ID: 1006974548

View in Genome Browser
Species Human (GRCh38)
Location 6:38086957-38086979
Sequence TAACCAGAACAACCTCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006974548 Original CRISPR TAACCAGAACAACCTCAAAC TGG Intronic
902831773 1:19018961-19018983 TAACCAAAACAATCTTGAACAGG + Intergenic
905484801 1:38287893-38287915 TAATCTGAACCACCTCAAACTGG + Intergenic
906800041 1:48729180-48729202 TACTCAGAACAACCCCATACAGG - Intronic
907587556 1:55634661-55634683 TAAACAGAAGAACCTCACAAAGG - Intergenic
907649527 1:56281519-56281541 TAACCAAAACAGCATCATACTGG - Intergenic
908279431 1:62516325-62516347 TATCCAGAACAGTCTCAACCAGG + Intronic
909424453 1:75506225-75506247 TAACCAAAACAACATCGTACTGG - Intronic
909991796 1:82232565-82232587 CAACCAAAACAACATCATACTGG - Intergenic
911375475 1:97045593-97045615 TAACCACAAAATCATCAAACTGG + Intergenic
911375510 1:97046123-97046145 TAACCACAAAATCATCAAACTGG - Intergenic
911886561 1:103308322-103308344 TAACCATAAGAACCTCTAATTGG - Intergenic
912082751 1:105957935-105957957 TAACCAAAACAACATGAAATTGG - Intergenic
912301807 1:108525514-108525536 TAACCAAAACAACATGATACTGG - Intergenic
913002801 1:114598189-114598211 TATTCATAACAACCTCAAACTGG + Intronic
913091600 1:115479915-115479937 TATAAAGAACTACCTCAAACTGG + Intergenic
916140359 1:161692119-161692141 CTACCTGAACAACCTGAAACTGG + Intergenic
916874558 1:168955070-168955092 TAACCAAAACAGCATGAAACTGG - Intergenic
917608759 1:176664858-176664880 TTACCAGAACATCATCAACCAGG - Intronic
919295372 1:195692349-195692371 TAACCAAAACAATCTTAAAAAGG + Intergenic
920064680 1:203259271-203259293 TAACCAAAACAACATGATACTGG - Intronic
920879162 1:209864251-209864273 TAAACAGAAACACCTGAAACTGG - Intergenic
921506345 1:215975689-215975711 TAACCAAAACAACATGATACTGG - Intronic
923578243 1:235181584-235181606 GAACCAGAACATCCTGAAAAAGG - Exonic
1063607572 10:7536220-7536242 ATACCAGCACAAACTCAAACAGG - Intergenic
1064185106 10:13154986-13155008 TAACCAAAACAGCCTGATACTGG + Intergenic
1064961965 10:20975274-20975296 TATCCATGTCAACCTCAAACTGG - Intronic
1065415492 10:25480974-25480996 TCTCCAGAAGAACCTCAATCGGG + Intronic
1066361855 10:34738922-34738944 AAACCAGAACAAGCACAAATGGG + Intronic
1066981133 10:42417652-42417674 TAACCAGAACAGCATGACACTGG - Intergenic
1067007086 10:42674407-42674429 CAACCAGCACAAACTCGAACAGG - Intergenic
1068069317 10:52176389-52176411 TAACCAAAACAGCATGAAACTGG - Intronic
1068271294 10:54729186-54729208 TAACCAGAACAGCATGATACTGG + Intronic
1068449656 10:57169751-57169773 CAAACAGAACAACCTGAGACTGG + Intergenic
1071743955 10:88393809-88393831 TAACCAAAACAGCATCATACTGG + Intronic
1071960292 10:90803554-90803576 TAAACAGAAACACCTGAAACTGG - Intronic
1072036249 10:91565603-91565625 TACCCAGGACACCCTCAAATGGG - Intergenic
1073360074 10:102891165-102891187 TAAACAGAAACACCTGAAACTGG - Intronic
1073433003 10:103499023-103499045 TACCCAGAAGAACCGAAAACAGG - Intronic
1075402786 10:122172995-122173017 TACCCAGAACATCCTCAGACAGG + Intronic
1075828346 10:125380357-125380379 TAACCAAAACAACATGATACTGG - Intergenic
1077474029 11:2778051-2778073 TAACCAGAACCACCGCAGGCCGG - Intronic
