ID: 1006974440

View in Genome Browser
Species Human (GRCh38)
Location 6:38085351-38085373
Sequence CCTTGTATGGATAGATTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006974440_1006974447 27 Left 1006974440 6:38085351-38085373 CCATCCAATCTATCCATACAAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1006974447 6:38085401-38085423 TAATGATGTGTGTTAGAACAAGG 0: 1
1: 0
2: 2
3: 27
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006974440 Original CRISPR CCTTGTATGGATAGATTGGA TGG (reversed) Intronic
907354047 1:53857618-53857640 CATTGTATGTATAGATGAGAAGG - Intronic
912055028 1:105584941-105584963 CCTTGAATTGATAGTTTTGATGG + Intergenic
919684689 1:200472964-200472986 CCTTGTATGGATCTATTGCAAGG - Intergenic
920741340 1:208583967-208583989 GCTTGTATGGTTTGATTTGAGGG - Intergenic
923522982 1:234750430-234750452 CCTTGCTTGAAGAGATTGGAAGG - Intergenic
1069603578 10:69725457-69725479 TGTTGGATGGATGGATTGGATGG - Intergenic
1070353549 10:75616816-75616838 TCTTGTATGGTTTGATTTGAAGG + Intronic
1073094346 10:100970503-100970525 CCTTGGATGGGCAGATGGGATGG - Intronic
1075925957 10:126252026-126252048 GGTGGGATGGATAGATTGGATGG + Intronic
1078632507 11:13016116-13016138 CCTTGCATGGATTGCTTTGAAGG + Intergenic
1079793762 11:24772606-24772628 CCTTATATGGATAGTTTATAGGG - Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1080605029 11:33858304-33858326 CATTGTATGGAGTGAGTGGAAGG - Intergenic
1090480135 11:127060825-127060847 CCTTGCACGGATATATTGCATGG + Intergenic
1104544847 12:129701355-129701377 CCTTGGAAGGATATATTGGGAGG + Intronic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1111580179 13:90212191-90212213 CCTTTTAAGCACAGATTGGAAGG - Intergenic
1114399888 14:22400257-22400279 GCTTGCATGGGGAGATTGGAGGG - Intergenic
1116329044 14:43573079-43573101 CCTTGTATGGCTAAATTCTATGG + Intergenic
1122009200 14:98731888-98731910 CATTGTACGGATGGATTGTATGG + Intergenic
1124026981 15:25975814-25975836 CCTTGTACGGAAAGATCAGATGG + Intergenic
1125417035 15:39464907-39464929 CATTGAATAGATAGCTTGGATGG - Intergenic
1129496954 15:75992513-75992535 CCTTAAATGGATAGATTGTACGG - Intronic
1131026996 15:89151724-89151746 CCTTGTATGGGAAGATGGGAAGG + Exonic
1131034503 15:89212654-89212676 ACATGTATGAAAAGATTGGAAGG + Intronic
1134830682 16:17320321-17320343 CCTTGATGCGATAGATTGGAGGG - Intronic
1135618196 16:23930215-23930237 CTTTGTATGGATTGTATGGATGG + Intronic
1138324582 16:56153655-56153677 CCTTGCATGCATATATTGTATGG + Intergenic
1141722053 16:85761842-85761864 CGTGGTATGGAAAGATGGGATGG + Intergenic
1146011178 17:29196069-29196091 CCTGGTGTGGCTAGAATGGAGGG + Intergenic
1146939706 17:36836031-36836053 CCATGTAGGGATGGATTGTAGGG + Intergenic
1148674880 17:49439356-49439378 CCTTGTAGGGACTGAATGGAGGG - Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151404142 17:73875982-73876004 CCTTGAATGGATAGAGAGGCAGG - Intergenic
1153180330 18:2425813-2425835 CATTGGATGGATAACTTGGATGG - Intergenic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155419103 18:25634534-25634556 CCTTGTATGGATGGATAGACAGG - Intergenic
1158169712 18:54583896-54583918 CCTTGTATGTAAATACTGGAAGG - Intergenic
1158614966 18:58978808-58978830 CCTTATATGGATAGCTTGAAGGG + Intronic
1158750973 18:60260501-60260523 CTTTGTATGGATATATTATAAGG + Intergenic
1164780699 19:30889422-30889444 CCATGCATGGAGAGATAGGATGG - Intergenic
926813998 2:16782224-16782246 CCTTGGATGGATATATTTTAAGG + Intergenic
928069223 2:28198034-28198056 CCATGTAAGGATAAATTAGAAGG + Intronic
929006493 2:37398389-37398411 CATTGTGTGGATACATTGGGAGG + Intergenic
937906817 2:127056524-127056546 CCTAGTGGGGATAGGTTGGAGGG - Intronic
941615513 2:167714110-167714132 CCTTGTTTGGATAAAATGGATGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943987201 2:194638569-194638591 CCATGTATGGATGGAGTGGGAGG + Intergenic
945104245 2:206294275-206294297 CTTTTTATGGATAGATGGTAAGG + Intronic
945647038 2:212510241-212510263 TGTTGTATGAATACATTGGATGG - Intronic
947929987 2:233956567-233956589 ACATGTATGTATAGATTTGAAGG + Intronic
1169267056 20:4173041-4173063 CCTTTGACGGATTGATTGGAGGG + Intronic
