ID: 1006981923

View in Genome Browser
Species Human (GRCh38)
Location 6:38154180-38154202
Sequence GGGGGCTGCCTCACTGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006981923_1006981937 30 Left 1006981923 6:38154180-38154202 CCATCCTCAGTGAGGCAGCCCCC 0: 1
1: 0
2: 3
3: 25
4: 288
Right 1006981937 6:38154233-38154255 GAGGCTGTGCGAGCCCTTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 186
1006981923_1006981931 0 Left 1006981923 6:38154180-38154202 CCATCCTCAGTGAGGCAGCCCCC 0: 1
1: 0
2: 3
3: 25
4: 288
Right 1006981931 6:38154203-38154225 CATAGGCTTCCGCCAAGCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 59
1006981923_1006981933 11 Left 1006981923 6:38154180-38154202 CCATCCTCAGTGAGGCAGCCCCC 0: 1
1: 0
2: 3
3: 25
4: 288
Right 1006981933 6:38154214-38154236 GCCAAGCTCTGGTCCCGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006981923 Original CRISPR GGGGGCTGCCTCACTGAGGA TGG (reversed) Exonic
900104246 1:975517-975539 AGGGGCTGCTGCACTGGGGAGGG + Exonic
900139658 1:1134385-1134407 GGGGGCTGCCTCAGGGGGGAGGG + Intergenic
900176807 1:1294717-1294739 GTGGACAGCGTCACTGAGGAGGG - Exonic
900307944 1:2019971-2019993 GGAGGCTGTCTCGCTGTGGAGGG + Intronic
900460841 1:2801519-2801541 GGGGGCTGCCTGTTTGATGAGGG - Intronic
900519542 1:3098953-3098975 CTGAGCGGCCTCACTGAGGAGGG + Intronic
900584531 1:3426041-3426063 GGGTGCTGGCTCACTGCGGAGGG - Exonic
900857594 1:5198414-5198436 GGAGCCTCCATCACTGAGGATGG - Intergenic
901086320 1:6614159-6614181 GGGGTCTGGCTGCCTGAGGACGG - Intronic
902516786 1:16993813-16993835 ACGGGCACCCTCACTGAGGACGG - Exonic
902606903 1:17573914-17573936 GGGGCCTGCCTCACTGGGGCAGG - Intronic
904092117 1:27952589-27952611 TGGGGAGGCCTCCCTGAGGAAGG - Intronic
905322074 1:37124896-37124918 GGGGGGTGCTTCACTGTGGTGGG + Intergenic
905345547 1:37308830-37308852 GGGGTCAGCCTGCCTGAGGATGG + Intergenic
905385950 1:37604340-37604362 GGGGCCTCCTTCACAGAGGAAGG + Intergenic
905787116 1:40767202-40767224 GGGGGCTGCCTCCCTGGGCTTGG + Intronic
909174516 1:72339160-72339182 GGGGTCTACTTCACTGGGGAGGG + Intergenic
916221134 1:162446058-162446080 AGGGGCTGCCAGACTGAAGAAGG - Intergenic
917602316 1:176588743-176588765 GGGGTCTGGCTCACTGAGGTTGG + Intronic
918098519 1:181353812-181353834 TGTGGCTACCACACTGAGGAAGG + Intergenic
918684320 1:187396690-187396712 GGGCGTTGCCTCACCCAGGAAGG + Intergenic
918851219 1:189693080-189693102 GAGGGTTGTCTCACTGTGGAGGG - Intergenic
918864005 1:189870923-189870945 GGAGGTTGTCTCACTGCGGAAGG + Intergenic
919597952 1:199587892-199587914 GGGGTCTTCATCACTGAGCAAGG + Intergenic
920385268 1:205567121-205567143 GGGGGCTACCTCATTGTGGCAGG + Intergenic
920585811 1:207159126-207159148 GGGAGCTGCCTCACTCAAGGTGG + Intergenic
922152643 1:223018680-223018702 GAGAACTGCCTGACTGAGGATGG + Intergenic
922806470 1:228392680-228392702 GGGGGCTGCCTCACTCCAGGAGG + Intergenic
923109519 1:230879780-230879802 GGGGGCAGACTGATTGAGGAGGG - Intergenic
923109532 1:230879817-230879839 GGGGGCAGACTGATTGAGGAGGG - Intergenic
