ID: 1006974468

View in Genome Browser
Species Human (GRCh38)
Location 6:38085728-38085750
Sequence CTGCATGTATGGGCTGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006974468_1006974471 21 Left 1006974468 6:38085728-38085750 CCGTGCTCAGCCCATACATGCAG 0: 1
1: 0
2: 2
3: 23
4: 247
Right 1006974471 6:38085772-38085794 CACAAATATATACATATTAAAGG 0: 1
1: 0
2: 8
3: 118
4: 1054
1006974468_1006974472 28 Left 1006974468 6:38085728-38085750 CCGTGCTCAGCCCATACATGCAG 0: 1
1: 0
2: 2
3: 23
4: 247
Right 1006974472 6:38085779-38085801 ATATACATATTAAAGGTACATGG 0: 1
1: 0
2: 3
3: 44
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006974468 Original CRISPR CTGCATGTATGGGCTGAGCA CGG (reversed) Intronic
900427612 1:2587607-2587629 CTGCGGGGGTGGGCTGAGCACGG + Intronic
901245046 1:7723673-7723695 CTGATTGTATGTGATGAGCAGGG + Intronic
901245157 1:7724540-7724562 TTGCATGTATGGGCCGGGCGCGG + Intronic
901729177 1:11266295-11266317 ATATATGTATGGGCTGGGCATGG - Intergenic
901737328 1:11320621-11320643 CTGCAGGCATGGGCAGAGGAGGG - Intergenic
902569760 1:17339673-17339695 CTGCAGGTCTGGGATGAGAAGGG - Exonic
903595754 1:24493066-24493088 ATACATTTATGGGCTGGGCAAGG + Intergenic
903952840 1:27006080-27006102 CTGCAGGCACTGGCTGAGCAGGG - Exonic
904635696 1:31879289-31879311 ATGCAAGTTTGGGCTGGGCACGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905871110 1:41405121-41405143 CTAGATGGAGGGGCTGAGCAGGG - Intergenic
905935147 1:41817499-41817521 CTGCATGGCTAGGCTGAGCAGGG + Intronic
907484616 1:54768569-54768591 CAGCCTGTCTGGGCTGAGCTGGG - Intergenic
907818830 1:57946893-57946915 CTGCATGTAAATGCTGAACACGG - Intronic
909841132 1:80325952-80325974 CTACTTGCAGGGGCTGAGCAGGG + Intergenic
910116269 1:83735776-83735798 CTGCATGTGTGAGCTGAGCTTGG - Intergenic
911103278 1:94110539-94110561 CTTCAGGTATGGGCTGCACAAGG + Intronic
911956123 1:104237274-104237296 ATGCATTTATAGGCTGGGCACGG + Intergenic
912545063 1:110444813-110444835 CTGCGCTTATGGGCTGAGCCAGG + Intergenic
913445628 1:118947710-118947732 CTGCAAGTATGGATTAAGCATGG - Intronic
914720066 1:150282304-150282326 CCGCATGTAGGGGAGGAGCACGG + Intergenic
916595142 1:166235864-166235886 CAGCCTGTCTGGGCTCAGCATGG - Intergenic
919452033 1:197784198-197784220 AGGCATTTATGGGCTGGGCATGG + Intergenic
919841383 1:201611648-201611670 CTCCATGTGTGAGCTGAACAAGG + Intergenic
919918907 1:202156711-202156733 CTGCCTGCATGGGCGGATCAAGG - Intronic
920310928 1:205047873-205047895 CTGCAAGAATGGGATGAGAAGGG - Intronic
921316775 1:213899189-213899211 GTGCAAGTATGTGCTAAGCATGG - Intergenic
922449302 1:225723937-225723959 CTGCAACTATGGGCTCTGCAGGG + Intergenic
923751502 1:236750796-236750818 GGGCATCTAAGGGCTGAGCATGG + Intronic
1063543307 10:6956014-6956036 CTGCAAGGATGGGCATAGCAAGG + Intergenic
1064008642 10:11717518-11717540 CTGCAGGGGTGGGGTGAGCAGGG + Intergenic