1077772549 11:5235894-5235916 TAATCATAAAAACCTCAAACCGG + Intergenic
1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG + Intergenic
1079474195 11:20811319-20811341 TAACCAAAACAACATGATACTGG - Intronic
1080046519 11:27814320-27814342 TAACAAGAACAACAACAAAAGGG + Intergenic
1080319475 11:30989819-30989841 TTACAAGAACAACCACAAATTGG - Intronic
1080613884 11:33929259-33929281 AAAACAGAACAGCCACAAACTGG + Intergenic
1081225039 11:40511123-40511145 TTACCACAGCAACCTCAAATGGG + Intronic
1081405474 11:42692766-42692788 TAACCAAAACAACATGATACTGG + Intergenic
1081467851 11:43340549-43340571 TAACCAAAACAGCCTGATACTGG + Intronic
1082151540 11:48746068-48746090 TAACCAAAACAGCATCATACTGG - Intergenic
1086227500 11:84529909-84529931 TAACCAAAACAGCCTAATACTGG + Intronic
1086737060 11:90319991-90320013 TAAATAGAAAAACCTGAAACTGG + Intergenic
1087607038 11:100389553-100389575 TAACCAAAACATCATCATACTGG + Intergenic
1087701863 11:101444035-101444057 TAAACAGAAACACCTGAAACTGG + Intergenic
1087706850 11:101503110-101503132 GGATCAGAACTACCTCAAACAGG + Intronic
1087707855 11:101515163-101515185 TAAGCAGCACATCTTCAAACTGG - Intronic
1088178138 11:107077436-107077458 TATTCACAACAACCACAAACTGG + Intergenic
1090733684 11:129592982-129593004 TAACCTTAACAGCCTCAATCCGG + Intergenic
1092324878 12:7519998-7520020 TAACCAAAACAGCATCACACTGG - Intergenic
1093064002 12:14637554-14637576 TAACCAAAACAACCTGTTACTGG + Intronic
1094324415 12:29221224-29221246 TAAGTAGAAAAACCTGAAACTGG - Intronic
1095327930 12:40920398-40920420 TAACCAGGCCAAACTCAAAGTGG - Intronic
1099421304 12:82464486-82464508 TAACCAAAACAACATGATACTGG - Intronic
1099598970 12:84707178-84707200 GAACCACAACAACCACAAATAGG + Intergenic
1100072867 12:90742735-90742757 AAACCAAAACAAACTCAAAAAGG - Intergenic
1101434544 12:104653879-104653901 TAGACTGAAAAACCTCAAACGGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103882572 12:124177426-124177448 AAACCAGAACAAACCCAGACAGG + Intronic
1105802454 13:23919736-23919758 TAACCAGAACAACATGATACCGG + Intergenic
1107150809 13:37108489-37108511 CAACAAGAACAACAACAAACAGG + Intergenic
1107296881 13:38918402-38918424 TAACCAAAACAACATGGAACTGG - Intergenic
1108160820 13:47637058-47637080 TAACCAGAACAGCATGATACTGG + Intergenic
1108934659 13:55869670-55869692 AAACCAGATCCTCCTCAAACAGG + Intergenic
1109714085 13:66198110-66198132 TAACCAAAACAGCATCATACTGG + Intergenic
1109805330 13:67432536-67432558 TAAACAGAAAAACCACAAACTGG - Intergenic
1112167649 13:96936703-96936725 TCACCAGAAAAACCTGAAAGTGG - Intergenic
1114586737 14:23821782-23821804 TAACCAAAACAACATGATACTGG - Intergenic
1114667472 14:24387915-24387937 TAGCCAGATCCACCCCAAACTGG - Intergenic
1116106758 14:40517903-40517925 TAACCAAAACAACCTGGTACTGG + Intergenic
1116482675 14:45410585-45410607 TAACCAAAACAACATCATACTGG - Intergenic
1116705239 14:48287576-48287598 TAACCAAAACAACATGATACTGG + Intergenic
1117071361 14:52059783-52059805 TAATCTGGAAAACCTCAAACTGG + Intronic
1118479566 14:66150644-66150666 TAACCAAAACAACATGATACTGG + Intergenic
1118890757 14:69906645-69906667 TAACCAGAACAAGGACAAAAAGG + Intronic
