ID: 1006975233

View in Genome Browser
Species Human (GRCh38)
Location 6:38094303-38094325
Sequence TGGATTAAATGCAGTACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006975233_1006975237 1 Left 1006975233 6:38094303-38094325 CCATGGGTACTGCATTTAATCCA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1006975237 6:38094327-38094349 AAGAAAAAAAAAAAGCAAAGGGG 0: 2
1: 35
2: 603
3: 9101
4: 51400
1006975233_1006975235 -1 Left 1006975233 6:38094303-38094325 CCATGGGTACTGCATTTAATCCA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1006975235 6:38094325-38094347 AGAAGAAAAAAAAAAAGCAAAGG 0: 2
1: 15
2: 470
3: 5753
4: 47389
1006975233_1006975236 0 Left 1006975233 6:38094303-38094325 CCATGGGTACTGCATTTAATCCA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1006975236 6:38094326-38094348 GAAGAAAAAAAAAAAGCAAAGGG No data
1006975233_1006975238 10 Left 1006975233 6:38094303-38094325 CCATGGGTACTGCATTTAATCCA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1006975238 6:38094336-38094358 AAAAAGCAAAGGGGAACAAGTGG 0: 1
1: 1
2: 7
3: 75
4: 813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006975233 Original CRISPR TGGATTAAATGCAGTACCCA TGG (reversed) Intronic
903494822 1:23758690-23758712 TGTATTAATTGCAGGGCCCATGG + Intronic
905918043 1:41699494-41699516 AGGATTCAATGCTGTTCCCAAGG - Intronic
906840373 1:49132003-49132025 TGGAGTAGATGCATTTCCCAGGG + Intronic
907688168 1:56634712-56634734 TGGATTTAATTAAATACCCAAGG + Intronic
908669010 1:66524981-66525003 TGGTTTATATTCAGTACCCTTGG + Intergenic
916851330 1:168707196-168707218 AGGATTAAATGCAGTAACACAGG + Intronic
918716979 1:187802193-187802215 TGAGGTAAATGAAGTACCCAGGG + Intergenic
921859279 1:220024518-220024540 TTGCTTAAATGCAGTATCAAGGG - Intronic
1064611168 10:17104068-17104090 TTGATTCAATGCAGTACTCTAGG + Intronic
1064617090 10:17170319-17170341 TGGATTAAATAAAGTAGTCATGG + Intronic
1067834489 10:49629741-49629763 TGGATTAATCGGATTACCCAAGG - Intronic
1073857439 10:107693789-107693811 AAGATTAAATGCAGTAATCAGGG - Intergenic
1074454092 10:113582309-113582331 TATAATAAATGCAGTGCCCATGG - Intronic
1078942246 11:16020440-16020462 TGGAGGAAATGCAGTAGACATGG - Intronic
1080584483 11:33668717-33668739 TGGATGAAAGTCAGTACCAATGG + Exonic
1085778448 11:79387453-79387475 TAGATTAAATGCCTTGCCCAAGG - Intronic
1093996015 12:25643695-25643717 TTGATTTTATGCAGTTCCCAGGG - Intronic
1094100779 12:26760126-26760148 TAGATTCAATGTAGTACTCAGGG + Intronic
1095804723 12:46306226-46306248 TGTGTTAAATGCAATCCCCATGG + Intergenic
1096880688 12:54666590-54666612 TGTTTTAAATGCAGTACCTTTGG - Intergenic
1097346254 12:58496561-58496583 AGGATTAAATGAAGTGACCATGG - Intergenic
1098987880 12:77031798-77031820 AGAATAAAATGCAGTACCCTGGG + Intronic
1102886527 12:116526163-116526185 TGGATTTAATGCATAACCCATGG + Intergenic
1104901468 12:132191664-132191686 TGAATTAAATGCAGTTCAGAAGG + Intergenic
1107275375 13:38672137-38672159 TGAATTATAGGCAGTGCCCAGGG - Intergenic
1108845118 13:54668957-54668979 AAGATTAAGCGCAGTACCCAAGG + Intergenic
1109725829 13:66340663-66340685 AGGATTAAATGAATTAACCATGG - Intronic
1112737234 13:102434584-102434606 AGGATTAAATTAAGTCCCCAAGG + Intergenic
1121955493 14:98209156-98209178 GGCATCAAACGCAGTACCCAGGG - Intergenic
1124361220 15:29037879-29037901 TGGATTAATGCCATTACCCAGGG - Intronic
1127476864 15:59342541-59342563 TGGATAAAAAGCAAGACCCAAGG - Intronic
1128092465 15:64928234-64928256 TGGACTCAGTGCAGAACCCAAGG - Intronic
1130964831 15:88689473-88689495 TGGATTAAATGATTTACTCAAGG - Intergenic
