ID: 1006974221

View in Genome Browser
Species Human (GRCh38)
Location 6:38082374-38082396
Sequence CTGCCTTTCTGTTTCTAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006974217_1006974221 -9 Left 1006974217 6:38082360-38082382 CCTGACTGATGCACCTGCCTTTC 0: 1
1: 0
2: 2
3: 70
4: 863
Right 1006974221 6:38082374-38082396 CTGCCTTTCTGTTTCTAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006974221 Original CRISPR CTGCCTTTCTGTTTCTAGGT GGG Exonic
900075076 1:807941-807963 CTGCCTTTCTTTTGCCAAGTTGG - Intergenic
901182595 1:7351976-7351998 CTGCTTTTCTGTTTCATGGCAGG - Intronic
902535093 1:17115079-17115101 CAGACTTTCTGTCTCTTGGTTGG - Intronic
903781752 1:25824531-25824553 CTTCATTTCTGTTTCTACCTGGG - Intronic
904123887 1:28222702-28222724 CTGCCTTCCTTGTTCCAGGTGGG - Intronic
904302790 1:29566227-29566249 CTTTCTTTCTGTTTCTGGGTGGG - Intergenic
904944824 1:34191506-34191528 CTGCCATTATGTGTCTATGTGGG - Intronic
905387938 1:37617103-37617125 TTGTCTTTGTGTTTCTGGGTAGG - Intronic
905445909 1:38028478-38028500 CTGCCTTCCTGCTTATAGGCAGG + Intergenic
908677867 1:66626306-66626328 CTACATTTCTGTTTCTGGCTAGG - Intronic
908988592 1:70056718-70056740 CTCCGTTTCTTTTTCTAGGATGG - Intronic
909891724 1:81015885-81015907 CTGCCTATCTGTTCTTAAGTGGG - Intergenic
910121111 1:83791575-83791597 CTGTCTATCTCTTTCTAGGCAGG - Intergenic
913384776 1:118247615-118247637 CTGACTTTCTACTTCTAGTTTGG - Intergenic
916147572 1:161753814-161753836 CTGTCTTTCTTTTTCTCTGTTGG + Intronic
917322300 1:173796216-173796238 CTGCTCTTCTTTTTCTAGGATGG + Intergenic
918587811 1:186207833-186207855 CTGATTTTCTGGTTCTAGGAAGG - Intergenic
919243208 1:194941498-194941520 TTGACTTTCTGTTTCTAAGAGGG - Intergenic
919959015 1:202447978-202448000 CTGCCTTTATGTTTGTATCTAGG + Intronic
920820366 1:209374641-209374663 TTGCCTTTTTGTTTTTTGGTGGG - Intergenic
922270916 1:224032840-224032862 CTGCCTTTCTTTTGCCAAGTTGG - Intergenic
923340030 1:232999176-232999198 CTGCCTGTGTGTCCCTAGGTAGG + Exonic
923978801 1:239296989-239297011 CTGCCTATTTGTTTCTGGTTTGG + Intergenic
1064497539 10:15928905-15928927 CTGCCTTCCTGTTGCAATGTTGG + Intergenic
1064690443 10:17912168-17912190 CTTCCTATTTGTTTCTAAGTTGG - Intergenic
1066157162 10:32690662-32690684 CAGCCTTTCTGTTTCTTCCTAGG + Intronic
1066647308 10:37622885-37622907 CTGGCTTCCTGTTGCTAGGAGGG - Intergenic
1067524737 10:47031492-47031514 CTGTCTTTCTGATTCTAAGCTGG - Intergenic
1067536005 10:47110603-47110625 CTAGCTTTGTGTTTCTAGGTGGG + Intergenic
1068813561 10:61284000-61284022 CTGCCTCTCAGTGTCTATGTGGG + Intergenic