1065172893 10:23049612-23049634 TGGCATGGATGGGCTGAGAATGG - Intergenic
1066091493 10:32025664-32025686 ATTCATGTGTAGGCTGAGCATGG - Intronic
1066443141 10:35457868-35457890 ATACAAGTATGGGCTGGGCATGG - Intronic
1066695654 10:38075500-38075522 CTGGAGGAATGGGCAGAGCAGGG + Intergenic
1069394664 10:67975638-67975660 ATGCATGTGTCGGCTGAGCATGG - Intronic
1073499955 10:103927700-103927722 TCGTATGTATGGGCTGGGCACGG - Intergenic
1074542150 10:114373887-114373909 CTGATTGTATGGGCAGAGAAGGG - Intronic
1075492995 10:122890216-122890238 CTGCTTGTTTCAGCTGAGCAGGG - Intergenic
1075582769 10:123634591-123634613 GTGCATGTGTGGGCTCAGAATGG + Intergenic
1077171010 11:1165739-1165761 CTGCAGCTATGTGCTGACCAAGG + Exonic
1078302798 11:10150178-10150200 CTCCATCTGTGGGCTGAGAAGGG - Intronic
1078418392 11:11184913-11184935 CTGAATGTTTGTGCTGAGCTAGG - Intergenic
1079770554 11:24453310-24453332 CTTTATGTATGAGCTAAGCATGG + Intergenic
1082615389 11:55353991-55354013 CTGCATGTTTGGTCAGCGCAGGG + Intergenic
1082659083 11:55888257-55888279 CTCCAGGTATGGACTGACCATGG + Exonic
1084353399 11:68620143-68620165 GTGCATGTGTGTTCTGAGCAGGG - Intergenic
1084620607 11:70267943-70267965 CAGCATGTATGAGCCAAGCATGG - Intergenic
1086839213 11:91664644-91664666 GTGGATGTATGGGCTGAGCAGGG + Intergenic
1087165911 11:95002035-95002057 CAGGATTTATTGGCTGAGCATGG - Intergenic
1089302815 11:117508726-117508748 CAGGATGTATGGGCAAAGCAAGG + Intronic
1091276938 11:134359104-134359126 CAACAAGGATGGGCTGAGCAAGG + Exonic
1091909703 12:4219599-4219621 CTGGAGGTAGGGGCTGGGCATGG - Intergenic
1092052723 12:5483955-5483977 CTGCCTCCATGGGCTGAGTAGGG + Intronic
1092484710 12:8892576-8892598 ATACATGTATAGGCTGGGCACGG - Intergenic
1094161421 12:27394859-27394881 CTGCATGAATGCAGTGAGCAAGG + Intronic
1096682997 12:53269299-53269321 AGGCATGGAGGGGCTGAGCAAGG - Exonic
1100501911 12:95182489-95182511 ATGTATGTATAGGCTGGGCAAGG - Intronic
1102888160 12:116537229-116537251 CAGCAAGCATGGGCTGGGCAGGG + Intergenic
1103479041 12:121239107-121239129 CTCCATGAATGGGCTGGGCAGGG + Exonic
1103796459 12:123506410-123506432 CAACATGTAGGGGCTGTGCAAGG + Intronic
1107976596 13:45694243-45694265 CTGCCTGCTGGGGCTGAGCAAGG - Intergenic
1108728623 13:53208396-53208418 CCCCATATATGTGCTGAGCAAGG - Intergenic
1108803028 13:54122674-54122696 ATGTATATATGGGCCGAGCACGG - Intergenic
1113579473 13:111418905-111418927 CTGCATGCAGGGGCTTAACAAGG - Intergenic
1113640445 13:111953396-111953418 CTGCATGTGTGTTCTGAGCCTGG - Intergenic
1113730952 13:112641142-112641164 TGGCTTGTATGGCCTGAGCAGGG + Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1115906158 14:38205501-38205523 ATACATGACTGGGCTGAGCACGG + Intergenic
1118216473 14:63813502-63813524 CTGCCTGTATTGGCTGGGCATGG + Intergenic
1119366043 14:74092624-74092646 CTACATTTATAGGCTGGGCATGG + Intronic
