ID: 1006973919

View in Genome Browser
Species Human (GRCh38)
Location 6:38078703-38078725
Sequence GTGTTGACCGGGACTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006973919_1006973923 26 Left 1006973919 6:38078703-38078725 CCAACCTCAGTCCCGGTCAACAC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1006973923 6:38078752-38078774 TAGAACCCACAATCATGAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006973919 Original CRISPR GTGTTGACCGGGACTGAGGT TGG (reversed) Intronic
904034529 1:27551669-27551691 GTGTACACCTGGACTGTGGTGGG - Exonic
904352589 1:29918628-29918650 CTGTGGACCGGGACTGTGCTAGG + Intergenic
905014067 1:34765057-34765079 GTGATGACCAGGTCTGGGGTGGG - Intronic
907573863 1:55507921-55507943 GAGTTGACCTGGGTTGAGGTGGG - Intergenic
914324451 1:146597909-146597931 GGGTTGTCAGGGGCTGAGGTTGG - Intergenic
915586981 1:156849215-156849237 GTGTCCACCGGCACTGGGGTTGG + Intronic
922367238 1:224877546-224877568 TTGTTGACAGGCACTTAGGTTGG - Intergenic
923349034 1:233085843-233085865 GTGGTGACTGGGACTGAAATAGG - Intronic
923717647 1:236438456-236438478 GTGGTGACCAGGGCTGTGGTGGG + Intronic
924477544 1:244395170-244395192 CTGCTGACCAGGACTGAGGCTGG - Intergenic
1063482349 10:6386672-6386694 GCGTTGCCCGGGCCTGGGGTAGG + Intergenic
1064209635 10:13351371-13351393 GTGAAGACCGAGACAGAGGTTGG + Intergenic
1067381534 10:45778173-45778195 GTGTGGACCAGGACTGGGATAGG - Intronic
1067889233 10:50118807-50118829 GTGTGGACCAGGACTGGGATAGG - Intronic
1068023622 10:51616437-51616459 GTGTTGACAGTGGCTGTGGTGGG + Intronic
1069544822 10:69320335-69320357 GTGGGGACCGGGAGTGAGGTAGG + Intronic
1070591762 10:77806731-77806753 GTGTTCTCCGGGCCTGGGGTGGG - Intronic
1077024522 11:433317-433339 GTGGTGACCGGGATGGTGGTCGG + Exonic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1080063230 11:27980209-27980231 GTGATGACAGAGACAGAGGTTGG - Intergenic
1083651698 11:64208105-64208127 CTCTTGGCCGGGACTGTGGTGGG - Intronic
1087086700 11:94226556-94226578 GTGATCACTGGGGCTGAGGTGGG + Intergenic
1090251174 11:125252932-125252954 GTGTTGCCTGGGACAGAAGTTGG - Intronic
1091572739 12:1703603-1703625 GTGTGTGCCGGGACTGAGGTGGG + Intronic
1094729448 12:33157857-33157879 GTGTTGTCTAGGGCTGAGGTTGG + Intergenic
1095439513 12:42227776-42227798 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
1096473700 12:51895433-51895455 CTGCTGACAGGGACTGAGTTCGG - Intergenic
1098240121 12:68458416-68458438 GTGTTGACGGACACTTAGGTTGG - Intergenic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1100477641 12:94948980-94949002 CTGTTGAGTGGGACTGAAGTGGG + Intronic
1106885469 13:34180013-34180035 GTGTTATCAGGGACTGAGGAAGG - Intergenic
1108397737 13:50006581-50006603 GTGTGGAGCAGGACTGGGGTTGG + Intronic
1111176739 13:84605894-84605916 GTGTTGACAGTGACAGTGGTGGG + Intergenic
1123059845 14:105589597-105589619 GCGTTGACCTGGGCTGAGCTGGG - Intergenic
1123084275 14:105710375-105710397 GGGTTGACCTGGGCTGAGCTGGG - Intergenic
1127855314 15:62949247-62949269 GTGTTTACTGGGACAAAGGTAGG + Intergenic