1068910777 10:62375843-62375865 CCACCTTTTTGATTCTAGGTAGG + Intronic
1070497673 10:77039186-77039208 CTGCCTGTCTGATTCTAAGAGGG - Intronic
1072157057 10:92733267-92733289 TTTCCATTCTCTTTCTAGGTTGG - Intergenic
1072886396 10:99279290-99279312 CTGCCTTTCTGTATATAATTTGG - Intergenic
1073134056 10:101209925-101209947 ATGTCTTTGTGTTGCTAGGTTGG - Intergenic
1074792585 10:116905465-116905487 CAGCCATTCAGTTTTTAGGTTGG - Intronic
1076619070 10:131775514-131775536 CTGCTTGCCTGTTTGTAGGTGGG - Intergenic
1076627182 10:131829302-131829324 CTGCCTCCCTGTTTCCTGGTGGG - Intergenic
1076995931 11:297550-297572 CTGCCTTTCTGGATATAGTTTGG + Intergenic
1078174815 11:8962690-8962712 CTTCCTTTCTAGTTGTAGGTGGG - Intronic
1078784529 11:14475785-14475807 CTGTCTTCCTCTTTCTTGGTGGG + Exonic
1079835962 11:25333241-25333263 CTGCTTTTCTGTCTATAGCTAGG - Intergenic
1081728296 11:45348819-45348841 CTGCCTTTTTTTGTCTAGATAGG - Intergenic
1081754476 11:45534862-45534884 CTGCCTTTCTGTCCCTGGCTGGG + Intergenic
1082727236 11:56750871-56750893 CTGCATTTTTGTTTTTAAGTTGG - Intergenic
1085927348 11:81037967-81037989 CTTCATTTCTGGTACTAGGTTGG - Intergenic
1086029607 11:82338199-82338221 CTGCCTGTGTGTTCCTAGGTAGG - Intergenic
1086062371 11:82713114-82713136 CTTCTTTTCTTTTTTTAGGTTGG - Intergenic
1086543550 11:87941822-87941844 CTTCCCTTCTGTTTCTCTGTAGG + Intergenic
1086828593 11:91531225-91531247 TTTCCTTTCTCTTTCAAGGTTGG + Intergenic
1089319971 11:117619084-117619106 TTGCCTTTATGGTTCTAGCTCGG + Intronic
1091014895 11:132041177-132041199 CTGCCTTTTTGTTTGTGTGTGGG + Intronic
1092135891 12:6146782-6146804 CTGTCTTTCAGTGTCTTGGTAGG - Intergenic
1094486915 12:30932933-30932955 CTGCCTTTCTGATTCCCAGTGGG + Intronic
1095379045 12:41567304-41567326 CTGCTTTTTTCTTTTTAGGTGGG - Intronic
1095653965 12:44647858-44647880 CTACCTTTATTTTACTAGGTTGG - Intronic
1096201152 12:49684234-49684256 CCCCCTCTCTGTTTCTAGGCAGG + Intronic
1096652775 12:53070028-53070050 CTGCATTTCTGTCTCTGGATAGG + Intronic
1096922809 12:55107074-55107096 CTACCTTTTTTTTTCAAGGTAGG - Intergenic
1098223547 12:68296979-68297001 CTGCCTTTTTTTTTTTAAGTGGG - Exonic
1098485788 12:71019991-71020013 CAGAGTTTCTGTGTCTAGGTAGG - Intergenic
1099919116 12:88935072-88935094 CTGTCTTTCAGCTTCTAGCTGGG - Intergenic
1101653589 12:106699789-106699811 CTCCCTCTATGTTTCTATGTTGG - Intronic
1102414534 12:112749056-112749078 ATGCCTTTCAGCTTCCAGGTAGG - Intronic
1103036043 12:117657286-117657308 CAGCCCTGCTGTTTTTAGGTCGG - Intronic
1103617272 12:122162308-122162330 CTGCCATGCTGTCTCTAGATGGG - Intergenic
