ID: 1006979529

View in Genome Browser
Species Human (GRCh38)
Location 6:38135865-38135887
Sequence CCTTCTGGACTGCAGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006979529_1006979538 21 Left 1006979529 6:38135865-38135887 CCTTGAGCCTGCAGTCCAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 248
Right 1006979538 6:38135909-38135931 TATTAAGGCAGTCATAGCTGTGG 0: 1
1: 1
2: 0
3: 7
4: 116
1006979529_1006979537 6 Left 1006979529 6:38135865-38135887 CCTTGAGCCTGCAGTCCAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 248
Right 1006979537 6:38135894-38135916 TCTCTGTGGAGCAGGTATTAAGG 0: 1
1: 0
2: 1
3: 15
4: 225
1006979529_1006979533 -8 Left 1006979529 6:38135865-38135887 CCTTGAGCCTGCAGTCCAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 248
Right 1006979533 6:38135880-38135902 CCAGAAGGCTCCCTTCTCTGTGG No data
1006979529_1006979534 -2 Left 1006979529 6:38135865-38135887 CCTTGAGCCTGCAGTCCAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 248
Right 1006979534 6:38135886-38135908 GGCTCCCTTCTCTGTGGAGCAGG 0: 1
1: 1
2: 2
3: 39
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006979529 Original CRISPR CCTTCTGGACTGCAGGCTCA AGG (reversed) Intronic
900094114 1:933451-933473 CCTTCTGGGCGCCAGGCTCGGGG + Intronic
900762680 1:4483471-4483493 CCTGCTGGTCTCCAGGCCCAAGG - Intergenic
900806175 1:4769670-4769692 CCTCCTCGACTGCAGGCCCCGGG - Intronic
901645254 1:10713582-10713604 CATCCTGGACTGGAGGCTCCCGG + Intronic
902980071 1:20116153-20116175 CCTTCTGGAAGGCAAGCTCCAGG + Intronic
904469807 1:30729348-30729370 CCAGCTGCACTGCAGGCTCCTGG - Intergenic
907122986 1:52024025-52024047 CCTTCTGTCATTCAGGCTCAAGG + Intronic
907524272 1:55045052-55045074 CCTCCTGAACTGTAAGCTCAAGG - Intronic
908736903 1:67286013-67286035 CCTCCTGGACTATAAGCTCAAGG + Intergenic
910820419 1:91338977-91338999 GCTCCTGGGCTGCATGCTCATGG - Intronic
911211237 1:95140045-95140067 CCTTCTGGACTGCCTCCTGAAGG + Intronic
911335152 1:96573334-96573356 CTTTCTGGGCTGAGGGCTCAGGG + Intergenic
911392898 1:97268594-97268616 CCTTCTGGAGTGATGGATCAAGG + Intronic
912695086 1:111835417-111835439 CCTACTGGACTGCATTCCCAGGG + Intronic
913563786 1:120049818-120049840 ACTTCTGGAATGCAGGCTTACGG + Intronic
913634338 1:120743745-120743767 ACTTCTGGAATGCAGGCTTACGG - Intergenic
914284379 1:146209192-146209214 ACTTCTGGAATGCAGGCTTACGG + Intronic
914545411 1:148659933-148659955 ACTTCTGGAATGCAGGCTTACGG + Intronic
914621156 1:149410741-149410763 ACTTCTGGAATGCAGGCTTACGG - Intergenic
915691729 1:157697216-157697238 CCATGTGGACTGAAGACTCAGGG - Exonic