923880775 1:238101806-238101828 GGGGGCTGCCTCCTTGAGGGAGG + Intergenic
1062901535 10:1150362-1150384 GGGGGCCACCTGTCTGAGGATGG - Intergenic
1063897692 10:10699642-10699664 GGGGGATGCCTGACTGCAGATGG + Intergenic
1064769604 10:18710511-18710533 GGGGGTCCCCTCCCTGAGGAGGG - Intergenic
1067684810 10:48459768-48459790 GAGCGCGGGCTCACTGAGGAGGG - Exonic
1067833609 10:49624461-49624483 AGGGGCAGTCTCACTGAGGCAGG - Intronic
1069774697 10:70919592-70919614 GGGGCTTGCCTCCCTGGGGAAGG - Intergenic
1069919370 10:71807267-71807289 GGGGGCTGCCTTTCTGCAGAGGG - Exonic
1071661102 10:87504169-87504191 GGGTGCTGTCTCACTGATGTCGG + Intergenic
1071881108 10:89898831-89898853 GGTTTCTGTCTCACTGAGGAAGG - Intergenic
1073463938 10:103682894-103682916 TGGGCCTTTCTCACTGAGGATGG + Intronic
1073705054 10:105973666-105973688 GGTGGCTGCCGCAAGGAGGAGGG + Intergenic
1074397105 10:113107260-113107282 GGTGGGTGGCTCTCTGAGGAGGG + Intronic
1075055522 10:119215536-119215558 GGGGGCTGCACCATGGAGGAGGG + Intronic
1075070920 10:119319412-119319434 GGGGGCTCCCGCTCTGGGGAAGG - Intronic
1075280807 10:121136569-121136591 GGGTGCTCCCACACGGAGGATGG - Intergenic
1076261317 10:129069251-129069273 TGGAGTTGCCTCACAGAGGACGG - Intergenic
1076769887 10:132657089-132657111 GGAGGCTGCCTCAGCCAGGATGG + Intronic
1077800835 11:5534534-5534556 GCTGGATTCCTCACTGAGGAAGG - Intronic
1079002336 11:16768398-16768420 GCTGGCTGCCACAGTGAGGAGGG + Intergenic
1079631602 11:22684295-22684317 GGAGAATGCCTCAGTGAGGACGG + Intronic
1080313116 11:30917724-30917746 GAGGACTGCTTGACTGAGGAAGG + Intronic
1083221803 11:61257634-61257656 GGGGGCTTCCACAGTGAGAAGGG - Intergenic
1083627432 11:64078788-64078810 GGGGGAGGCCTCTCTGAGCAGGG + Intronic
1083960789 11:66013769-66013791 GGCGGCAGACTCACAGAGGAGGG + Intergenic
1084419371 11:69052711-69052733 GGCAGCTGCCTCCCTAAGGATGG + Intronic
1084935834 11:72586190-72586212 GGGGGTGGGCTCACTCAGGAGGG + Intronic
1085736810 11:79046145-79046167 AGGGGCTGACTCACTTAGAAGGG + Intronic
1089385978 11:118068317-118068339 GAGGGCTCCCTCCCCGAGGAGGG - Intergenic
1093954335 12:25198886-25198908 GGGGTATGCCTCTCTGGGGAAGG - Intronic
1096532965 12:52253468-52253490 AAGGGCTGCCTCTCTGAGGTTGG - Intronic
1097223515 12:57463753-57463775 GGGGGCCCCCTGACTGGGGAGGG - Exonic
1099032515 12:77544909-77544931 GGGGGCTGCTTGAGTGGGGAGGG + Intergenic
1099390892 12:82077846-82077868 GGGGTCTGGCTCACTGGGGTTGG + Intergenic
1101648888 12:106656706-106656728 GGGGGGTGTCTCAAGGAGGAAGG - Intronic
1102039996 12:109794508-109794530 GGGGGCTGCCTTCCTGAGATGGG + Intronic
1102044179 12:109819438-109819460 GGGAGCTTCCCCACTGTGGAGGG - Intronic
1102532782 12:113558933-113558955 AGGGGCAGCCTCACCCAGGATGG + Intergenic
1102532949 12:113560162-113560184 AGGGGCAGCCTCACCCAGGATGG - Intergenic
1102614299 12:114139765-114139787 AGGGGCTGCCTGACAGAGGTTGG - Intergenic
1103743564 12:123107383-123107405 GGGGTCTGCCTTAAAGAGGAGGG - Intronic
1104110224 12:125697809-125697831 GGCTGCAGCCTCACTGGGGAAGG - Intergenic