1104604493 12:130177915-130177937 CTGGCTTCCTGTTTCTAAGGGGG + Intergenic
1105866130 13:24461363-24461385 TTGCAGTTCTGTTTCTGGGTAGG + Intronic
1105881339 13:24608940-24608962 GTGCCATTCATTTTCTAGGTAGG + Intergenic
1107484168 13:40810627-40810649 GTGCCATTCATTTTCTAGGTGGG + Intergenic
1107922536 13:45224494-45224516 CTTCTTTTCTGATTCTAGTTAGG + Intronic
1108424607 13:50286626-50286648 CTGCCTTTCTGAGTCTAAGACGG - Intronic
1109388814 13:61667377-61667399 CTGCTTATCTCTTTCTAGATGGG - Intergenic
1110259669 13:73471371-73471393 CTGACTTTCTGTTTCAATTTTGG - Intergenic
1110333329 13:74297667-74297689 TTGCCTCTTTATTTCTAGGTAGG - Intergenic
1112476285 13:99733828-99733850 CTCCCTGTCTGTTTTTTGGTGGG + Intronic
1115975367 14:38991076-38991098 CTGGCTTTCAGTTTCCAGCTGGG - Intergenic
1117036698 14:51737619-51737641 CTGCCTCCCTGTCTCTATGTAGG - Intergenic
1118133288 14:62992081-62992103 TTGTCTTTCTGTGTCTGGGTTGG + Intronic
1118886304 14:69869180-69869202 TTGCTTTTCTGTTTCTGCGTTGG + Intronic
1120410282 14:84145408-84145430 CTGCCTTACTGTCTCAAGATAGG - Intergenic
1120579752 14:86231232-86231254 CTGCCTTTCTGCTTTGAGCTGGG - Intergenic
1121600598 14:95200209-95200231 CAGCCTTTCTGGATCTGGGTGGG + Intronic
1124266857 15:28243851-28243873 CATTCTTTCTGTTTCTTGGTGGG - Intronic
1125121097 15:36159504-36159526 CTGCCTTTCTTCTTCTATATTGG - Intergenic
1126461236 15:48917119-48917141 CTACCTCTTTGTGTCTAGGTGGG - Intronic
1126910552 15:53412888-53412910 TTGCCTTTCTGTTCCCAGGCTGG + Intergenic
1127455425 15:59152240-59152262 CTACCTTTTTGTTTGTTGGTTGG - Intronic
1127921389 15:63497172-63497194 CTGTCTATTTGTTTCTAGCTAGG + Intergenic
1128628621 15:69239267-69239289 CTGCCTTTCTTTTTCTTTCTGGG + Intronic
1129193052 15:73948547-73948569 CTGCTTTTCTGCTTCTGAGTGGG - Intronic
1130705445 15:86228915-86228937 GTTCCTTTCTGTGTCTATGTAGG + Intronic
1132315406 15:100886617-100886639 ATGCCTCTCTCTTTCTAGGAAGG - Intronic
1132328538 15:100993895-100993917 CTACCTATCTGTTCCTTGGTTGG + Intronic
1132545300 16:530277-530299 GTCCGTTTCTGTTTCTTGGTAGG + Intronic
1133998643 16:10766037-10766059 CTTCCTGTCTGTTCCTAGGAAGG - Intronic
1134386012 16:13773318-13773340 CTGCCTTTTTTTTGTTAGGTTGG - Intergenic
1134855566 16:17515854-17515876 CTTCCTGTCTTTTTCCAGGTAGG + Intergenic
1135002337 16:18787276-18787298 CTTAGTTTCTGTTTCTAGTTGGG + Intronic
1135802320 16:25509397-25509419 TTGCCTTTCTTTTTATAAGTAGG - Intergenic
1138234424 16:55369741-55369763 CTGACTTTTTGTTCCTAGCTGGG + Intergenic
1138446476 16:57067369-57067391 CTCCCTGTCTGTGTCCAGGTTGG + Exonic