1132203606 15:99971588-99971610 TGCATTACATACTGTACCCATGG - Exonic
1133270885 16:4610321-4610343 AAGATTAAGTGCAGGACCCACGG + Intronic
1138211426 16:55166435-55166457 TAGAATAAATGCACAACCCAGGG + Intergenic
1138550051 16:57742807-57742829 TGGATTGAATGCAGTGATCACGG - Intronic
1139317259 16:66083942-66083964 AGGATTAAATGCAATACTGAAGG + Intergenic
1140090752 16:71836663-71836685 TGGATTAAATGGCTTGCCCATGG + Intergenic
1142207721 16:88791919-88791941 TGGAGTAAATGCAGTGCTCGGGG + Intergenic
1147200223 17:38796485-38796507 TGGATGAAATACAGTTCCGAGGG - Intronic
1152119004 17:78406690-78406712 GGGAATAACAGCAGTACCCAGGG + Intronic
1203192380 17_KI270729v1_random:200780-200802 TGGATTAAATGGACTACCGAGGG - Intergenic
1203201745 17_KI270730v1_random:217-239 TGGATTAAATGGACTACCGAGGG - Intergenic
1153669316 18:7395099-7395121 TGGACTAAATGCAGTTCCAGGGG - Intergenic
1156075225 18:33268139-33268161 TGCATTAAATGAAGTTCACATGG + Intronic
1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG + Intronic
1164137943 19:22430836-22430858 TAGAGTAGATGCACTACCCAGGG + Intronic
925295490 2:2773727-2773749 TGGAGTTAATGCTGAACCCACGG - Intergenic
925798374 2:7571084-7571106 AGGATTTCATGCAGTACGCAGGG - Intergenic
925863933 2:8207689-8207711 TGGATTAAATAAATGACCCATGG + Intergenic
926342174 2:11912604-11912626 TGGATTTAATGCTGTACCTCAGG - Intergenic
927393701 2:22625146-22625168 TTGATTAAATACTGTGCCCACGG + Intergenic
928504176 2:31932205-31932227 TGAAATAAATACAGTACCTATGG + Intronic
931552816 2:63465970-63465992 TGAATTCACTGTAGTACCCAGGG + Intronic
936694527 2:114930202-114930224 TGGTTTTACTGCAGTACCCTTGG + Intronic
936888264 2:117338676-117338698 TGGATAAAATGAAGTTCCTATGG + Intergenic
937362687 2:121239864-121239886 TGGAGCAAGTGAAGTACCCAAGG + Intronic
937468274 2:122153924-122153946 TGGATTGAATGCAGTAGCTGAGG + Intergenic
940033393 2:149288399-149288421 CACATTAAATGCAGTACCCTGGG - Intergenic
940181981 2:150944212-150944234 TGAAGTACATGCAGAACCCAGGG + Intergenic
943091687 2:183383095-183383117 TCGATTTCATGCAATACCCAAGG + Intergenic
943241690 2:185392769-185392791 TGGACTAGCTGCAGTAGCCATGG + Intergenic
943568628 2:189545676-189545698 AGGAATAAATGCAGTCCCAAGGG - Intergenic
948359344 2:237408207-237408229 TGGATTTATTGCAGTAACCTGGG + Intronic
1170330280 20:15201955-15201977 TGTATAAAATACAGGACCCACGG + Intronic
1173613113 20:44385349-44385371 GGGATTAAAGGCAGGAGCCATGG - Intronic
1178089522 21:29146923-29146945 AGAATAAAATGCAGTACACAAGG - Intronic
1184123797 22:42472500-42472522 TGGATTATAAGCAGTGCACAGGG + Intergenic
952849244 3:37714070-37714092 TGGAACAAATGCAGGAGCCATGG + Intronic
954156490 3:48687652-48687674 GGGATTAAAAGCTGGACCCAAGG + Intergenic
955229591 3:57086865-57086887 TGGAGTATATAAAGTACCCAAGG - Intergenic
955390800 3:58520987-58521009 TGGATTAAATGAAGTAACCCTGG + Intronic
956043052 3:65166848-65166870 TGAATTAAAAGCAGTACACATGG - Intergenic
959943432 3:112103478-112103500 TGAATTAAATGTAGGACCTAAGG - Intronic
960727542 3:120685499-120685521 TGGATTAAAAACAGAACCCAGGG + Intergenic
966162566 3:176983736-176983758 TGAATTGAATGCAGGCCCCAGGG + Intergenic
973164927 4:47065112-47065134 TGGTTTGAATGCCGTTCCCATGG + Intronic
974573118 4:63681505-63681527 TAGTTTAAAGACAGTACCCAGGG - Intergenic
975300424 4:72783804-72783826 TTTATTATATGCAGAACCCAAGG + Intergenic
975984560 4:80190325-80190347 GGGAGGAAATGCAGTTCCCAAGG - Intronic
976547858 4:86358586-86358608 TGGCTAAATTGCAGTACCCTGGG + Intronic
976933196 4:90594226-90594248 TGGTTTAAATGAAGTAATCATGG + Intronic
977258266 4:94764451-94764473 TGGATTTACTGCAATACCCTTGG + Intronic