918041649 1:180917313-180917335 CCTATTGGTCTGCAGGGTCATGG - Intronic
918405748 1:184210247-184210269 CCTTCTGGGATCCAGGCTGAAGG - Intergenic
920029648 1:203028852-203028874 CCCTCTGGCCTGCTAGCTCACGG + Intronic
921046416 1:211481076-211481098 CTTGCTGGGCTGCAGGCTCCAGG - Intronic
922462520 1:225824271-225824293 CCTTCTGGCCTGAAGACTCAAGG + Intronic
1063035275 10:2280651-2280673 TCTTATGGACTGGAGGTTCATGG + Intergenic
1064362865 10:14681411-14681433 CCTTCTTCATTGCATGCTCAAGG + Intronic
1065847520 10:29758307-29758329 CCTTCTGGCCTGCAAGTTCCAGG - Intergenic
1067198627 10:44145979-44146001 CCCTCTGGACCCCAGGCTGAAGG - Intergenic
1068213691 10:53954661-53954683 CTTTCTGGACTTCAAGCTAAAGG - Intronic
1070085253 10:73230764-73230786 CATTCTGGACAGCACGCACATGG - Intronic
1070280061 10:75042102-75042124 CCTGGTGGACAGCAGGCTCTCGG - Intronic
1070954613 10:80455536-80455558 GCTTCTGGACTTCAAGGTCAAGG - Intronic
1070993717 10:80756121-80756143 CATTCTGGAACGCAGGCTAAAGG - Intergenic
1071524591 10:86351067-86351089 TCTGCTGTACTGCAGGCTCCTGG - Intronic
1074853451 10:117456735-117456757 CCTTCTGGTCAGAAGGCTCAAGG - Intergenic
1075584251 10:123645671-123645693 CCTTTTGGAATGGAGGCTAAAGG - Intergenic
1075763037 10:124871170-124871192 CCTACTGGGCTGTGGGCTCAGGG - Intergenic
1076159785 10:128234897-128234919 CCATCTGGCCTCCAGGCCCAGGG - Intergenic
1076988714 11:257827-257849 CATTCAGGGTTGCAGGCTCAGGG + Intergenic
1077486463 11:2840964-2840986 CCTTCTAGGCTCCAGGCTCCAGG + Intronic
1077591977 11:3499403-3499425 CCGACTGGACTGCATGCTCCTGG + Intergenic
1077941525 11:6848531-6848553 CCTTCTGGAGTGGTGGCCCAAGG - Intergenic
1083896930 11:65624681-65624703 GCGTCTGTACTGCAGACTCAAGG + Intronic
1084247818 11:67872139-67872161 CCAACTGGACTGCATGCTCCTGG + Intergenic
1085280332 11:75325847-75325869 CCTTCTGGACCTCACGCCCAGGG + Intronic
1091331110 11:134731512-134731534 CCTGCTGGACTGTCGGCTCTGGG + Intergenic
1091544924 12:1495253-1495275 CCACCTGGATTGCAGGCTCCAGG - Exonic
1092418099 12:8307534-8307556 CCGACTGGACTGCATGCTCCTGG + Intergenic
1095962759 12:47845724-47845746 TTTCCTGGACTGGAGGCTCAAGG - Intronic
1096609006 12:52788896-52788918 CCTTCTGGACAGCACTCCCATGG + Intergenic
1097062976 12:56299927-56299949 CGTTCTGGACTGCGGGCCGAGGG + Intronic
1097407710 12:59211512-59211534 CCCTCTGCCTTGCAGGCTCAAGG + Intergenic
1098092275 12:66916282-66916304 CCTGCTGTACTCCAGCCTCAGGG - Intergenic
1098568897 12:71967227-71967249 CCTTCTTCTCTGCAGGCACAAGG + Intronic
1099864209 12:88258704-88258726 TCTTCCTGACTGCAGACTCAAGG + Intergenic
1102738362 12:115183231-115183253 CCCTCTGGATTGGAGGCTCCTGG + Intergenic