1119778535 14:77263021-77263043 TAACCAGAACACACTCAAGATGG - Intergenic
1120114154 14:80594088-80594110 TAACCAAAACAACGTGATACTGG + Intronic
1122715745 14:103696007-103696029 TCACCAGAACGACCACACACAGG - Intergenic
1124701951 15:31922509-31922531 TAAAAAGAAAAACCTCAAAATGG - Intergenic
1124960299 15:34388966-34388988 TGACCAGAAGAACCAGAAACGGG + Intronic
1124976928 15:34535187-34535209 TGACCAGAAGAACCAGAAACGGG + Intronic
1125787697 15:42336249-42336271 TAACCAAAACAACATGATACTGG + Intronic
1126897830 15:53278790-53278812 TAACCAAAACAACATGATACTGG + Intergenic
1128464464 15:67898253-67898275 TATTCATAATAACCTCAAACTGG - Intergenic
1133037568 16:3042652-3042674 GAACCAAAAAAACCACAAACTGG + Intergenic
1134776412 16:16857473-16857495 CAACAAGAACAAACACAAACAGG + Intergenic
1135660920 16:24295864-24295886 CAAACAAAAAAACCTCAAACAGG + Intronic
1137473713 16:48787784-48787806 TGACAAAAACAACCTCAAAAAGG - Intergenic
1137746246 16:50822344-50822366 TAAACAGAAACACCTGAAACTGG - Intergenic
1142800459 17:2341906-2341928 TATCCATAACAGCCCCAAACTGG + Intronic
1144458729 17:15440306-15440328 TAGCCAGAGCCTCCTCAAACTGG + Intronic
1144707940 17:17381854-17381876 TATTCATAACAGCCTCAAACTGG - Intergenic
1145039878 17:19569823-19569845 TCACCTGAACCACCTTAAACAGG - Intronic
1146495765 17:33320566-33320588 TAACAACAAAACCCTCAAACAGG - Intronic
1148257612 17:46149377-46149399 TAACCAGAACAACAATGAACAGG + Intronic
1148499712 17:48080511-48080533 TAACCAGTTTAACCTCAAATTGG - Intronic
1149198168 17:54148898-54148920 TAACCAAAAGAACCTGATACTGG - Intergenic
1150420417 17:65029112-65029134 TACCAAGAACTACCTAAAACAGG + Intronic
1151913313 17:77098944-77098966 TAACCACATCAAACCCAAACAGG - Intronic
1152945661 17:83196146-83196168 TACAAAGAACAACCACAAACTGG - Intergenic
1154401166 18:14038962-14038984 TAACCACAACAGCCTGATACTGG - Intergenic
1154403874 18:14069741-14069763 TAACCAAAACAACATGATACTGG + Intronic
1155708616 18:28847607-28847629 TAACCAGATCACCATCAAGCTGG + Intergenic
1155793199 18:29999063-29999085 TAACCAGAATATCTTCAATCTGG - Intergenic
1156665598 18:39402357-39402379 TAACCAGACCAACTTCTTACCGG - Intergenic
1157191955 18:45589190-45589212 TATCCAGGGCAACTTCAAACAGG - Intronic
1159825879 18:73209768-73209790 TAACCAAAACAACATGATACTGG + Intronic
1160671619 19:367406-367428 TAACCAAAAAAACCCCAAAAGGG + Intronic
1162337378 19:10070357-10070379 CAACCAGGATGACCTCAAACAGG + Intergenic
1162682888 19:12360291-12360313 TAACAAATACAACCTCAAACAGG + Intronic
1162704804 19:12547545-12547567 TAACTATTACAACCTCAGACAGG + Intronic
1163557295 19:18000005-18000027 TAACCAGAACTCCCTAAAAAGGG + Exonic
1164286246 19:23820177-23820199 TGCCCAGAACAACCTAATACAGG - Intronic
1164619364 19:29685119-29685141 TATTCATAACAACCCCAAACTGG - Intergenic
930006252 2:46899408-46899430 TAACCAAAACCAACTCAACCTGG - Intergenic
930856548 2:56025116-56025138 TAACCAAAACCACCTTAAAGGGG - Intergenic
930961105 2:57262783-57262805 TAACCAAAACAACATGATACTGG - Intergenic
934944376 2:98527445-98527467 TAACCAAAAAAACCTTAAAAGGG + Intronic
935045431 2:99477701-99477723 TAATCAGATCAGCCTCAAACTGG - Intronic
