAAAAATTAGCTGGG + Intronic
1042191875 8:66195210-66195232 CAGCAATACCTCTATGAGGTAGG - Intergenic
1055847959 9:80590710-80590732 GAGAATCACAAATATTAGGTTGG - Intergenic
1055959416 9:81805984-81806006 CAGCCTCAATAATATTAGGTTGG + Intergenic
1057879828 9:98784755-98784777 AAGGACTACAAATATTAGGTTGG + Intronic
1185885798 X:3781576-3781598 CATCATTACCAATCTTATTTTGG + Intergenic
1187284365 X:17889937-17889959 TAAAATTACCAATATTAGGCTGG + Intergenic
1191611911 X:63125386-63125408 AAGTATTACCAAAATTAGGCAGG + Intergenic
1193536354 X:82720639-82720661 TTGCAGTACCAATATTATGTGGG + Intergenic
1193948774 X:87771341-87771363 CTGCATTACTAATATTATGTAGG + Intergenic
1194721973 X:97351324-97351346 GAGCATTACCAAAATCAAGTTGG - Intronic
1194846510 X:98815942-98815964 CAGAATTAGAAATATTAAGTGGG + Intergenic
1199330095 X:146549354-146549376 CAGCAATCCCATTATTGGGTTGG - Intergenic
1201225932 Y:11819304-11819326 TAAAATTACAAATATTAGGTGGG + Intergenic