1103067473 12:117911907-117911929 CCTTCTGGATTTGAGGCCCAGGG - Intronic
1104654646 12:130564809-130564831 CCTTATTAACTGTAGGCTCAGGG - Intronic
1104755499 12:131266772-131266794 CCTCGTGGACAGCAGGCCCAAGG + Intergenic
1106453704 13:29908579-29908601 ACATCTGGACTGCAGGCACGGGG + Intergenic
1107800971 13:44107692-44107714 CATGCTGCACAGCAGGCTCAGGG + Intergenic
1107958815 13:45541777-45541799 CTTTCTCGAGTGAAGGCTCAGGG - Intronic
1109438480 13:62338014-62338036 CCTTATGTATTTCAGGCTCAGGG - Intergenic
1112463112 13:99620386-99620408 CCTGCTGGACTGCTGGCTGATGG - Intronic
1112920288 13:104604164-104604186 CCTTCTGGTCTGCTGGCTTGTGG - Intergenic
1113946727 13:114048643-114048665 CCTTCGGGATTCCAGGCGCAGGG - Intronic
1114501942 14:23176359-23176381 CTTTCTGGACTCCAGTCTCAGGG + Intronic
1116678762 14:47939367-47939389 CCATCTTGACTGCAAGCTTATGG - Intergenic
1119185867 14:72642148-72642170 ACATCTGGACTGCAGCCTCATGG + Intronic
1119187205 14:72651316-72651338 CCTTCCGGAAGGCAGGGTCAGGG - Intronic
1120824729 14:88945040-88945062 CCCACTGGACTGTAGGCTAATGG - Intergenic
1121525397 14:94615863-94615885 CCATCTGGACTGTGGGCTCCAGG - Intronic
1121701313 14:95956486-95956508 CCTACTGAACTCCTGGCTCATGG - Intergenic
1122080490 14:99263534-99263556 CCTTCTGGTCTACAGACTCCAGG + Intronic
1122266353 14:100548701-100548723 CCCTCTGGACCGCAGGCTCCCGG - Intronic
1122422409 14:101585935-101585957 CCAACTGGACTGCAAGTTCAAGG - Intergenic
1129356406 15:74995127-74995149 CCTTCAGATCTGCAGGCGCAGGG - Intronic
1129618175 15:77117140-77117162 TCTTCTGGAATGAAAGCTCAAGG + Intronic
1131753421 15:95534692-95534714 CCTTTTGGACTGAAGCCCCATGG - Intergenic
1132343138 15:101090574-101090596 ACTTCTTGACTACAGGCTCAGGG - Intergenic
1132625703 16:890490-890512 CCATCAGGACATCAGGCTCATGG + Intronic
1132709812 16:1261426-1261448 CCCTCTGGTCTGCAGGCTGCGGG - Intergenic
1132900271 16:2250390-2250412 GCTTCAGGACTCCAGGCTCCTGG - Intronic
1132949808 16:2554885-2554907 CCTGCTGGAATGCAGGCTTCTGG + Intronic
1132964540 16:2645282-2645304 CCTGCTGGAATGCAGGCTTCTGG - Intergenic
1133353704 16:5120372-5120394 TCATCTTGACTGCAGCCTCAGGG - Intergenic
1133357456 16:5147135-5147157 CCGACTGGACTGCATGCTCCTGG + Intergenic
1135031878 16:19045038-19045060 CCTTCTGGAATACAGTGTCATGG + Intronic
1135618395 16:23931718-23931740 CCTTCTGGCCTGCTGGGTCTTGG + Intronic
1136686362 16:31997018-31997040 CCTCCTTCACTGCATGCTCAGGG + Intergenic
1136786974 16:32940547-32940569 CCTCCTTCACTGCATGCTCAGGG + Intergenic
1136882798 16:33913242-33913264 CCTCCTTCACTGCATGCTCAGGG - Intergenic
1137892186 16:52174398-52174420 CCCTCAGCACTGCAGGCTCAGGG + Intergenic