980784220 4:137531597-137531619 TGGATCAAATGCACTGTCCAGGG + Exonic
981833078 4:149024116-149024138 GGAATAAAAAGCAGTACCCAAGG - Intergenic
985034436 4:185824049-185824071 GGGAGCAAATGCAGTAACCATGG - Intronic
995037911 5:107556230-107556252 TGGATTAAATGTAGTTCTCCTGG - Intronic
998172467 5:139880765-139880787 TGGATCACATGCAGGCCCCAAGG + Intronic
1000322710 5:160147652-160147674 GGGATTAAATGCATGAGCCACGG + Intergenic
1002555410 5:180034229-180034251 TGGATTAGATTCATTACCCCAGG - Intronic
1003342102 6:5231430-5231452 TGGATTCAATCCAGTATTCAGGG - Intronic
1004856424 6:19755779-19755801 TGAACTAAATGTGGTACCCAAGG - Intergenic
1006975233 6:38094303-38094325 TGGATTAAATGCAGTACCCATGG - Intronic
1007697537 6:43743330-43743352 TGGTTCAAATGCAGACCCCAGGG + Intergenic
1010924253 6:81724413-81724435 TGGATTAAATGGAGGACTGAAGG - Intronic
1011852766 6:91651185-91651207 TGGAGTAAATTCATTACACAAGG + Intergenic
1012416800 6:99021338-99021360 TGGATACAATGCAGTTGCCAAGG + Intergenic
1015333842 6:132011831-132011853 TGGATAAAATGCAGTCCCTAGGG + Intergenic
1021682113 7:23144098-23144120 TGGATTAGACTCAGTAGCCAGGG + Intronic
1021782567 7:24120235-24120257 TGGATTAATTGCAATATCCTGGG + Intergenic
1023375130 7:39548272-39548294 TGGACTAAATGTAGGCCCCAGGG - Intergenic
1031765336 7:125770705-125770727 TTGATTAAATGCAGATGCCAGGG - Intergenic
1033160488 7:138991912-138991934 TGGTTTAAATGTTTTACCCATGG - Intergenic
1036573191 8:9999730-9999752 GGGACTAAGTGCAGTACACATGG + Intergenic
1038007251 8:23442793-23442815 TGGATTAGATGGACTACCCAAGG - Intronic
1041627774 8:60050274-60050296 GGGAGTAAATGCAGGTCCCATGG - Intergenic
1043882016 8:85554733-85554755 GAGATTAAATGTAGTACCAAGGG - Intergenic
1045947000 8:107807692-107807714 GGGGTCAAATGAAGTACCCAAGG - Intergenic
1047292535 8:123541963-123541985 CGGGTTAAATGATGTACCCAGGG + Intergenic
1047576552 8:126161972-126161994 TGAATTAAGTGCAATACACATGG - Intergenic
1048838244 8:138541728-138541750 TGAATTATATGAAATACCCAAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1190337756 X:49272655-49272677 TGGATTGAATGCAGCAAACATGG + Intronic
1191229442 X:58082479-58082501 TGGAATGAATGCAGTTGCCAAGG - Intergenic
1193334087 X:80266853-80266875 TGGATTAGATGCAGTAACACAGG + Intergenic
1196003010 X:110806679-110806701 TGGATTGTGTGAAGTACCCAAGG - Intergenic
1196011002 X:110887970-110887992 TGAAATAAATGCAGAACACAGGG + Intergenic
1197233537 X:124032397-124032419 TGGAATAAATACAATACTCAAGG + Intronic
1200009366 X:153109530-153109552 TTGATTAAAGGCAGGCCCCAAGG + Intergenic
1200030234 X:153290392-153290414 TTGATTAAAGGCAGGCCCCAAGG - Intergenic
1200217898 X:154376582-154376604 TGAATTAATTGCTGTACTCAGGG + Intergenic
1200686100 Y:6261415-6261437 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1200991636 Y:9352663-9352685 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1200994291 Y:9372939-9372961 TGGATTCACTGTAGTAGCCAGGG - Intronic
1200996955 Y:9393279-9393301 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1200999470 Y:9461831-9461853 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1201002125 Y:9482137-9482159 TGGATTCACTGTAGTAGCCAGGG - Intronic
1201004790 Y:9502423-9502445 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1201007443 Y:9522749-9522771 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1201010047 Y:9542601-9542623 TGGATTCACTGTAGTAGCCAGGG - Intergenic
1201735543 Y:17256730-17256752 TGGATTAAACCCATGACCCAGGG + Intergenic
1202019551 Y:20450417-20450439 TGGAATAGAAGCAGTACCAATGG + Intergenic