1139132521 16:64163523-64163545 GGGCCTTTCTGTTTCAAGGATGG + Intergenic
1140527597 16:75636543-75636565 TTGCTCTTCTTTTTCTAGGTAGG - Exonic
1141048274 16:80736998-80737020 CTGCCTTTCTTTTGTTACGTGGG + Intronic
1141448792 16:84082384-84082406 TTGCCTTTTTGTTTCCAGATTGG + Intronic
1142129722 16:88427157-88427179 CTCCCTTCCTGCTTCTAGGTAGG + Intergenic
1144241929 17:13321140-13321162 CTTCCTTTCTTATTCTAGTTGGG + Intergenic
1144458499 17:15438200-15438222 CTGCATTTCTCTTTGTTGGTAGG - Exonic
1144513655 17:15899697-15899719 TTGGTTTTCTGTTTCTATGTGGG + Intergenic
1145795901 17:27655230-27655252 CTGCGGTTCTGATTCTAGGCAGG + Intergenic
1146937152 17:36819020-36819042 CTCCCTTCATTTTTCTAGGTTGG - Intergenic
1147052014 17:37802400-37802422 CTGGCTTTCTTTATATAGGTGGG + Intergenic
1148768420 17:50052995-50053017 CTGTCTGTGTGTTTCTAGGTGGG + Intergenic
1149052239 17:52319452-52319474 CCTCATTTCTGTTTCTAAGTGGG + Intergenic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1150226127 17:63525392-63525414 CTGCCTTTGTGTTTACAGGCAGG + Intronic
1151717114 17:75836541-75836563 CTGCCTTCCTCTTCCTCGGTGGG - Intronic
1153230625 18:2931995-2932017 ATACATTTCTTTTTCTAGGTGGG - Intronic
1155088292 18:22479452-22479474 CTTCTTTTTTGTTTCTAGTTTGG - Intergenic
1155990608 18:32275408-32275430 CTGGCGTTCTGTTTTGAGGTGGG + Intronic
1157402069 18:47396887-47396909 CTGACTTTCTGTATATAGTTTGG - Intergenic
1158686954 18:59623279-59623301 CTGCCATTCTGTGTCTATCTTGG + Intronic
1159477009 18:68934986-68935008 CTGGCTTTCTGTTTCTCCATAGG - Intronic
1160094998 18:75863154-75863176 ATGTCTTTCTCTTTCTACGTAGG - Intergenic
1163300005 19:16438955-16438977 CTTCCTTCCCGTGTCTAGGTGGG - Intronic
1163311794 19:16519348-16519370 CTGCGTCTCTGTTTCCAGGCTGG - Exonic
1166767524 19:45260760-45260782 CTGCCTCTCTGTTTTAAGGGTGG + Intronic
1167577268 19:50323763-50323785 CTGCCCTTCTATCTCGAGGTGGG - Exonic
1167973529 19:53204930-53204952 ATGCCTTTCTTTTTCTAAGCAGG + Intergenic
1168483288 19:56739527-56739549 ATGCCTTTGTATTTCTAGATGGG - Intergenic
925308889 2:2867981-2868003 CTGAGTTTCTGTTTCTTTGTTGG + Intergenic
927256922 2:21047721-21047743 CTGTCATTCAGTTTCTAGGTAGG + Intergenic
929582997 2:43095546-43095568 ATTCATTTCTGTTGCTAGGTTGG - Intergenic
930298187 2:49581189-49581211 CTGCTTTTCTTTTTCTAAATGGG - Intergenic
931343169 2:61422446-61422468 TTGCCTTTCTGGTTCTGGGTTGG - Intronic
931483942 2:62671434-62671456 CTGCCTTAATGCTTCTAGGGTGG - Intergenic
931646970 2:64432788-64432810 CTGCCTTATTCTTCCTAGGTGGG + Intergenic