1138083773 16:54115639-54115661 TCTTCTCGGCTTCAGGCTCAGGG - Exonic
1139301008 16:65945401-65945423 CCTTGTGGACCCCAGGCTCCTGG - Intergenic
1139348619 16:66321316-66321338 CCTGCAGGACAGCAGCCTCATGG - Intergenic
1139431600 16:66913732-66913754 CCACCTGGACTCCAGGCCCAGGG - Intronic
1141766044 16:86060659-86060681 GCCTCTGGGCTGCAGGCTAAGGG + Intergenic
1203089211 16_KI270728v1_random:1202217-1202239 CCTCCTTCACTGCATGCTCAGGG + Intergenic
1143262061 17:5606852-5606874 AGTTCTGGACTGCAAGCTCCTGG + Intronic
1143347283 17:6259204-6259226 CCATCTGGACTGCAGGCCTCAGG + Intergenic
1143455332 17:7064079-7064101 CTTTCTGTTCTGCAGGCTCCTGG - Intergenic
1146100640 17:29978501-29978523 ACTTATGGACTGCAAGATCATGG + Intronic
1147147322 17:38492687-38492709 CCTCCTTCACTGCATGCTCAGGG + Intronic
1150275285 17:63894159-63894181 CCATCAGGACTGCAGGGACACGG - Intergenic
1150277416 17:63908847-63908869 CCATCAGGACTGCAGGGACACGG - Intergenic
1151695743 17:75716178-75716200 CCTTCTGGAATGCTTCCTCATGG - Intergenic
1152132647 17:78486322-78486344 CCTGCTGGAGTGCCTGCTCACGG - Exonic
1152738221 17:82007784-82007806 CCCTCTGGAATGCAGGCGCTGGG + Intronic
1154335785 18:13463347-13463369 TCTTCTGAACCCCAGGCTCAGGG - Intronic
1154385609 18:13889264-13889286 CCTTGTTTACTGCAAGCTCAAGG - Intronic
1157307140 18:46525499-46525521 ACATCTGGGATGCAGGCTCAAGG + Intronic
1157884312 18:51351578-51351600 CCTTCTGGTCTCCAGGCTTTGGG - Intergenic
1159356945 18:67348477-67348499 TCTTCTTGAGTGCAGGCTCATGG + Intergenic
1160249904 18:77193388-77193410 CCTTCTGGAGGGCACTCTCATGG - Intergenic
1160486320 18:79296304-79296326 CCTTCTGGGCTGCAGTAACATGG - Intronic
1161881429 19:6956682-6956704 TCCTCTGGAGTGCAGGCTGAAGG - Intergenic
1162189368 19:8932680-8932702 CCTCCTGGAAGGCAGGCTTAGGG + Intronic
1162775716 19:12977900-12977922 GCTTCTGGACTTCAGTCTCTGGG + Intergenic
1162831714 19:13288718-13288740 CCTTCTGGACTACAGACCCCTGG + Intronic
1163559486 19:18010315-18010337 CCTGCTGGACTGGAGGCTGGGGG + Exonic
1163697333 19:18770456-18770478 CCTGCTGGGCTGCAGACTTAGGG + Intronic
1165746537 19:38233277-38233299 TCTTCTGGACTCCAAGCTTAAGG - Intergenic
1165991859 19:39819909-39819931 CCCACTGGAATGCAGGCTCCAGG + Intergenic
1166123868 19:40702214-40702236 CCTTCTGCACTGCAGGTTGTGGG - Intronic
1166239827 19:41482612-41482634 CATTCTAGCCTGCAGGCTCCAGG + Intergenic
1166745184 19:45138500-45138522 CATTCTGGGCTGCAGGCACAGGG - Exonic
1166779547 19:45333954-45333976 CCTTGTGGAGTGCAGGCTGAGGG + Intronic
1168089028 19:54069941-54069963 CCTGCTGGACTGCATTCCCAGGG - Exonic
1168423078 19:56217792-56217814 CCCTCTGGTCTGCAGCCGCAGGG - Intergenic