1104996594 12:132661705-132661727 GGGGGCAGCTTCACTCATGATGG + Intronic
1105024171 12:132837747-132837769 GGGTCTTGCCTCCCTGAGGACGG - Intronic
1107898479 13:44989234-44989256 GGGGGCTGCGACTCAGAGGAAGG + Exonic
1108722298 13:53144894-53144916 GTGTGCTGCCTCCATGAGGAGGG + Intergenic
1111873287 13:93861769-93861791 GGGTGCTGCCACAGTCAGGAAGG - Intronic
1112143110 13:96668482-96668504 GGGAGCTGCCTCACAGGGTATGG - Intronic
1113395065 13:109939967-109939989 GGGGGTTGGCTCACCCAGGATGG + Intergenic
1113649580 13:112026439-112026461 GGGGGCTGCCTGAAGAAGGAGGG + Intergenic
1113770671 13:112906430-112906452 AGGGCCTGTCTCACTGAGAATGG + Intronic
1113799702 13:113080029-113080051 GGGGGCATCCGCACAGAGGAGGG + Intronic
1113799738 13:113080189-113080211 GGGGGCATCCGCACAGAGGAGGG + Intronic
1114456092 14:22854477-22854499 GGTGGCTCCCGCGCTGAGGAGGG + Intergenic
1114709987 14:24768321-24768343 GGGTGTCGCCTCACTCAGGAAGG + Intergenic
1115354488 14:32433033-32433055 GGGAGCTGACTCAATTAGGAGGG - Intronic
1116856879 14:49960388-49960410 GGGGGCTCCCACCCTGAGGAGGG - Intergenic
1118318011 14:64737395-64737417 GGGGACTGGCTGACAGAGGAGGG + Intronic
1118422175 14:65618808-65618830 GGTGGCAGCCTCACTGACCATGG - Intronic
1118589866 14:67393136-67393158 GGGGACAGGCTCACCGAGGAAGG + Exonic
1118982721 14:70729709-70729731 GGGAACTGCCTCAGTGAGAACGG - Exonic
1119152560 14:72375596-72375618 GGGGTCTGGCTCACTGGGGTTGG - Intronic
1121813584 14:96912572-96912594 AGGAGCAACCTCACTGAGGATGG + Intronic
1122194610 14:100075599-100075621 GGACGATGGCTCACTGAGGAAGG + Intronic
1122548127 14:102536041-102536063 TGGGGCTGCCTCACTGAGGTAGG - Intergenic
1123944513 15:25232590-25232612 CTGGGCTGCCTCATTGAGGAGGG - Intergenic
1125932685 15:43611654-43611676 GGGACCTGAGTCACTGAGGATGG - Intronic
1125945784 15:43711116-43711138 GGGACCTGAGTCACTGAGGATGG - Intergenic
1128081003 15:64856874-64856896 GCTGGAGGCCTCACTGAGGACGG - Intronic
1128337764 15:66798436-66798458 AGGGGATGCGTCCCTGAGGAAGG - Intergenic
1128357029 15:66935283-66935305 GAAAGCTGGCTCACTGAGGAGGG + Intergenic
1128647945 15:69390783-69390805 TGGGCCTGACTCACTGATGAGGG - Intronic
1128762646 15:70227936-70227958 GGGGCCTGCCACAGTGTGGAGGG - Intergenic
1130723281 15:86411264-86411286 GGGGACTGCCTCCCTGGGGTGGG + Intronic
1131061109 15:89405184-89405206 GGGGGTTGCTGCAGTGAGGAGGG + Intergenic
1131091660 15:89628674-89628696 GGGGGCCCCCTCAGTGAGGGGGG + Exonic
1131601478 15:93853611-93853633 GGGTGCTGCCTGCTTGAGGAAGG + Intergenic
1132185293 15:99798135-99798157 GGGGGCTGGGGCTCTGAGGATGG + Intergenic
1132821214 16:1872168-1872190 GGGGGCGGAGTCGCTGAGGACGG - Exonic
1132976574 16:2714064-2714086 TGGGGCAGCCCCAGTGAGGAAGG - Exonic
1133238905 16:4403248-4403270 GGGGGCGGCCTGACTGTGGTAGG - Intronic
1134102241 16:11460638-11460660 GAGGGCTGCCTGGCAGAGGAGGG - Intronic
1135091194 16:19519232-19519254 GTGGGGTCCCTCTCTGAGGAGGG + Intronic
1135325152 16:21520985-21521007 GGGGGCTGCATCAATGTGGCTGG + Intergenic