1129496878 15:75991494-75991516 ATGTTCACCAGGACAGAGGTTGG - Intronic
1132891422 16:2206678-2206700 GTGCTGCCCGGGGCTGGGGTGGG + Intronic
1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG + Intronic
1134454097 16:14381352-14381374 GTGTTGTCCCAGACTGAGGGAGG + Intergenic
1135291076 16:21238923-21238945 GTGTTGAGCAGGCCTGATGTAGG + Intronic
1138658882 16:58506480-58506502 GTGGTGACCGGGGGTGGGGTGGG + Intronic
1141091940 16:81136322-81136344 GTGTTGGCAGGGACTGGGGTTGG + Intergenic
1146632319 17:34479693-34479715 CTGTTGACCGGGCCCCAGGTTGG - Intergenic
1148236329 17:45971676-45971698 GTGTTGGCAGGGAGGGAGGTGGG + Intronic
1148598272 17:48874060-48874082 GTGTTAACAGGGACTGAAGCTGG - Intergenic
1151552333 17:74829368-74829390 GTGTGGCCCAGCACTGAGGTGGG - Intronic
1155266950 18:24103719-24103741 GTGTTGGCTGGGACTGGGGCAGG - Intronic
1156372617 18:36484993-36485015 GTGATCACCGGGAATGAAGTTGG - Intronic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1161236259 19:3199626-3199648 GGGTTGAGCGGGAGTGGGGTGGG + Intronic
928464522 2:31510625-31510647 GTTTTGACAGGGTCTCAGGTTGG - Intergenic
932871152 2:75399686-75399708 TTGTTGATGGGCACTGAGGTTGG - Intergenic
933754232 2:85625277-85625299 GAGTTGACCAGACCTGAGGTCGG + Intronic
936478595 2:112864295-112864317 GTGTTTACCTGGATTGAGGGTGG + Intergenic
939394800 2:141614633-141614655 GTGTAGACCGGGACAGAAATTGG + Intronic
947593369 2:231396875-231396897 GTGTGGACCGGGGTTGGGGTGGG + Intronic
948036559 2:234862859-234862881 GTGCAGACCGGGGCTGAGGCTGG + Intergenic
948792465 2:240386072-240386094 GTGCTGGGCTGGACTGAGGTGGG + Intergenic
1169513953 20:6296408-6296430 GTGTTGGCAGGGAGTGAGGCTGG - Intergenic
1173243630 20:41318844-41318866 GAGTTGACATGAACTGAGGTAGG - Intergenic
1175766813 20:61598054-61598076 GTGTTCACTGAGACGGAGGTGGG - Intronic
1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG + Intronic
1175915120 20:62422588-62422610 GTGGGGACGGGGACTGGGGTGGG + Intronic
1176937716 21:14885785-14885807 GAGGTGACCTGAACTGAGGTGGG - Intergenic
1178664297 21:34533298-34533320 GAGTGGACAGGGACAGAGGTAGG - Intronic
1179397959 21:41058555-41058577 GTGGTGACTGTGACAGAGGTTGG - Intergenic
1179826285 21:43968236-43968258 GTGGTGACTGGGAGTGAGCTGGG + Intronic
1182995659 22:34809653-34809675 GTGAAGCCCGGGACTGAGGCTGG - Intergenic
1183251392 22:36732846-36732868 GTGTTTCCCAGGACTGAGGAGGG - Intergenic
1184580437 22:45413257-45413279 GCGAGGACCGGGGCTGAGGTGGG + Intronic
1185398777 22:50605474-50605496 GTGATGGCAGGGACTGAGGCTGG - Intronic
953232953 3:41080665-41080687 GTCTTGACTGAGACTGAGGCTGG - Intergenic
953996777 3:47525842-47525864 GTGGTGATCGGGATTGGGGTGGG + Intergenic
954361374 3:50124494-50124516 GTGGTGACTGGGGCTGGGGTGGG + Intergenic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
955124720 3:56099781-56099803 TTCTTGAGCAGGACTGAGGTAGG - Intronic
955390902 3:58521549-58521571 GTCTGAACCGGGACTGAGGGTGG - Intronic
957203215 3:77164466-77164488 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