932168011 2:69525989-69526011 CTTCCTTCATGTTTCCAGGTGGG + Intronic
932884887 2:75540742-75540764 CTTCCTTTGTGTTTGTAGTTTGG - Intronic
934968105 2:98740691-98740713 CTGCGTTTCTGTTTCTACCTTGG - Intergenic
935960620 2:108422344-108422366 CAGCCATTCTGTTTCAAGATGGG - Intergenic
939095259 2:137826893-137826915 CTGCCTCTCTGTGGTTAGGTAGG - Intergenic
941047335 2:160691249-160691271 TTGCCTTTCTGTTTCTTTGATGG - Intergenic
941676597 2:168349163-168349185 TTGACTTTCTGTCTTTAGGTTGG + Intergenic
942872038 2:180746506-180746528 CTGGTTTTCTGTTTCTGTGTTGG + Intergenic
943433269 2:187830791-187830813 CTGCCTTCCTATATCTAGGCAGG - Intergenic
944263832 2:197702737-197702759 TTGGCTTTCTGTTCCTATGTTGG + Intronic
944506755 2:200420316-200420338 TTGAAATTCTGTTTCTAGGTAGG - Intronic
946412292 2:219521432-219521454 CTGCCCTTCTGCTTCTTGGGAGG + Intronic
946562042 2:220924947-220924969 GTGCCTTTCAATTTCTAAGTAGG - Intergenic
947385817 2:229589003-229589025 CTGCCTTTCTTTTTCCTTGTAGG + Intronic
947580741 2:231315923-231315945 TTGCCTTTTTGTTTGTAAGTTGG + Intronic
948301132 2:236908430-236908452 CTCCCTTTATTTTTCTAGGTTGG + Intergenic
948456958 2:238109060-238109082 CTTCCTATCTCTGTCTAGGTTGG - Intronic
948655627 2:239475327-239475349 GGGCCTTTCTGTGTCTGGGTGGG + Intergenic
949082647 2:242116843-242116865 CTGCCTTTCTTTTGCCAAGTTGG + Intergenic
1168860007 20:1039355-1039377 CTGCATTGCTATTTCTTGGTAGG + Intergenic
1171811945 20:29751855-29751877 CTGCCTGTCTGTCTGTCGGTAGG - Intergenic
1173112819 20:40209849-40209871 CTGATTTTCTGTTTTTATGTTGG - Intergenic
1175326039 20:58129188-58129210 CTGGCTTTCTGTGTCCAGGGTGG - Intergenic
1177382957 21:20369473-20369495 CTGCTTTTTTGTTTCCATGTTGG + Intergenic
1177572005 21:22899290-22899312 CTGCCTTACTGTTTCAAACTGGG + Intergenic
1180093544 21:45544061-45544083 CTGCCTTGCTGTCTCCAGGCGGG - Intronic
1180232368 21:46434808-46434830 GTGCCTGTCTGTGTCTATGTTGG + Intronic
1180870914 22:19146876-19146898 CTGCTTTTTTGTTTGTCGGTTGG - Intergenic
1181960490 22:26618756-26618778 CTGACTTCCTCTTTGTAGGTTGG + Intergenic
1183254839 22:36755832-36755854 CTGCCTTTCAGTGACTAGGATGG - Intergenic
1183814184 22:40285627-40285649 CTGCTTTTCTGTTTACAGGGCGG + Exonic
1183900243 22:41000019-41000041 CAGCTTTTCTGTTTCTTGGGGGG + Intergenic
949221570 3:1640109-1640131 TTGCCTTTCTGCTTTCAGGTGGG - Intergenic
949499206 3:4662760-4662782 CTCTCTTTCTGTCTCTAAGTTGG + Intronic
953062335 3:39437608-39437630 CTGTCTTTCTGATTCTATGCAGG + Intergenic
953109736 3:39922351-39922373 CTGCTTAGCTTTTTCTAGGTAGG - Intronic
953773693 3:45797878-45797900 CTGCTTTGCTTTTTCGAGGTAGG - Intergenic