1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG + Intronic
1136336636 16:29614253-29614275 GGGGGCTGCATCAATGTGGCTGG + Intergenic
1138414131 16:56861566-56861588 GGCAGATGCCTCTCTGAGGAGGG + Intergenic
1139081959 16:63532855-63532877 GGGTCTTGCCTCACTGTGGATGG + Intergenic
1139226329 16:65235974-65235996 GGGGCCTGACACACTGAGAAAGG - Intergenic
1139592628 16:67942005-67942027 GGGATGTGCTTCACTGAGGATGG - Intronic
1141402717 16:83764590-83764612 GGTGGGAGCCTCACAGAGGAAGG - Intronic
1141647336 16:85374802-85374824 GCCTTCTGCCTCACTGAGGACGG + Intergenic
1142037362 16:87870037-87870059 GGGGGCTGCATCAGTGGGGCTGG + Intergenic
1142133391 16:88441103-88441125 AGGGGGGGCCTCAGTGAGGATGG - Intergenic
1142560437 17:806187-806209 GGGGGCTGCAGCCCTGGGGAGGG - Intronic
1142560454 17:806233-806255 GGGGGCTGCAGCCCTGGGGAGGG - Intronic
1142560473 17:806278-806300 GGGGGCTGCAGCCCTGGGGAAGG - Intronic
1142814532 17:2414881-2414903 GGCGCCTGCCCCACTGATGATGG - Intronic
1143624753 17:8103441-8103463 GGGGGCTGCCTCATGGATGATGG + Exonic
1145249654 17:21290133-21290155 GGGGGCTGCCTCACTGGGGCAGG + Intronic
1146158194 17:30541994-30542016 GAGGGCATCCTCACTGAGCACGG - Intergenic
1146797331 17:35791912-35791934 GAGGGGTGCGTCACAGAGGAGGG - Intronic
1149543895 17:57489017-57489039 GGGGGCTGCATCTCTGGGCACGG - Intronic
1150712859 17:67546542-67546564 GGGTTCTGCCTCACTGCTGATGG + Intronic
1150737557 17:67753339-67753361 GGGGGCTGCTGCAGTGGGGAGGG - Intergenic
1152366669 17:79860439-79860461 GGGGGCTGCGTCCTTGAGGACGG + Intergenic
1152945816 17:83196847-83196869 GGGGATGGCCTCACTGTGGAAGG + Intergenic
1154178026 18:12100952-12100974 GGGGGCTGCCTCTTTGAAGTAGG + Intronic
1154485769 18:14870610-14870632 GGTGGATGCCTAAGTGAGGAAGG - Intergenic
1156179456 18:34586007-34586029 AGGGACTGCCTCATGGAGGAGGG + Intronic
1156350022 18:36295902-36295924 GAGGGCTCTCTCAGTGAGGAGGG + Intergenic
1158488142 18:57886736-57886758 GAGGGCTGCCTCATAGAAGAGGG + Intergenic
1160354675 18:78216761-78216783 GGAGGCTGCCTGCCTGGGGAAGG + Intergenic
1161186128 19:2922016-2922038 GGGGGATGCCTCACTGCTGATGG + Intergenic
1161288405 19:3480197-3480219 GGGGGGTCCCTTACAGAGGAGGG + Intronic
1161738667 19:6007154-6007176 GGGGTCTTCGTCACTGTGGAGGG + Exonic
1162142482 19:8592908-8592930 GCGGGCTGCCCCAGGGAGGAAGG - Intronic
1164668897 19:30062126-30062148 GGGCACTGCCTCCCTGAAGATGG + Intergenic
1165423421 19:35733183-35733205 GGTGGCTGCTTCACTGGGGGTGG - Exonic
1166294094 19:41880631-41880653 GGTGGGTGCCTCAGTGAGCAGGG - Intronic
1166322690 19:42028425-42028447 GGAGGTTGCCAGACTGAGGAGGG + Intronic
1166723608 19:45012027-45012049 CGGGGCTGCGTCCCTGAGCACGG + Exonic
1166807940 19:45498056-45498078 GGGGGCTGTACCACTGAGGTGGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168718229 19:58541165-58541187 GGGAGCTTCCTGTCTGAGGAGGG - Intergenic
925125742 2:1454564-1454586 GGAGGCTGTGTCACTGAAGACGG + Intronic
925649662 2:6076389-6076411 TGGGGCTGCCACAGTCAGGACGG + Intergenic