1120131095 14:80808388-80808410 CTGCATGTCTGGGCTGTGTGTGG + Intronic
1120988955 14:90358147-90358169 CTGCCTGTACAGGCTGGGCATGG - Intergenic
1121458954 14:94058715-94058737 CTGCATGTCTGAGCTGAGGCCGG + Intronic
1124381778 15:29173187-29173209 CTGCAGGAATGGGCGGGGCAGGG + Intronic
1124693986 15:31848170-31848192 CTGCCTGCAGGTGCTGAGCAAGG + Intronic
1125170150 15:36757627-36757649 CAGCATGGATGTGCTGGGCAAGG - Intronic
1125664690 15:41421028-41421050 GTACATGTATAGGCTGGGCATGG + Intronic
1125782154 15:42279317-42279339 TTGCATGTTTAGCCTGAGCAAGG + Intronic
1127838257 15:62808080-62808102 CTCCGTGTGTGGGCTGAGTAGGG - Intronic
1128447884 15:67780837-67780859 CTGGATGTATGGACAGAGCTAGG + Intronic
1128907510 15:71480902-71480924 CTGCATGCATGGGGTGTTCATGG - Intronic
1129727617 15:77909545-77909567 CAGCATGTGTGGGCTGGGGAGGG + Intergenic
1130763089 15:86841129-86841151 CTGCCTGTAGGGGCTGAGTGTGG - Intronic
1130895117 15:88164066-88164088 CTGGGTGTATGGGGTGAACAAGG + Intronic
1131467893 15:92670113-92670135 ATGCATGTAGGGGCTGGGCGCGG + Intronic
1131685362 15:94761712-94761734 CTGAATGTGTTGGCTGAGCTTGG + Intergenic
1132711436 16:1270272-1270294 CTTCATGTATGTGCTGCGCGGGG + Intergenic
1133112400 16:3556386-3556408 CTGTGTGTGTGGCCTGAGCAGGG - Intronic
1134823060 16:17262225-17262247 CTGCATCCAAGGGCTTAGCATGG - Intronic
1136998544 16:35208112-35208134 CTGCATGGAAGGGCTGGGCAGGG + Intergenic
1139799731 16:69512584-69512606 ATGCATGTGTTGGCTGAGCGCGG - Intergenic
1140699133 16:77565113-77565135 CTGCATATCAGGGTTGAGCAGGG - Intergenic
1141437696 16:84009810-84009832 CTTCATCTTTGGGCAGAGCACGG - Exonic
1141591263 16:85070386-85070408 ATGCATTTATGGGCTGAGTACGG + Intronic
1141597405 16:85105876-85105898 CTTCATGTCTGGGCTTGGCATGG - Intronic
1142711238 17:1725021-1725043 CTGCATGTCTGGGCTTGGCGGGG - Exonic
1143038647 17:4016238-4016260 GAGCATGGAGGGGCTGAGCACGG + Intronic
1143573673 17:7777183-7777205 CTGCAAGTATGGGCTAGGCCTGG + Intronic
1144766462 17:17735645-17735667 GTGCATCTTTGGGCTGGGCACGG - Intronic
1147383425 17:40068931-40068953 GTGCATGTGTGGGCTGGGGAGGG + Intronic
1148148254 17:45379564-45379586 CTGCATATTTGGGGAGAGCAAGG + Intergenic
1148476633 17:47932993-47933015 CTGCCTGTAAGGGGTGAACAGGG + Intergenic
1148913214 17:50954417-50954439 CTGCATGTCTGGGCTTGTCAGGG - Intergenic
1149022596 17:51986865-51986887 CGGCATGGATGTGCTGAACAGGG + Intronic
1150773200 17:68059166-68059188 CTGCATGAAGGGGCTGGGCGTGG + Intergenic
1151292895 17:73163319-73163341 CTGCAGGGATGGGCTGATCGTGG - Intergenic
1151805222 17:76400790-76400812 CAGCCTGTACAGGCTGAGCAAGG - Intronic
1151869553 17:76827144-76827166 TGGCAGGTCTGGGCTGAGCAAGG + Intergenic
1152409360 17:80114584-80114606 CTGCGTGGATGGGCTCATCATGG - Intergenic
1152919533 17:83059071-83059093 GTGCATGGACGGGCTGAGCGGGG - Intergenic