956881073 3:73511281-73511303 GGGCCTTTCTGTTTTTGGGTTGG - Intronic
956916427 3:73876608-73876630 CTGCCTTCCTGTCTCTCAGTCGG - Intergenic
957288594 3:78248717-78248739 CTGCCTCCCTTTTTCTAGATAGG + Intergenic
958745915 3:98134264-98134286 CTGCCTCTCACTTTCTAGGATGG + Intergenic
960568054 3:119156309-119156331 CACCCCTTCTGTTTCTAGCTAGG - Intronic
961106119 3:124243107-124243129 CTGCCTGTCTGTTTCTATATTGG + Intronic
962211200 3:133480098-133480120 TAGCCACTCTGTTTCTAGGTGGG - Intergenic
962211215 3:133480197-133480219 TAGCCACTCTGTTTCTAGGTGGG - Intergenic
962336083 3:134531827-134531849 CCACCTTTCTGCTTTTAGGTTGG + Exonic
962432550 3:135333287-135333309 CCACCTTTCTGTATCAAGGTAGG + Intergenic
964980286 3:162669730-162669752 CTGCCTCACTCTTTCTAGATGGG + Intergenic
969484940 4:7466934-7466956 CTGCCTTTCTCTTTGGAGATGGG + Intronic
970405743 4:15761505-15761527 CTTCCTGTCTGTTGCTAGCTTGG + Intergenic
971850195 4:31975480-31975502 CTGCCTTTCTGTGTATAAATTGG - Intergenic
972407203 4:38758107-38758129 CTGTCTTCCTGTGTCTGGGTAGG + Intergenic
973080685 4:45988982-45989004 ATACCTTTCTCTTTCTATGTGGG + Intergenic
974386590 4:61207950-61207972 CTGCCTATCTTTTTACAGGTTGG - Intronic
975077081 4:70223396-70223418 TAGCCTTTCTTTTTCTAGATTGG + Intergenic
975570227 4:75809002-75809024 CTGCTTTTCTGTCTGTAGTTTGG - Exonic
977083413 4:92562637-92562659 GTTCCTTCATGTTTCTAGGTCGG - Intronic
977862746 4:101985203-101985225 TTGCCTGTCTGTTTCTGAGTTGG - Intronic
979846973 4:125525931-125525953 GTTCTTTTTTGTTTCTAGGTGGG + Intergenic
980501405 4:133658962-133658984 CTGCCTTTTTTTTTCTATTTAGG + Intergenic
981413972 4:144466219-144466241 CTGCCTTAGTGTCTCTAGGTGGG - Intergenic
982239625 4:153286012-153286034 GTTCCCTTCTGTTTCTAGTTTGG + Intronic
983038867 4:162900788-162900810 TTGCCTTTCTGTCTCTCTGTGGG + Intergenic
984120477 4:175735932-175735954 CTGCCTTTATATTTTTATGTAGG - Intronic
984809748 4:183784635-183784657 CTGGCCTTATGTTTCTGGGTAGG - Intergenic
986115900 5:4774319-4774341 CTGCCTGTCAGTCTCCAGGTCGG - Intergenic
987214214 5:15715817-15715839 CTGATGTTCTGTTTCTAGTTCGG - Intronic
987779565 5:22416633-22416655 ATTCCTTTCTTTTTCTAGCTGGG - Intronic
988079532 5:26399184-26399206 GTGCATTTCTGTTTGTAGGAAGG - Intergenic
988222165 5:28361748-28361770 GTGGCATTCTGTTTTTAGGTAGG - Intergenic
991112862 5:62921168-62921190 CTGCTTTTCTGTTTCTCAGTAGG + Intergenic
991464369 5:66894722-66894744 TTGCCACTCTGTTTCTATGTGGG + Intronic
992201846 5:74392641-74392663 CTTCCTTGATGTTTCTTGGTAGG + Intergenic