929463770 2:42126417-42126439 AAGGGCTGCATCACTGAGCAGGG + Intergenic
929564772 2:42977463-42977485 TGGGGCTGCCACAGGGAGGAAGG + Intergenic
931247934 2:60506515-60506537 TGGGGCCGGCTCACTGAGGCTGG - Intronic
931963681 2:67509202-67509224 GGGTGCTGGCTCACTGAGATGGG - Intergenic
932303579 2:70685909-70685931 GGGAGCTGCCTCTCTCAGCAGGG + Intronic
933771568 2:85747979-85748001 AGGGACAGCCTCACTGAGAAGGG + Intergenic
934517153 2:94995759-94995781 GAAGGCTGGCCCACTGAGGAAGG + Intergenic
934620716 2:95803003-95803025 CAGCTCTGCCTCACTGAGGATGG - Intergenic
934812723 2:97296714-97296736 CAGCTCTGCCTCACTGAGGATGG + Intergenic
935411859 2:102772415-102772437 GGGGACTTCCACACTGAGTAGGG + Intronic
935591844 2:104852333-104852355 GGGGGCTGCCTGGCTGCGGCTGG + Intergenic
936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG + Exonic
936547273 2:113403542-113403564 CAGCTCTGCCTCACTGAGGATGG + Intergenic
937259250 2:120574912-120574934 GGGGAAGGCCTCCCTGAGGAGGG - Intergenic
937519538 2:122695078-122695100 GGGGGCAGCCTCACTCAGGGAGG + Intergenic
937863530 2:126731542-126731564 GGGGGCTGCCTCGGTGGGGAGGG + Intergenic
938811628 2:134858983-134859005 CTGGGCTGCCTGACTGAGAATGG - Intronic
939580516 2:143940752-143940774 GGGGGCTGCCTTTCTGATGAAGG + Exonic
942116046 2:172730403-172730425 GGATGCTGCCTCCTTGAGGAGGG - Intergenic
944587612 2:201186379-201186401 GGGCTCTGCCACACTGAGGTGGG - Intronic
946096857 2:217281879-217281901 GGGGGCTGGATGACTTAGGATGG + Intergenic
947406402 2:229781854-229781876 AGGAGCTGCTTCACTGGGGAAGG - Intronic
947967826 2:234296843-234296865 GGGGGCTGCCCCTCTGTGAACGG - Intergenic
948100188 2:235366881-235366903 GGAGCTTGCCTCACTGAGGGAGG + Intergenic
948379060 2:237540611-237540633 GGGTGCTGCCTCCCTGGGGAGGG - Intronic
1170750923 20:19144224-19144246 GGCAGCTGACTCAGTGAGGAAGG + Intergenic
1172164982 20:32893509-32893531 AGGGGTGGCCTCTCTGAGGATGG + Intronic
1172214445 20:33225235-33225257 GGGGTCTTACTCAGTGAGGATGG - Exonic
1173580346 20:44142601-44142623 AGGGCTGGCCTCACTGAGGAAGG - Intronic
1174458210 20:50664547-50664569 GGGGGCTGGCTGAGTCAGGAGGG + Intronic
1174716304 20:52762433-52762455 AGGGCAGGCCTCACTGAGGATGG + Intergenic
1175400978 20:58699716-58699738 GGGGAAGGCCTCTCTGAGGAGGG - Intronic
1175465990 20:59191647-59191669 GGGGGCGGCCTCCTGGAGGAAGG + Exonic
1176795560 21:13368859-13368881 GGTGGATGCCTAAGTGAGGAAGG + Intergenic
1178561217 21:33641734-33641756 GGGGGCGGGCTCTCTGACGAAGG - Exonic
1178676006 21:34632262-34632284 GGGGGCTCCCACCCTGAGAAAGG + Intergenic
1178715417 21:34959917-34959939 GGGGGCTACCTGGATGAGGAGGG + Intronic
1180116649 21:45710733-45710755 GTGCTCTGCCTCACTGAGGATGG + Intronic
1182570197 22:31231507-31231529 GGGGCCTGCCTGACAGAGGAAGG + Intronic
1183094753 22:35545465-35545487 GGGGGCTGCATCCCAGAGGTGGG - Intronic
1184487160 22:44786689-44786711 AGGGGCTGCCTCACTGCAGCTGG + Intronic
1184860509 22:47170970-47170992 GGGGCCTGCCTCAGTGAGGGTGG + Intronic
1184923130 22:47619825-47619847 GTGGGCAGCCTCCCTCAGGAGGG - Intergenic