935290405 2:101605718-101605740 TAACCAGAACAACATGGTACTGG + Intergenic
935974879 2:108568515-108568537 TATCCAGAACAATCTAAAGCAGG - Intronic
936765884 2:115848214-115848236 TAAACAGAAACACCTGAAACTGG + Intergenic
938953370 2:136277624-136277646 TAACCAGAAACTCCTCAAACAGG + Intergenic
939913319 2:148009264-148009286 TAACCAGAACAACAATAAAAAGG + Intronic
941247217 2:163113878-163113900 TAATAAGAACAAACACAAACTGG + Intergenic
942069214 2:172300321-172300343 GTACCAGAACAGCCTCAAAAGGG - Intergenic
944027910 2:195194175-195194197 TAACCAAAACAACATGATACTGG + Intergenic
944471703 2:200060419-200060441 TAACCAAAAAAACATGAAACTGG + Intergenic
945466471 2:210175396-210175418 TATTCACAACAGCCTCAAACTGG + Intergenic
945804905 2:214478673-214478695 GATCCAAAACAACCTCAAACTGG + Intronic
946024194 2:216661977-216661999 TGGCCTGTACAACCTCAAACAGG + Exonic
1173454998 20:43194897-43194919 TAACCACAAGGACCTCAAACTGG - Intergenic
1174989914 20:55498471-55498493 TAACCAGAACAGCATGATACTGG - Intergenic
1175169000 20:57066791-57066813 TAATCAGAACCACCCTAAACAGG - Intergenic
1175701852 20:61144636-61144658 TAACCAAAACAACATCATATTGG - Intergenic
1177202433 21:17972908-17972930 TAACCAAAACAACATGATACTGG + Intronic
1177341244 21:19803310-19803332 TAACAAGAACAACATCTAATAGG - Intergenic
1177423103 21:20887420-20887442 TAACCAAAACAACTTGGAACTGG - Intergenic
1177645430 21:23894671-23894693 CAACAACAACAACCACAAACAGG - Intergenic
1177867989 21:26535938-26535960 TATACAGAACAACCTAAGACTGG + Intronic
1178471802 21:32900311-32900333 TAACCAGAACAGCATGATACTGG + Intergenic
1178616182 21:34135171-34135193 TACCTATAACAACCCCAAACTGG - Intronic
1180724424 22:17935195-17935217 TAACCAAAACAACATGATACTGG + Intronic
1183491250 22:38116955-38116977 TAACCAAAACTAACTCAAAAAGG + Intronic
1183860746 22:40668163-40668185 GAAACAGAACAAACTCAAACAGG - Intergenic
949292625 3:2484011-2484033 TGAAAAGAACAACCACAAACTGG + Intronic
949593387 3:5517123-5517145 TAACCAAAACAACATGATACTGG - Intergenic
949941329 3:9157094-9157116 TAAAAAGAACAACCTGAGACTGG + Intronic
950245947 3:11418738-11418760 TATCAAGAACTACCTGAAACTGG + Intronic
950325094 3:12100175-12100197 TAGCCAGAACAATCTGAAAAAGG + Intronic
950937424 3:16853998-16854020 TATCCAGAATAGCCTCACACTGG - Intronic
952506578 3:34012016-34012038 AAAACAGAAGAACCTCCAACTGG - Intergenic
952683907 3:36128532-36128554 TAACCAAAACATCCTAATACTGG + Intergenic
953716081 3:45318173-45318195 TAAACAGAAACACCTGAAACTGG - Intergenic
954500366 3:51007996-51008018 TAACCAAAACAACATGATACTGG - Intronic
954829660 3:53409336-53409358 TTACCACAACAACCTCAGGCTGG - Intergenic
955462625 3:59201224-59201246 TAACCAAAACAGCATCATACTGG - Intergenic
956552459 3:70476970-70476992 TAAACAGAAGCACCTGAAACTGG + Intergenic
957013658 3:75037708-75037730 TAACCAAAACAACATGATACCGG - Intergenic
957222546 3:77402503-77402525 TAAACAGAAACACCTGAAACCGG + Intronic
957475565 3:80718420-80718442 ATACCAGAAAAACCTCAAAGAGG + Intergenic
957610859 3:82463402-82463424 TAAACAGACAAACCTGAAACTGG - Intergenic
957958212 3:87216960-87216982 TAACCAGGATAACTTCAGACTGG + Intergenic
958186853 3:90132418-90132440 TAACCAACACAACCTCAATGTGG + Intergenic