992350117 5:75920430-75920452 CTGCCTTCCTATTTTTAGTTTGG - Intergenic
992356904 5:75995078-75995100 CTGCCTTTTTTTTTCTATTTAGG + Intergenic
992749136 5:79846261-79846283 CGGCTTTTCTTTTTCTAGGAAGG - Intergenic
992972376 5:82075076-82075098 CTTGCTTTCTGTTTCTGAGTTGG + Intronic
994293767 5:98064217-98064239 CTGCCTAGTTGTTTCTAGGAGGG + Intergenic
994337430 5:98584472-98584494 CTGAGATTCTGATTCTAGGTTGG - Intergenic
994345400 5:98679678-98679700 CTGCATTGCTGTTTCTCCGTTGG - Intergenic
995805970 5:116052826-116052848 CTTCCCTTTTGTTTCCAGGTGGG + Intronic
997091243 5:130861221-130861243 ATGACTTTTTGTTTCTAGTTTGG - Intergenic
997288488 5:132702857-132702879 GTGACTTTCTGTTTTTAGTTTGG - Intronic
997978978 5:138457476-138457498 CTGTCTTTCTGTCTCTACCTAGG + Intergenic
998481343 5:142465771-142465793 CTGACTTTCTTTCTCTAAGTGGG - Intergenic
998656541 5:144187343-144187365 CTGCCTTTCTATTTCTAACAGGG + Intronic
999231356 5:150063898-150063920 CTTCCTTTAAGTTTCTAGCTCGG - Intronic
1001052523 5:168424527-168424549 CAGCCTTTCTGGTTAGAGGTGGG + Intronic
1001499089 5:172214837-172214859 CAGACTTTCTGTTTCTAGTCTGG + Intronic
1003993407 6:11511725-11511747 CTTCCTTTGTGTTTCTAGCCAGG - Intergenic
1006448250 6:34091756-34091778 CTGCCTGGCTGTTGCCAGGTGGG - Intronic
1006811277 6:36822045-36822067 CTGCCTGTCTGTCTCTAATTCGG - Intronic
1006974221 6:38082374-38082396 CTGCCTTTCTGTTTCTAGGTGGG + Exonic
1007290638 6:40783572-40783594 CTGCCTTCTTGTATCTAGTTGGG - Intergenic
1007398796 6:41592007-41592029 CTGTCTGTCTGTCTCAAGGTGGG + Intronic
1008288058 6:49678559-49678581 CTGGCTTTCTGTTTCTCCGGTGG + Intergenic
1008546793 6:52590268-52590290 CAGCTCTGCTGTTTCTAGGTAGG + Intergenic
1010048081 6:71470621-71470643 TTGGCTTTCTGTTTCTGAGTTGG + Intergenic
1010933470 6:81832257-81832279 CTGCCATTGTGTTGCTGGGTGGG - Intergenic
1015774323 6:136798363-136798385 CTTCCTTTCTGTTTATCAGTTGG + Intergenic
1016013317 6:139160436-139160458 CTGCTGTTCTGTTTTTAGTTTGG + Intronic
1017129802 6:151098482-151098504 CTTCCTTTCTGCTTCCAAGTAGG + Intronic
1018553074 6:165021071-165021093 CTGCCTTGCTGGTTCTCGGCGGG + Intergenic
1019287656 7:231635-231657 CTGCCTGCCTGTTTCCAGGAGGG + Intronic
1019963216 7:4478571-4478593 CTTCCTTCCTGATTCTAGGATGG - Intergenic
1022146851 7:27552341-27552363 TTGCTTTTCTGTTTCCAGCTTGG - Intronic
1022827269 7:34028123-34028145 CTACATTTCTGTGTTTAGGTTGG + Intronic
1023683329 7:42711200-42711222 CTTCCTTTCTGTATTGAGGTAGG - Intergenic
1024604864 7:51014858-51014880 CTGCCTTTCTGATTATAGCCAGG - Intergenic
1027952092 7:84829613-84829635 CTGACTTTCTTTTTTTTGGTTGG - Intergenic