1154246887 18:12707246-12707268 ATACAAGTATGGGCTGGGCACGG - Intronic
1155587542 18:27384754-27384776 CAGCAAGTAAGGTCTGAGCAGGG + Intergenic
1156984391 18:43332082-43332104 ATACATGTTTGGGCTGGGCATGG + Intergenic
1157713896 18:49869304-49869326 CTGAATGTCTGGGCTGGGCCTGG + Intronic
1157862062 18:51150682-51150704 CTGCAGGTAGGGGCTCAGTAAGG + Intergenic
1160716351 19:578468-578490 CTGCAAGCCTGGGCTGAGCTTGG - Intronic
1162904261 19:13814337-13814359 ATGCATGTGTAGGCTGGGCATGG - Intronic
1163483564 19:17573101-17573123 CTGCATGTATAGGCCAGGCATGG + Intronic
1164563661 19:29310921-29310943 GGGAATGTATGGGCTGCGCAAGG - Intergenic
1165164629 19:33843164-33843186 CTGTATGTGTGTGGTGAGCAGGG - Intergenic
1165487617 19:36104940-36104962 CTGCAGGTCTGGGCTGGCCAGGG - Exonic
1166745209 19:45138606-45138628 CTGCAGGTATGGGCGGGACAGGG + Exonic
1166912992 19:46174097-46174119 CTGCCTGCCTGGGCTGAGAAAGG + Intergenic
1167535246 19:50046295-50046317 CTGTATAAATGGGGTGAGCAAGG + Exonic
1168685886 19:58349360-58349382 CTGCAAGAATAGGCTGGGCATGG + Intronic
926046817 2:9716109-9716131 CTGCTGGGATGGGCAGAGCATGG - Intergenic
926709341 2:15865115-15865137 CTGAATATGTGGGCTGGGCATGG + Intergenic
927075709 2:19574863-19574885 CTGCAGGTGTGGGCTGTGGAAGG + Intergenic
927838735 2:26423090-26423112 CTGCCTGTATGGGCTGTGCCAGG + Intronic
928529961 2:32180721-32180743 GTACATGCATGGGCTGAGCGCGG - Intronic
928943229 2:36749174-36749196 CTACCTGTATGTGCTGAGCAAGG + Intronic
929704434 2:44195499-44195521 ATACATGTCTGGGCTGGGCATGG - Intronic
933663732 2:84947852-84947874 AAGAATGTATAGGCTGAGCATGG - Intergenic
935069888 2:99684765-99684787 CTGAATTCATGGGCTGGGCACGG - Intronic
935353629 2:102177834-102177856 GTTCATGTGTGGGCTGTGCAAGG - Exonic
936063451 2:109313147-109313169 CTGTGTGCATGGGCTGAGCTGGG + Intronic
936080211 2:109427882-109427904 CTGCAGGTATGGCCTCAGGATGG - Intronic
938663602 2:133511430-133511452 CTGCAGTGATGGGCTGAGCTCGG + Intronic
938787914 2:134649722-134649744 CAGCCTATATAGGCTGAGCATGG + Intronic
940052722 2:149480822-149480844 CTGCATGTAGGGGCTGCCTAGGG - Intergenic
942374067 2:175317945-175317967 GTGCATGTGTGTGCTGAGGAGGG + Intergenic
944110286 2:196124487-196124509 TTGGGTGTATGGGCTGGGCACGG + Intergenic
944230575 2:197387793-197387815 CTGCATCTTTGGGCTGGGCTTGG - Intergenic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946737004 2:222764038-222764060 CTGTATGTATGGACTCAGCATGG - Intergenic
947517182 2:230815981-230816003 TTACATGTTTGGGCTGAGTATGG + Intronic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
947618930 2:231576350-231576372 CTGCATGAAGGCCCTGAGCATGG + Intergenic
1168963427 20:1884156-1884178 CTCCCTGAAAGGGCTGAGCAGGG + Intergenic
1169358664 20:4928959-4928981 AAACATGTATGGGCTGGGCACGG + Intronic
1169842014 20:9949093-9949115 CTGTATGTATGGGCTCAGCATGG + Intergenic