959294769 3:104521603-104521625 TAAACAGAAACACCTGAAACTGG - Intergenic
961092916 3:124130696-124130718 TATTCATAACAGCCTCAAACTGG + Intronic
962815739 3:138996632-138996654 TATCCATAATAACCTAAAACTGG - Intergenic
963019788 3:140861923-140861945 TAACCAAAACAACCTGGTACTGG + Intergenic
963327194 3:143875807-143875829 TACCCAAATAAACCTCAAACTGG + Intergenic
964840746 3:160990943-160990965 TACCCAGAACATCCTCATTCAGG + Intronic
970483838 4:16504733-16504755 TATCCTGAACATCCCCAAACAGG - Intronic
972618964 4:40728230-40728252 TAAACAGAACAACTTAAAACTGG - Intergenic
972955638 4:44387487-44387509 TAACCAGAACAACATAGCACTGG + Intronic
972984940 4:44751800-44751822 TAACCAAAACAACATGATACAGG - Intergenic
972987097 4:44777957-44777979 TAGACAGAAAAACCTGAAACTGG + Intergenic
973224026 4:47762520-47762542 TATCCAGCACAATATCAAACAGG - Intronic
974727944 4:65820550-65820572 TAACCAAAACAACTTGACACTGG + Intergenic
974889749 4:67867098-67867120 TAACCAAAACAGCATCATACTGG + Intronic
975285912 4:72619829-72619851 TAACCAAAACAACATGATACTGG + Intergenic
975747674 4:77490795-77490817 TACCCAGGACAGCCTGAAACAGG - Intergenic
976239725 4:82942490-82942512 GAACAGGAACAACTTCAAACTGG - Intronic
976395920 4:84555494-84555516 TAACCAAAACAACATAATACTGG + Intergenic
976466894 4:85380511-85380533 TAACCAAAACAGCATCATACTGG + Intergenic
976963376 4:91005945-91005967 TAACCAAAACAACATGATACTGG - Intronic
977139514 4:93350602-93350624 TAACTAGAAGATACTCAAACAGG - Intronic
979093973 4:116520598-116520620 TAAATAGAAAAACCTGAAACTGG - Intergenic
979183972 4:117764709-117764731 TAACCAGAACAACATGGTACTGG - Intergenic
979216748 4:118174008-118174030 TCACTAGAACAACTTAAAACTGG + Intronic
979427438 4:120585073-120585095 TAACCAAAACAACATGATACTGG + Intergenic
980428114 4:132653687-132653709 TAACCAAAACAACATGATACTGG - Intergenic
980644498 4:135625322-135625344 TAACCAAAACAACATGATACTGG - Intergenic
981191928 4:141873966-141873988 TAAACAGAAACACCTGAAACTGG - Intergenic
981261822 4:142729625-142729647 GAACCAGGAAAAGCTCAAACGGG - Intronic
983781352 4:171674248-171674270 TAACCAGAAACACCTGAAACTGG - Intergenic
985870598 5:2551929-2551951 TATCCATAACAGCCCCAAACTGG - Intergenic
987719708 5:21617828-21617850 TCACCAGAACAGCATCAAAGGGG + Intergenic
988118774 5:26932467-26932489 TAATCAGAACACCATCAAAATGG - Intronic
990271133 5:54140627-54140649 TAAATAGAACAATCTCAACCAGG + Intronic
991622592 5:68560268-68560290 CAATAAAAACAACCTCAAACTGG - Intergenic
993498841 5:88640399-88640421 TAACCAGATCAGCCTCAGAGAGG + Intergenic
994080110 5:95699106-95699128 TACCCAGCAGAACCTCAACCTGG - Intergenic
994399978 5:99266394-99266416 TAACCAGAACAGCATGATACTGG - Intergenic
994633600 5:102316808-102316830 TAACCAAAACAGCATCATACTGG - Intergenic
994642678 5:102429678-102429700 TAACCAAAACAGCATCATACTGG - Intronic
994851897 5:105066288-105066310 TAACCAAAACAACATGATACTGG + Intergenic
995475462 5:112543722-112543744 TAACCAAAACAACATGATACTGG + Intergenic
995476457 5:112553163-112553185 CATCCAGAACAACCTCAAAAAGG - Intergenic
997019748 5:129985398-129985420 TAACCAAAACAACATGATACTGG - Intronic