925281877 2:2690615-2690637 CATCCAGGACTGCAGGCTCCAGG + Intergenic
925628889 2:5868832-5868854 CTGTCTGGTCTACAGGCTCATGG + Intergenic
926112668 2:10192936-10192958 CCTTCTGCGCTGCAGTCTCCTGG + Intronic
926408400 2:12577083-12577105 CCTGCTGGACTGCAGCTTGAGGG - Intergenic
926862830 2:17326918-17326940 CATTCTGGAATGCATGCTGATGG + Intergenic
926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG + Intronic
930160892 2:48155468-48155490 TCTTGTGGACTCCAGTCTCAGGG - Intergenic
930168355 2:48225887-48225909 CCTTCTGGACTACAAGGACAAGG + Intergenic
931201203 2:60098865-60098887 CCCTCTGGACTGCATGCTTCAGG + Intergenic
931916885 2:66966084-66966106 TCTTCTGGACTCCAAGTTCAGGG + Intergenic
933476404 2:82797569-82797591 ACTTCTGGACTTCTGGCTTAGGG - Intergenic
934696838 2:96406101-96406123 CCATCTGGCCCACAGGCTCAGGG + Intergenic
935656294 2:105426540-105426562 CTTCCAGGACTGCTGGCTCAGGG - Intronic
936615437 2:114043237-114043259 CCTTCTAGTCTGGGGGCTCAGGG - Intergenic
936701030 2:115011962-115011984 CCTTTAGGACTGCAGGCTGCTGG + Intronic
937255945 2:120555673-120555695 CCTCCTGGAATGCATGCACATGG - Intergenic
937320197 2:120956455-120956477 CCTTGCTGACCGCAGGCTCATGG - Intronic
937774131 2:125755686-125755708 CCTTATGGATTGCAAGCTCTTGG + Intergenic
937926372 2:127170805-127170827 CCTTATGGACTGCAGGGTAGGGG - Intergenic
938766047 2:134461057-134461079 CCTGCTGGGCTGGGGGCTCAGGG - Intronic
938820963 2:134959763-134959785 CATTCAGGAGTGCAGGCTCTGGG + Intergenic
942204378 2:173604818-173604840 CTTTCTGAACTGGAGGCTCTTGG + Intergenic
942730651 2:179057599-179057621 TTTTCTGGACTCCTGGCTCAAGG - Intergenic
943513219 2:188852200-188852222 CCTTCTGGACTATAAGCTCCAGG + Intergenic
944096318 2:195972865-195972887 CCAACTGGACTGCAAACTCAGGG - Intronic
947126422 2:226873623-226873645 CCTTGTAGACTGCAGGATAATGG + Intronic
947811048 2:233004211-233004233 CCTGCAGGGCTGCAGGGTCAGGG - Intronic
947950655 2:234144239-234144261 CCATCAGGACAGGAGGCTCATGG + Intergenic
948828103 2:240583918-240583940 CCTCCTCAACTGCAGGCTCTTGG - Intergenic
1168829964 20:840489-840511 CCTGCAGGGCTGCAGTCTCATGG + Intronic
1168835132 20:872807-872829 CCTTCTGGACTTCTGGGTCAAGG + Exonic
1172810293 20:37642779-37642801 CCTGCTGGACTGGAAGCTCAGGG - Intergenic
1172838268 20:37886761-37886783 TCTTCTGGACTCCATGGTCAAGG + Intergenic
1172841561 20:37905256-37905278 CCCTCGGGACTGCAAACTCAGGG - Intronic
1173875106 20:46365311-46365333 CCCTCTGAACAGAAGGCTCAAGG + Intergenic
1174842350 20:53912146-53912168 CCAACTGGCCTGCAGGCCCAGGG - Intergenic
1175872316 20:62214309-62214331 CCTTCGGGATTAAAGGCTCACGG + Intergenic