1028025192 7:85828490-85828512 CTTCCTTTCTCTTTCTAAGGTGG + Intergenic
1028114253 7:86979861-86979883 CTTCGTTTCTGTTTCTGGTTGGG + Intronic
1031763832 7:125749073-125749095 CTGCCATTCTTTTTATATGTGGG + Intergenic
1033041267 7:137920480-137920502 CTACCTGTCTGTTTCTGTGTGGG - Intronic
1033426663 7:141250918-141250940 ATGCCCTTCTGTTGCGAGGTGGG - Intronic
1033921102 7:146393256-146393278 ATGCCATTATGTTTCCAGGTGGG - Intronic
1034150771 7:148913951-148913973 ATTCCTTTCTGTTTCCATGTGGG - Intergenic
1034968246 7:155404410-155404432 CTCCCTCTCTGTTCCTGGGTTGG - Intergenic
1035540570 8:433546-433568 CTGCCTTTCTTTTGCCAAGTTGG + Intronic
1037204328 8:16295396-16295418 ATGCCTTTGTCTTTTTAGGTGGG + Intronic
1037646594 8:20798045-20798067 CTGCTTTTTTGTTTGTTGGTTGG + Intergenic
1037745690 8:21642427-21642449 ATGCCTTTCTGTTTATTGGCTGG - Intergenic
1039247302 8:35623126-35623148 CTGCCTCTCTGTCTCTCGGATGG + Intronic
1040783303 8:51137369-51137391 CTGCATTTCTATTTCAGGGTAGG - Intergenic
1041180814 8:55246120-55246142 CTGCCTTTGTGTTTTTATTTAGG + Intronic
1048707718 8:137172777-137172799 CTACTTTGCTGTTTTTAGGTGGG - Intergenic
1049117431 8:140701653-140701675 CTGTCTTCCTGTTTCTTCGTTGG + Intronic
1049220146 8:141425346-141425368 CCGTCTTTCTGTCTCTAGGGTGG + Intronic
1049547932 8:143243232-143243254 CTGCACTTCTCTTTCTATGTTGG - Intergenic
1050090376 9:2012454-2012476 TTGCTTTTCTCTTTCTAGTTTGG - Intergenic
1050460311 9:5871951-5871973 CTGCCTGTCTGTCTCTAATTTGG - Intergenic
1052935936 9:34093212-34093234 CTGACTTTCAGTTTCTTTGTTGG - Intronic
1055605839 9:77969488-77969510 ATGACTTTTTGTTTCTAAGTTGG - Intronic
1058006399 9:99920084-99920106 CTTCCTTTGTGTTTCAAGATAGG + Intronic
1061928224 9:133818055-133818077 CTGCCTTTTTTGTTCTACGTGGG - Intronic
1186729714 X:12396298-12396320 CTGACTTTCTTTTTCTTTGTAGG + Intronic
1189846493 X:45143479-45143501 CTGCTTTTCTCTTTCTCAGTGGG - Intergenic
1190855798 X:54293554-54293576 CTGATTCTCTGTTTTTAGGTTGG - Intronic
1194778641 X:97996033-97996055 CTCTCTTTCTGATTCTAGGCTGG - Intergenic
1195425212 X:104721418-104721440 CTGGTTTTCTGTTTCTGAGTTGG - Intronic
1195879769 X:109580412-109580434 CTGCATTTCTGTTTCCATTTAGG + Intergenic
1197241274 X:124125692-124125714 CTGCCCTTCTGTGTGGAGGTAGG + Intronic
1199692946 X:150322394-150322416 CTGCCTTGTTATTGCTAGGTGGG - Intergenic
1201331224 Y:12823596-12823618 CTGAGTTTCTGTTTCTTGATAGG - Intronic
1202072059 Y:21002196-21002218 CTGACTCTCTTTTTCTAAGTGGG - Intergenic
1202081610 Y:21089526-21089548 CTTCCTTTCTGGTACTGGGTTGG + Intergenic