997742164 5:136265550-136265572 TAATCAGAACAAAATAAAACTGG - Intronic
1000406912 5:160897807-160897829 TAACCAGAACAGCATGGAACTGG + Intergenic
1000581945 5:163046144-163046166 TAACCAAAACAACATGGAACTGG + Intergenic
1001120344 5:168975013-168975035 TAACCACAGCATCCTCAGACTGG + Intronic
1001505299 5:172274603-172274625 GAACCACACCAACCTCAAAAGGG + Intronic
1002631695 5:180585696-180585718 AAACGAGAACAACTTCAATCTGG + Intergenic
1003456307 6:6285798-6285820 TAAACAGAAATACCTGAAACTGG + Intronic
1004009778 6:11672570-11672592 GAACCAGAAAAAAATCAAACAGG + Intergenic
1004267140 6:14158632-14158654 TCACCAGAACAGCATCAAAAAGG - Intergenic
1006374808 6:33665955-33665977 GGAGCAGAACATCCTCAAACAGG + Exonic
1006974548 6:38086957-38086979 TAACCAGAACAACCTCAAACTGG + Intronic
1007335915 6:41154749-41154771 TATGCAGTACAACCTCAAACAGG + Intergenic
1008352388 6:50507140-50507162 TAACCAGAGCAATCTGAAAGGGG + Intergenic
1009377113 6:62986483-62986505 TAACCAGAACAGCATGATACTGG + Intergenic
1009652498 6:66493804-66493826 TAACCAGAACAGCATGATACTGG + Intergenic
1009700430 6:67170873-67170895 TAACCAAAACAACATGATACTGG + Intergenic
1009724143 6:67514664-67514686 TAACCAAAACAGCATCATACAGG - Intergenic
1010361338 6:74998091-74998113 TTACCAGAAATACCTAAAACTGG + Intergenic
1010556059 6:77281231-77281253 TAACCAAAACAGCATGAAACTGG + Intergenic
1012117004 6:95313454-95313476 TAACCAGAACAGCATCGTACTGG + Intergenic
1012892732 6:104915246-104915268 TAACCAAAACAGCCTGATACTGG + Intergenic
1013837954 6:114354965-114354987 TAACCAGAAAAACCACATGCCGG - Intergenic
1014374888 6:120660155-120660177 TATACAGAACTACCTGAAACTGG + Intergenic
1014806922 6:125839979-125840001 TAAACAGAACAGCCTCAGGCAGG + Intronic
1016899572 6:149088326-149088348 TAACCAGAACAGACTCAAGGAGG - Intergenic
1017588921 6:155957555-155957577 AAAACAAAACAACCTCAAAAAGG - Intergenic
1018325429 6:162662797-162662819 TAACCAAAACAGCATCATACTGG - Intronic
1020838546 7:13185089-13185111 TATCCAGAACTACCTGAGACTGG - Intergenic
1021367815 7:19802973-19802995 AAACCACCAAAACCTCAAACAGG - Intergenic
1021644302 7:22773152-22773174 TAATCAGAACAACCTCATATAGG - Intergenic
1022523775 7:31024321-31024343 TAACAAGAACTACCTGAGACTGG + Intergenic
1023720290 7:43086212-43086234 TAACCAAAACAACATGATACTGG + Intergenic
1024224817 7:47318405-47318427 TAACCAGTCCCAACTCAAACTGG - Intronic
1030076084 7:105738045-105738067 TAACCACAACCACCTAAAAGGGG + Intronic
1030512166 7:110496137-110496159 TAACCAAAACAGCATCATACTGG - Intergenic
1031408727 7:121417077-121417099 TCACCAAAACAAACTCAAAATGG - Intergenic
1031431058 7:121670122-121670144 TAACCAAAACAACCTGAAGGGGG - Intergenic
1033000304 7:137496568-137496590 TAACCAAAACAACATGATACTGG + Intronic
1036107513 8:5856654-5856676 TACACAGAAGAACCTCAAAAAGG - Intergenic
1037220104 8:16508370-16508392 TAACAAGAACAACAGAAAACGGG - Intronic
1037386648 8:18350705-18350727 TAACCAGAACAACATGTTACTGG + Intergenic
1037437445 8:18877938-18877960 TGACCAAAACAACCTGAAAAAGG - Intronic
1039348111 8:36730522-36730544 TAACCAGAACAGCATGATACTGG + Intergenic
1040772427 8:50993606-50993628 CAACTAGAATAACCTCAAAGAGG - Intergenic