1177848401 21:26318442-26318464 TCTTCTGGGCAGCAGACTCAGGG - Intergenic
1178472773 21:32908743-32908765 CCCTCTGCACTTCAGGCCCAGGG - Intergenic
1179247859 21:39649191-39649213 CCTGCTGGACTCTAGACTCATGG + Intronic
1179343144 21:40531465-40531487 CCCTCTGCACTGCAGACTGATGG + Intronic
1180588611 22:16915970-16915992 CCTTTTCAACTGCAGACTCATGG - Intergenic
1183327049 22:37199922-37199944 CCTTCTGAAGAGCAGGCGCAGGG + Intergenic
1183640758 22:39090972-39090994 CCTTCCGTCCTGCAGGCTCAGGG - Intergenic
1184558762 22:45248828-45248850 TCTTCTGAACTGGAGCCTCAGGG - Intergenic
1184670262 22:46008498-46008520 CTTTCTGGACCACAGGGTCAGGG + Intergenic
949414613 3:3800745-3800767 CCTTCTGGGCTCAAGGCTCACGG - Intronic
950424326 3:12916510-12916532 CCTTTTGGACTGCAGTCTGGCGG - Intronic
950885978 3:16363094-16363116 CATTCTGAACTTCAGCCTCATGG - Intronic
951173510 3:19571917-19571939 TCTTCTGGATTCCAGGCTGAAGG - Intergenic
952933610 3:38378372-38378394 CCTCCTAGACAGCAGGCTCTGGG - Intronic
952995832 3:38881322-38881344 CCTACTAGACTTCAGGCTCCTGG + Intronic
953534992 3:43770530-43770552 CTCTCTGGACTGCAGGGTCTTGG - Intergenic
955420174 3:58727846-58727868 CGTTCTGGGATGCAGGCTGATGG + Intronic
956520917 3:70103144-70103166 CGTGCTGGAATGCAGGCCCACGG + Intergenic
957925489 3:86805397-86805419 CCACCTGCACTGCAGGCCCATGG - Intergenic
961895796 3:130166911-130166933 CCGACTGGACTGCATGCTCCTGG + Intergenic
964521631 3:157575582-157575604 CCTTTTGGGATGCAGGCTGATGG + Intronic
967545659 3:190724143-190724165 CCTTCTGGAGTGAAAGCCCAAGG - Intergenic
968415009 4:424166-424188 GCTTCTGGACTTCAGTTTCATGG + Intergenic
968843973 4:3029542-3029564 CCTACTGGGCTGCAGGGGCAGGG - Intronic
969005920 4:4020055-4020077 CCGACTGGACTGCATGCTCCTGG + Intergenic
969721934 4:8896865-8896887 CCTTCTGCCCTGCATGCCCAAGG - Intergenic
969807029 4:9617235-9617257 CCGACTGGACTGCATGCTCCTGG - Intergenic
969872562 4:10113980-10114002 CTGTTTGGAATGCAGGCTCAGGG - Intronic
969912352 4:10457738-10457760 ACTGCAGGACTGCAGGCTCCAGG - Intergenic
970431733 4:15995068-15995090 CCTTCTGGACAGCGTGCTCTAGG - Intronic
970546491 4:17135419-17135441 CCTTCTAGACCACAGGTTCAGGG - Intergenic
972268274 4:37483787-37483809 ACTTCTGGACTGCTGGCACAGGG - Intronic
980053658 4:128061058-128061080 CCGCCCCGACTGCAGGCTCAGGG - Intergenic
984191754 4:176614007-176614029 CCTCCTGGAAAGAAGGCTCAAGG + Intergenic
985910304 5:2874304-2874326 TCTTCTGGGCTCCAGGCTGAAGG - Intergenic
985925575 5:3013769-3013791 CCTTGAGGACTGCAGGGTGATGG + Intergenic
987192432 5:15491992-15492014 CCTTCTGGAGCCCAGGCTAAAGG - Intergenic