1172395571 20:34601989-34602011 ATGTATGTATGGGCTGGGTATGG + Intronic
1172617857 20:36301053-36301075 CTGCTTGTTTTGGCTGAGCCTGG + Intergenic
1174672284 20:52319383-52319405 GTGGATGTATGGGCTGACCCAGG + Intergenic
1174724748 20:52849914-52849936 CTGGATGTGTGGCCTGAGGAAGG + Intergenic
1175342386 20:58241899-58241921 GTGCATTCATGGGTTGAGCATGG - Intergenic
1176837809 21:13809980-13810002 CCACATGGATGGGCTGAGCTCGG - Intergenic
1178198234 21:30373135-30373157 TTCCATGTATGGGTTGAACAGGG - Intronic
1179423219 21:41252354-41252376 CTGGATATATGGGCGGAGTAAGG - Intronic
1179483232 21:41691858-41691880 CTGCAGGCAAGGGCTGAGCCTGG - Intergenic
1179839355 21:44060889-44060911 ATGTATGTATAGGCTGGGCATGG - Intronic
1179921849 21:44511881-44511903 CTGCAAGTTGGGGCTGAGCCGGG + Intronic
1182461955 22:30489646-30489668 CTGCATGTAGGAGGTCAGCAGGG - Exonic
1182464937 22:30508954-30508976 TTACACGTATGGGCTGGGCATGG + Intergenic
1183468568 22:37993152-37993174 CTGTAAATATGGTCTGAGCAGGG + Intronic
1184088557 22:42280532-42280554 CCACATGTAGGGGCAGAGCAGGG - Intronic
1184885774 22:47343716-47343738 CTGCATGCAGGGACTGAGTAGGG - Intergenic
950679342 3:14574291-14574313 GCGGCTGTATGGGCTGAGCATGG - Intergenic
950821967 3:15769953-15769975 CTGTGAGTATGGTCTGAGCAAGG + Intronic
951535059 3:23733136-23733158 ATGCATCTATGGGCACAGCATGG + Intergenic
952181659 3:30923059-30923081 CTTCATGTATGTTCTGAGCAAGG + Intergenic
953024343 3:39136244-39136266 CTGCCCATCTGGGCTGAGCAGGG - Intronic
953985464 3:47439116-47439138 ATGCATGACTAGGCTGAGCAAGG + Intronic
954670561 3:52289180-52289202 CAGCAAGTATGGACTGAGCAGGG - Intronic
954710654 3:52503674-52503696 CTTCAGGGAGGGGCTGAGCAGGG + Intronic
959086419 3:101855167-101855189 CTGCATGTGTGTGCTGAGAAGGG + Exonic
959874947 3:111372077-111372099 CTGAAGGTATGGGCTGGGTATGG + Intronic
960383323 3:116991084-116991106 ATGCATGTATGTGTTGGGCATGG + Intronic
960952973 3:123011589-123011611 GTGCATGTGTGTGCTGGGCAGGG - Intronic
961605907 3:128095249-128095271 CTGCAGGTATGGGCTGGGCTGGG + Intronic
962358944 3:134719291-134719313 CTGCATTTCTGGGCTGGGTATGG - Intronic
962828979 3:139123197-139123219 CTGCATGTAGGTGCTCAGCCAGG - Intronic
962847182 3:139282912-139282934 CAGCATGCTTGGGCTGGGCAGGG + Intronic
964169092 3:153746031-153746053 CAGGATGTGTGGGCTAAGCATGG + Intergenic
964841119 3:160994554-160994576 CTGAATGTATGTTCTGAGCTAGG - Intronic
965416610 3:168402750-168402772 CAGCATGAATGTGGTGAGCACGG - Intergenic
965545377 3:169910147-169910169 ATGCATGTCTAGGCTGGGCATGG + Intergenic
966090470 3:176129445-176129467 GTGCATGGATGGGCTGGGCATGG - Intergenic
966305081 3:178522633-178522655 CTGAAAGAATGGGATGAGCATGG - Intronic
966729179 3:183136331-183136353 CTGAATGTATTAGATGAGCAGGG + Intronic
970205915 4:13655232-13655254 CTGCATATCTGGACTGTGCAGGG + Intergenic
973553029 4:52054002-52054024 CTGCTGGAGTGGGCTGAGCAAGG - Intronic