1041615723 8:59904268-59904290 TAACCAAAACAACATAATACTGG + Intergenic
1042697638 8:71573779-71573801 TAACCAAAAGAACTTCAAAAGGG - Intronic
1043303886 8:78769801-78769823 TAACCAAAACAACATGATACTGG + Intronic
1044287517 8:90426407-90426429 TTTCCAGAACAACCTCTATCAGG - Intergenic
1049295493 8:141832319-141832341 TATCCATAACAGCCCCAAACTGG - Intergenic
1050618106 9:7424114-7424136 TAACCAAAACAACATTATACTGG - Intergenic
1050985206 9:12073404-12073426 GAACTCTAACAACCTCAAACAGG + Intergenic
1052506070 9:29356152-29356174 TAACCAAAACATCATCATACTGG - Intergenic
1052536251 9:29751050-29751072 TATCCATAACAACCTTATACTGG - Intergenic
1053490179 9:38493820-38493842 TAACCAAAACAGCATCATACTGG + Intergenic
1058521813 9:105819621-105819643 TATTAAGAACAACCTCACACGGG + Intergenic
1059036995 9:110765356-110765378 TAACCAGAAATATCTCAAACTGG - Intronic
1187430381 X:19218762-19218784 TAACCCAAAAATCCTCAAACTGG - Intergenic
1188883685 X:35522690-35522712 TAAACAGAAATACATCAAACAGG - Intergenic
1189377575 X:40477593-40477615 CAACAAGAACAACAACAAACTGG - Intergenic
1189514859 X:41702895-41702917 AATCCAGAACAAACTCATACAGG + Intronic
1189580457 X:42400806-42400828 TAAACAGAAACACCTGAAACTGG + Intergenic
1189878175 X:45458808-45458830 TAACCAAAACAGCCTCATATTGG - Intergenic
1189944291 X:46162238-46162260 TCACCAGAACTAGCTCATACTGG + Intergenic
1191686431 X:63896922-63896944 TAACCAAAACAGCCTGATACTGG + Intergenic
1192971950 X:76241360-76241382 TAACCAAAACAACATGGAACTGG + Intergenic
1193309930 X:79994531-79994553 TAACCAAAACAGCATCATACTGG + Intergenic
1193701302 X:84764918-84764940 TAACCAAAACAACATGATACTGG - Intergenic
1193755000 X:85397875-85397897 TAACCAAAACAACATGATACTGG - Intergenic
1193773480 X:85615994-85616016 TAACCAAAACAACATGATACTGG - Intergenic
1194107082 X:89783593-89783615 TAACCAAAACAGCCTGAAACTGG + Intergenic
1195521643 X:105837407-105837429 TAACCAAAACAAACTCCAGCAGG - Intronic
1195690542 X:107620847-107620869 TCACCAGAACAATTTCCAACTGG + Intergenic
1195807262 X:108788522-108788544 TAACCAAAACAGCATCTAACTGG - Intergenic
1196366979 X:114934296-114934318 TAACCAGAAGAAAGTCAAAAGGG + Intergenic
1196583472 X:117402415-117402437 AAACCAGTACAAACTCAAAATGG - Intergenic
1197382252 X:125759147-125759169 TAACCAAAACAGCATAAAACTGG - Intergenic
1197443809 X:126523969-126523991 TAACCAAAACAGCCTGATACTGG + Intergenic
1197478413 X:126951491-126951513 TAACCAAAACAGCCTGATACTGG + Intergenic
1197519666 X:127481821-127481843 TAACCAAAACAGCCTGATACTGG - Intergenic
1197993627 X:132347382-132347404 TAACCAGAACAACATGGTACTGG + Intergenic
1198938759 X:141930080-141930102 TAAAGAAAACAGCCTCAAACAGG - Intergenic
1199136505 X:144259918-144259940 TAACTAAAACAACATGAAACTGG - Intergenic
1199271635 X:145890016-145890038 TAACCAAAACAACATCATACCGG - Intergenic
1199423804 X:147677632-147677654 TAACCAGAACAACATGGTACTGG + Intergenic
1200353617 X:155525449-155525471 TATAAAGAACAACCTGAAACTGG - Intronic
1200420297 Y:2957884-2957906 TGACCTGAATAACCTCAAATTGG - Intronic
1200459040 Y:3431455-3431477 TAACCAAAACAGCCTGAAACTGG + Intergenic
1202035822 Y:20633868-20633890 AAACCAGAACAAACTCAGCCAGG - Intergenic