988645410 5:33090109-33090131 CCATGTGGACTCCAGCCTCAGGG + Intergenic
995208997 5:109515602-109515624 CTTTCTGGGCTGCATGCTCATGG + Intergenic
996197765 5:120631407-120631429 CTTTCTGGACAGGAGGCTCATGG + Intronic
996341462 5:122443652-122443674 TCTTCTGGGCTGCAGTGTCAAGG + Intronic
997305499 5:132832831-132832853 CGCTCTGGACTGCATCCTCATGG - Intergenic
997405858 5:133646059-133646081 TCTCCTGGACTGCATGCTCTAGG - Intergenic
997475721 5:134141267-134141289 CCTTAGGGGCTGCTGGCTCAGGG + Intronic
997849181 5:137315593-137315615 CCTGCTGCACTGATGGCTCAAGG + Intronic
997953893 5:138263642-138263664 CATTCTGGGATCCAGGCTCAAGG - Intronic
998005254 5:138652523-138652545 CCTCCTGGACTGAAAGCACAGGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999124750 5:149238926-149238948 GCTTCTGTGCTGCATGCTCAGGG - Intronic
1001702821 5:173719929-173719951 GCTTCTGTTCTGCAGGCTGAGGG + Intergenic
1002000150 5:176192739-176192761 CCTCATGGCCTTCAGGCTCAGGG + Intergenic
1002319873 5:178368698-178368720 CACTCTGGACTGGAGGCTGACGG - Intronic
1004061302 6:12200573-12200595 CCTTCTAGACTCCAGGCTCTAGG - Intergenic
1004629810 6:17410355-17410377 CCTTCTTAAATGCAGGCTCCTGG - Intronic
1006979529 6:38135865-38135887 CCTTCTGGACTGCAGGCTCAAGG - Intronic
1007260131 6:40557547-40557569 CCTACTGGCCTTCAGGGTCAAGG - Intronic
1007462789 6:42030503-42030525 CCTACTGGACTGTGGGCTCCTGG + Intronic
1010534530 6:77011324-77011346 CCTTCTGGACTTTAGGCGCCAGG + Intergenic
1010881568 6:81180418-81180440 CTTTTTGGACTGCAGTCTCTGGG - Intergenic
1016435622 6:144034294-144034316 CCCTCTGGACTGAAGCCTCTAGG + Intronic
1016701852 6:147063421-147063443 CATTCTGGAGTGGATGCTCATGG - Intergenic
1017321989 6:153105142-153105164 CCTTAGGGACAGCAGCCTCATGG + Intronic
1017915171 6:158825989-158826011 TCTGCTGGACTGGAGGCACAGGG - Intergenic
1018102606 6:160454468-160454490 CCTTGTGTTCTGCAGCCTCACGG - Intergenic
1018110517 6:160532749-160532771 CCTTGTGTTCTGCAGCCTCACGG - Intronic
1018367962 6:163140492-163140514 GCTGCTGGACTGGAGGCTCTAGG + Intronic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1019649963 7:2151548-2151570 CCTTCTGCTCTGCAGGCTGCAGG - Intronic
1020326474 7:6978360-6978382 CCGACTGGACTGCATGCTCCTGG + Intergenic
1021386339 7:20035497-20035519 CCCTCTGGGCTTCAGGGTCATGG - Intergenic
1022497859 7:30864559-30864581 CCTTCTGCACGGTGGGCTCAAGG + Intronic
1022992369 7:35721086-35721108 CCTTCCTGACTGCAGACTCAAGG + Intergenic
1023368667 7:39490428-39490450 CCTTCTGGCCTGCAGCCACCTGG - Intronic
1023514993 7:40992976-40992998 CCTCCTTGTATGCAGGCTCAAGG + Intergenic
1025606158 7:63041392-63041414 CCTTAGGGGCTGCAGGCTGAGGG + Intergenic