973759780 4:54105208-54105230 CTGAATGTCTGGGCTGGGCCAGG - Intronic
975741768 4:77436113-77436135 CTGCAGGAATGCACTGAGCATGG - Intergenic
979152873 4:117342066-117342088 CTGCATCTCTTGGCTGAGGATGG + Intergenic
985047052 4:185951231-185951253 ATGCTTGTATGGACTGAGAAAGG - Intronic
985923057 5:2994490-2994512 CTCCATTGATGGGCAGAGCAGGG - Intergenic
994075240 5:95643030-95643052 CTGAATGTATGTTCTGAGCTAGG + Intergenic
995061203 5:107813511-107813533 CTACTTGTCTGGGCTGATCAAGG - Intergenic
998417628 5:141957269-141957291 CTGCATGTTTGGTCTCATCAGGG + Exonic
999097056 5:148988976-148988998 CTTCATGTCTGGGCTCAGTAGGG - Intronic
999692288 5:154158526-154158548 CTGCATGTGTAGGGAGAGCAGGG - Intronic
1001452668 5:171838257-171838279 CTTCATGCCTGGGCTGAGCAGGG - Intergenic
1001854592 5:174999904-174999926 CTGGATGCCTGGGCTCAGCACGG + Intergenic
1001957795 5:175860177-175860199 CTGTATGTATGGGATTAGCAGGG - Intronic
1003170949 6:3721562-3721584 CTGCAAGTATGGGCCCAGTATGG - Intergenic
1006638269 6:35475319-35475341 CTGCAGGTATGGGGGCAGCAGGG - Exonic
1006974468 6:38085728-38085750 CTGCATGTATGGGCTGAGCACGG - Intronic
1007101869 6:39254161-39254183 CTGCATGTATGGCCTGCGTCTGG - Intergenic
1007711410 6:43826475-43826497 CTGCCTGCAGGGTCTGAGCAAGG + Intergenic
1008263433 6:49394746-49394768 CAGAATGTGTGGGCTGGGCATGG - Intergenic
1008883933 6:56411311-56411333 ATGGATGTGTGGGCTGGGCATGG + Intergenic
1012044642 6:94255620-94255642 CTGCATGTATGGGGTGAGTGGGG + Intergenic
1013013339 6:106139522-106139544 ATGCATATATAGGCTGGGCACGG - Intergenic
1013037176 6:106396968-106396990 ATCCATGTATTGGCTGGGCATGG - Intergenic
1015902509 6:138082505-138082527 TCTCATGCATGGGCTGAGCAAGG - Intergenic
1017462668 6:154666164-154666186 ATGCAGGTGTGGGCTGGGCATGG - Intergenic
1018845737 6:167553978-167554000 CTGCATGCGTTGTCTGAGCAGGG + Intergenic
1022105053 7:27191453-27191475 CTGCGTGGATGGGCTGGGCTGGG - Intergenic
1025151821 7:56560869-56560891 CAACATATATGGGCTGGGCATGG - Intergenic
1025728772 7:64091642-64091664 ATATATATATGGGCTGAGCATGG + Intronic
1025794960 7:64730724-64730746 CTGTATTTATGGGGTGGGCATGG - Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1026669120 7:72371852-72371874 CTGCATTCATGGGGAGAGCAAGG - Intronic
1028457443 7:91053834-91053856 CTGCAGGTGTGGTCTGTGCAGGG - Intronic
1029807074 7:103009382-103009404 CAGCCTGTCTGGGCTCAGCATGG + Intronic
1029807342 7:103010707-103010729 CAGCCTGTCTGGGCTCAGCATGG - Intronic
1032432468 7:131873035-131873057 CTGGAATTATGGGCTGGGCATGG + Intergenic
1033040984 7:137917998-137918020 CTCCATCTCTGGGCTGAGCTGGG - Intronic
1033806307 7:144958187-144958209 CCGCAAGTGTGGGCTCAGCAGGG - Intergenic
1034970881 7:155418386-155418408 CTTCCTGTATGAGCTGGGCATGG - Intergenic
1035057327 7:156044214-156044236 CTGCAGGTTTAGGCTGGGCATGG + Intergenic