1169712366 20:8579423-8579445 GCTTGTATGGGTAGACTGCATGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171442650 20:25177773-25177795 CTTTGGATGCATCGATTGGATGG + Intergenic
1175406989 20:58741381-58741403 CATGGCATGGACAGATTGGATGG - Intergenic
1179073372 21:38094294-38094316 ACTTGTATGGATGGAAAGGAAGG + Intronic
1181163537 22:20971517-20971539 CCTTGTCTGGGTAGATAGGAAGG + Intronic
1181869215 22:25884715-25884737 CCTTGTATGTCCAGTTTGGAGGG + Intronic
1182412066 22:30195727-30195749 CATTTTATGGGTAGATAGGATGG - Intergenic
955085636 3:55699899-55699921 TCCTGTATGGAAAGATGGGAAGG + Intronic
955319161 3:57961917-57961939 CCTTGCATGGGTACATTGGCTGG - Intergenic
961075567 3:123978764-123978786 TCATGTCTGGATAGAATGGAGGG + Intronic
961308120 3:125973744-125973766 TCATGTCTGGATAGAATGGAGGG - Intronic
964494956 3:157278733-157278755 TCTTGTGGTGATAGATTGGATGG + Intronic
964604296 3:158542653-158542675 CCTAGGATGGAAAGGTTGGAAGG + Intronic
966420810 3:179732518-179732540 ACTTGAATGGTGAGATTGGAAGG - Intronic
974455579 4:62125602-62125624 ACTTGTATGGCTAGATTAAATGG + Intergenic
975715732 4:77204007-77204029 CCTTGTGTGGAAGGAATGGAGGG - Intronic
977044147 4:92048136-92048158 AATTGTATTTATAGATTGGAAGG - Intergenic
977192294 4:94016031-94016053 TCTTTTATGGTTAGACTGGAGGG + Intergenic
978597807 4:110397500-110397522 AGTGGTATGGACAGATTGGACGG + Intronic
979759636 4:124386233-124386255 GATTGTATGGAAAGATTGTATGG - Intergenic
984308275 4:178022770-178022792 CCTTGGATGACTAGATTCGATGG + Intergenic
984445912 4:179835196-179835218 CCTTCTATGGATTGATAGAAAGG + Intergenic
986300135 5:6471953-6471975 CCTTGCATGGATGGACTGGTGGG - Intronic
987371520 5:17197869-17197891 CTTTGGATGGATAGATTGGTTGG + Intronic
988152831 5:27408550-27408572 CCTCATTTGGATAGATGGGAAGG + Intergenic
990457586 5:56003183-56003205 TCTTCTATGGAGAGATTTGAGGG + Intergenic
990473482 5:56139770-56139792 CTCTGTAAGAATAGATTGGAAGG + Intronic
993205367 5:84871861-84871883 GCTTCAAAGGATAGATTGGAAGG + Intergenic
994611067 5:102040349-102040371 CCTTGTGTGTATAGAGGGGAGGG - Intergenic
995137246 5:108693031-108693053 CCTTCAATGGTTTGATTGGATGG + Intergenic
998190865 5:140023383-140023405 CCTTGAATGAATAGATTTGGAGG - Intronic
1000641827 5:163712144-163712166 ACTTGTAAGGATAGATGGGAAGG + Intergenic
1001569153 5:172718831-172718853 GGATGTATGGATGGATTGGATGG + Intergenic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1008297845 6:49799958-49799980 ACTTAAATGGATAGATTGCATGG + Intergenic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1028331633 7:89601778-89601800 CCTTGAATGGAGGGATTGGCTGG - Intergenic
1031821915 7:126512710-126512732 CCTTATATGCATGGTTTGGATGG - Intronic
1036889409 8:12586079-12586101 GGTTGGATGGATAGATTGGTGGG + Intergenic
1038319892 8:26516146-26516168 CCTTATATGAATAAATTAGAGGG - Intronic
1038394925 8:27239605-27239627 CCCTGAATGGATTGATTTGATGG - Intronic
1039461207 8:37746594-37746616 CCTTGCATGGATACATAGGAGGG - Intronic
1041861671 8:62520946-62520968 GCTTGTATGGAAAGAGTGCATGG + Intronic
1044790536 8:95842425-95842447 CCATATATGGATACATGGGATGG + Intergenic
1049246151 8:141563665-141563687 TGGTGGATGGATAGATTGGATGG - Intergenic
1051519624 9:17971179-17971201 CCTTTAATTGATAGTTTGGAGGG + Intergenic
1054852908 9:69866926-69866948 CCTGGAATGGATAGCTTGGCTGG + Intronic
1057329211 9:94096885-94096907 AAGTGTATGGATTGATTGGATGG + Intronic
1058563289 9:106252307-106252329 CCCCTTTTGGATAGATTGGATGG + Intergenic
1185823834 X:3229735-3229757 CTTTGTATGCATAGATAGAATGG - Intergenic
1187132290 X:16514439-16514461 CCTTCTGTGGCTATATTGGAGGG - Intergenic
1187505974 X:19878898-19878920 CCTTAAATGGATAAATTGTATGG + Intronic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1194985919 X:100489666-100489688 GATTGAATGGATTGATTGGAAGG + Intergenic
1196800417 X:119538349-119538371 CCTTGCATGGATACATGGGAGGG - Exonic
1198131055 X:133695388-133695410 CTTTAAATGGATAGATTGTATGG + Intronic
1198481078 X:137041285-137041307 TCTTGAATGGAGGGATTGGATGG + Intergenic
1201255590 Y:12105470-12105492 CTTTGTATGCATAGATAGAATGG + Intergenic
1202028013 Y:20544799-20544821 CCTTGGATGGTTACAGTGGATGG + Intergenic