957203237 3:77164515-77164537 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
957203310 3:77164691-77164713 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
958124408 3:89336936-89336958 CTGTTGACCCAGGCTGAGGTGGG + Intronic
960051219 3:113241177-113241199 GTATTGACTGGGATTGAGATAGG + Intronic
961120708 3:124368149-124368171 GTGCTGTCCGGGAGGGAGGTGGG - Intronic
961568932 3:127784638-127784660 GTGCTGACCGGGCCTGGGGGTGG - Intronic
968246095 3:197149768-197149790 GTGTTGACCAGTACTGGGGGAGG + Exonic
969196257 4:5566212-5566234 GTGTTGCCCGGGACAGTGGGAGG + Intronic
976788786 4:88853762-88853784 GTGTCGACCTAGACTGAGGGTGG - Intronic
981584580 4:146287041-146287063 GTGGTGAGAGGGACTGAGTTTGG + Intronic
985638734 5:1053163-1053185 GTGGTGACCGGGCCAGAGTTGGG - Intronic
986695657 5:10352982-10353004 GTGCTGACGGGGACAGAGCTTGG + Intergenic
987314043 5:16707699-16707721 GCGTTTACGGTGACTGAGGTGGG - Intronic
990081009 5:51913676-51913698 GTGTTGACCTGGACTGCGTGTGG + Intergenic
990553779 5:56909863-56909885 GGGTGGGCAGGGACTGAGGTGGG + Intronic
996110590 5:119562098-119562120 GGGTTGATGGGGACTTAGGTTGG - Intronic
999196149 5:149782907-149782929 GTGTCCACTGGGACAGAGGTAGG + Intronic
1001187454 5:169588558-169588580 ATGATGACCATGACTGAGGTAGG + Exonic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1015149412 6:130020469-130020491 GCTTTGACCGGGACTGGGGGAGG - Intronic
1017082586 6:150683577-150683599 GTGATGACCGTGACTGCTGTGGG - Intronic
1017843967 6:158240755-158240777 GTGCCGACCGGGAGGGAGGTGGG - Intronic
1019057785 6:169235661-169235683 GTGTGGACGGGGAGTGAGTTTGG - Intronic
1019084779 6:169465850-169465872 TTGTTGCCAGGGACTGAGGAAGG + Intronic
1020182660 7:5934431-5934453 ATGGTGACTGGGACTAAGGTGGG - Intronic
1020300251 7:6790326-6790348 ATGGTGACTGGGACTAAGGTGGG + Intronic
1024330997 7:48155320-48155342 GTGTTCACCGGAACTAGGGTTGG + Intergenic
1030869206 7:114734470-114734492 ATGGTGACTGGGACTGAAGTGGG - Intergenic
1031411631 7:121446531-121446553 GTTTTGCCGGGGAGTGAGGTAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1038529223 8:28304076-28304098 GTGCTGACAGGGACTGTGGCTGG + Intergenic
1041097269 8:54362077-54362099 GTTGTGACAGGGAGTGAGGTGGG + Intergenic
1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG + Intergenic
1046311989 8:112449405-112449427 GTGGTGTCTGGGAGTGAGGTTGG + Intronic
1053255833 9:36615353-36615375 GTGCCGACCGGGAGGGAGGTGGG - Intronic
1187976479 X:24709349-24709371 GTGCTGTCCGGGAGGGAGGTGGG - Intronic
1190938588 X:55018761-55018783 GTTTTGACCAGGGCTGAGGGTGG + Intronic
1191755175 X:64585004-64585026 ATGTGGACAGGGACAGAGGTAGG + Intergenic
1199703436 X:150403281-150403303 TAGTTGCCAGGGACTGAGGTGGG + Intronic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1202272598 Y:23085754-23085776 GTGATGGCGGGGACTGAGGGGGG + Intergenic
1202293428 Y:23334928-23334950 GTGATGGCGGGGACTGAGGGGGG - Intergenic
1202425595 Y:24719498-24719520 GTGATGGCGGGGACTGAGGGGGG + Intergenic
1202445194 Y:24950587-24950609 GTGATGGCGGGGACTGAGGGGGG - Intergenic