1035720382 8:1786863-1786885 CTGCAGGAATGGGCTGTGCACGG - Intergenic
1035823198 8:2616975-2616997 CTGCAGTTTTGGGCTGAGAAAGG - Intergenic
1038310692 8:26444185-26444207 CCTCACGTATGTGCTGAGCATGG - Intronic
1038422524 8:27442600-27442622 CTGCATGTTTGGGCTGGGACTGG + Intronic
1039133485 8:34294422-34294444 CTGAATGTATGCTCTGAGCTAGG + Intergenic
1039816526 8:41099622-41099644 CTTTATGTAGAGGCTGAGCAGGG - Intergenic
1047012799 8:120690770-120690792 CTCCAGGTACAGGCTGAGCAGGG - Intronic
1047610540 8:126516399-126516421 CTGCTATTATGGGCTGGGCACGG - Intergenic
1047912618 8:129546785-129546807 CTGCGAATATGGTCTGAGCAGGG + Intergenic
1048434974 8:134407751-134407773 CTGAACGTATGGGCTGAGGAGGG + Intergenic
1049044168 8:140136423-140136445 ATGCATGTATGTGCTCAGTAAGG - Intronic
1049337664 8:142095059-142095081 GGGCATGTGTGTGCTGAGCAGGG + Intergenic
1049620623 8:143596922-143596944 CTGCACGCATCAGCTGAGCACGG - Intronic
1050952962 9:11619794-11619816 CAGCATTTATGGGCAGAGCTGGG + Intergenic
1051744440 9:20281218-20281240 CTTCATGCTTGGGCTGGGCATGG - Intergenic
1055977165 9:81966789-81966811 GTGCATGGATGGGCAGAGCAGGG - Intergenic
1056024147 9:82475210-82475232 ATCCATGTATAGGCTGGGCATGG + Intergenic
1056197182 9:84240174-84240196 TTGCACTTATGGGCTGGGCATGG + Intergenic
1056780681 9:89547929-89547951 TTGCACATAGGGGCTGAGCAAGG + Intergenic
1056949653 9:91031907-91031929 ATGCATGAAAGTGCTGAGCATGG - Intergenic
1057091098 9:92258697-92258719 CTGCATGTATGGCCTCCCCATGG + Intronic
1057244525 9:93443709-93443731 GTGCAGCTCTGGGCTGAGCACGG + Intergenic
1058768560 9:108207698-108207720 GTGCATGGATGGGCTGCACACGG - Intergenic
1061155371 9:128857544-128857566 CTAAATGTATGGGCTGGGGACGG + Intronic
1062038625 9:134393881-134393903 CTGTATGAGTGGGCTGTGCAAGG + Intronic
1062263773 9:135677221-135677243 CTGCATGTCTGGGATCAGCCTGG + Intergenic
1062491079 9:136805180-136805202 CTGCAGGGCTGGGCTGAGGAGGG + Intronic
1062596861 9:137303466-137303488 CTGCCAGTATGGGCACAGCATGG - Intergenic
1186212507 X:7264385-7264407 CTGGCTGTGTGGGCTGACCACGG - Intronic
1186249385 X:7649914-7649936 CTGCTTGTGTTGGCTGGGCATGG + Intergenic
1186441558 X:9591409-9591431 CTGCATGAATCGGCTGGCCAAGG - Intronic
1187280187 X:17852581-17852603 TTCCATGTATGGGCAGGGCATGG + Intronic
1187579613 X:20593824-20593846 CTGAATGTATGTTCTGAGCTAGG - Intergenic
1189626247 X:42900241-42900263 ATGCATGTGTGCGCTAAGCAGGG + Intergenic
1190294543 X:49017588-49017610 TAACATGTATGGGCTGGGCATGG - Intergenic
1191181955 X:57573906-57573928 CTGGATGTCAGGGCTGAGCAAGG + Intergenic
1191215602 X:57929596-57929618 CTGGATATCAGGGCTGAGCAAGG - Intergenic
1199471991 X:148205716-148205738 CTGCAGGTATTAGCTGGGCATGG - Intergenic
1200868621 Y:8073550-8073572 CTGCATGAATGGGCAGGACATGG + Intergenic
1201713538 Y:17018165-17018187 CAGTATGTATCGGCTGACCATGG + Intergenic