1026604216 7:71802097-71802119 CCTTCTGGACTGCATCCATATGG + Intronic
1029603387 7:101583240-101583262 CCATCTGAAGTGCTGGCTCAGGG + Intergenic
1030110919 7:106026308-106026330 CCTTCTGCTCTGCTGGCTCTTGG + Intronic
1032443332 7:131959173-131959195 CCTTCTGGGCTTCAGGCACAGGG - Intergenic
1032912117 7:136444757-136444779 CTTTCTGGAAGGCAGGTTCAAGG + Intergenic
1034719739 7:153280103-153280125 CCTCCTGAACTGCACACTCAGGG - Intergenic
1035271349 7:157721888-157721910 CCTTCTAGAGTAGAGGCTCAGGG + Intronic
1035402786 7:158577968-158577990 CCCTCTGGCCTGCAGGGTAAGGG - Intronic
1036489975 8:9215792-9215814 CCTTCTGGAATCCAGGCTGAAGG - Intergenic
1036595663 8:10209747-10209769 CCTTCAGGACTGAAAGCTCTTGG + Intronic
1036686800 8:10917194-10917216 CCTGCTCAACTGCAGGCCCAGGG + Intronic
1036690192 8:10940342-10940364 CCTTCAGGGCTCCAGGTTCAGGG + Intronic
1037011791 8:13852373-13852395 CATTCTGGGGTGCAGGCTGAAGG - Intergenic
1037709104 8:21341603-21341625 TCTTCTGGAGTGCAGCCACAGGG + Intergenic
1041719106 8:60960369-60960391 GATTCTGGAGTGCAGGCTCTGGG + Intergenic
1042694699 8:71544021-71544043 ACTGCAGGACTGCAGTCTCAGGG + Intronic
1043528282 8:81120519-81120541 CCTGCTGGACTGCAGGCTTCTGG + Intergenic
1047556086 8:125931923-125931945 ACTGCTGGAAGGCAGGCTCAAGG + Intergenic
1047759021 8:127940361-127940383 CGTTCTGCTCTGCAGTCTCATGG - Intergenic
1048867726 8:138773134-138773156 TTTCCTGGACTGCTGGCTCATGG + Intronic
1049003068 8:139838338-139838360 CCTGCTGGACTGCAAGCTCTGGG + Intronic
1049474377 8:142789997-142790019 CCTACTGGTCTGCAGGCCCTGGG - Intergenic
1049551037 8:143259938-143259960 CCTTCTGTGCAGCAGGCTCCTGG + Intronic
1052970169 9:34372532-34372554 CCTGCTGGGCTGCTCGCTCACGG - Exonic
1053143775 9:35698358-35698380 CCTTGTGGCCTGCAAGGTCAAGG - Exonic
1055939251 9:81634213-81634235 CCTTCGGGACTTCAGCCTCCTGG - Exonic
1057820182 9:98324117-98324139 GCATCTTGACTGCAGGCTCAGGG + Intronic
1061015721 9:127980147-127980169 CCTTCGGGGCTTCAGACTCAGGG - Exonic
1061059346 9:128242935-128242957 GCTGCTGGGCTGCAGGGTCAGGG - Intronic
1061824350 9:133248542-133248564 CCTTCTGCACTGCATTCTCAGGG - Intergenic
1188112758 X:26211554-26211576 CTCCCTGCACTGCAGGCTCAAGG + Intergenic
1191830396 X:65408521-65408543 CCTTCGGGACTTCAGCCTCCTGG + Intronic
1191918012 X:66222968-66222990 ACTCCTAGACTGCAGTCTCAGGG - Intronic
1196001050 X:110786502-110786524 CCTTCTGGACTGAAAACTAAAGG - Intronic
1199100006 X:143788750-143788772 CTTTCAGGAGTGAAGGCTCAGGG + Intergenic
1200141591 X:153905361-153905383 CCTTCTGGACTGCATGAGCCTGG + Intronic
1200834374 Y:7718409-7718431 CATTCTGAACTTCAGCCTCATGG - Intergenic