1185128679 22:49025527-49025549 GGGGCCTGCCTTTCTGAGGCCGG + Intergenic
1185219552 22:49622597-49622619 GGGGCCTGCCCCACAGAGGTGGG + Intronic
1185276244 22:49951255-49951277 GGAGGCTGGCTGACTGAGGACGG + Intergenic
1185366876 22:50440902-50440924 GGGGGCTCCCACAGCGAGGATGG + Exonic
949917235 3:8974550-8974572 TGGGCCGGCCTCTCTGAGGAGGG - Intergenic
950372634 3:12544027-12544049 GTTGGCTGCCTCCCTGAGCAAGG + Intronic
950540610 3:13610085-13610107 AGGGACAGCCTCACTGAGGAGGG + Intronic
951164443 3:19467916-19467938 GGAGCCTGCCTCCCTAAGGAAGG - Intronic
953793400 3:45965428-45965450 TGGAGCTGCCTCAGAGAGGAGGG + Intronic
953961763 3:47271523-47271545 GGGGGCTTCCTAACTCAGAAGGG + Intronic
954039154 3:47871032-47871054 GGGGGCTGTCCCACTGAGAGTGG + Exonic
954378436 3:50206712-50206734 GGGGGCTGAATCTCTGGGGAGGG + Intronic
954680575 3:52343899-52343921 GGGGTCTGCCTATGTGAGGACGG + Intronic
954687282 3:52377759-52377781 GGGGGAGGCCTCACTGAGGAAGG - Intronic
954753563 3:52827059-52827081 GGGGGCAGCTTCAGTGGGGAGGG - Intronic
956248148 3:67207244-67207266 ATGGGCTGCATCACTGAGCATGG - Intergenic
956858834 3:73302621-73302643 GGTGGCTGCATCACAGAGGTTGG - Intergenic
958618446 3:96526833-96526855 GGGAGTTGCCTCACCCAGGAAGG + Intergenic
959131687 3:102363755-102363777 GGGGTCTGGCTCACTGGGGCTGG - Intronic
961380691 3:126494803-126494825 TGGGGCTGCCTCACACAGAATGG - Intronic
962365939 3:134781490-134781512 GGGGACGGCTTCAGTGAGGAAGG + Intronic
967811627 3:193765759-193765781 AGGGGCAGCCACAGTGAGGAGGG + Intergenic
968188731 3:196652029-196652051 GAGCCCTGCCACACTGAGGAGGG + Intronic
968575798 4:1365559-1365581 GGGGGATCCCTCACTGAGTCTGG - Intronic
968981513 4:3852486-3852508 CCGGGCTGCCTCCCTGAGGGCGG + Intergenic
969056587 4:4406463-4406485 CAGGGCTGCCTCACTCAGGGTGG - Intronic
969071441 4:4542326-4542348 GGCGGCTCCCTCACTGAGACCGG + Intronic
969401176 4:6956637-6956659 CGGGGCTGCTTCTCTGTGGAAGG + Intronic
969628972 4:8324343-8324365 GGGGGGTGACTCACAGAGGCAGG - Intergenic
969716824 4:8871862-8871884 CGGGGCGGCCTCACTGGGGGCGG + Intergenic
974810411 4:66938638-66938660 GGTGGCTGGCTAGCTGAGGAAGG - Intergenic
975618065 4:76267282-76267304 TGGGGATGCCTCCCCGAGGAAGG + Intronic
975866976 4:78733941-78733963 GGGGACAGGCTCACTTAGGAGGG + Intergenic
983031441 4:162807207-162807229 GGGTGCTGCCTCAGTGTTGATGG + Intergenic
984102271 4:175499952-175499974 GGGGGCTGCCTCAATGGGGCTGG - Intergenic
985393135 4:189513095-189513117 GCGGGCTGCCTAACCAAGGAGGG + Intergenic
985558033 5:567731-567753 GGAGGCTCCCACACTGAGGACGG + Intergenic
985564594 5:608994-609016 GGGGGCTTCCTGCCAGAGGAGGG - Intergenic
986465301 5:8015109-8015131 CAGGGCTGCTTCCCTGAGGATGG + Intergenic
988174845 5:27708769-27708791 GGAGGCTGACTCAGTGAGGTTGG + Intergenic
992364413 5:76077535-76077557 GGGTGCTGCCACACTGAGTTTGG - Intergenic
992400075 5:76403630-76403652 GGGAGCTCCCTCCCCGAGGACGG + Intronic
992761858 5:79957501-79957523 AGGGGAGGCTTCACTGAGGAAGG + Intergenic
994894772 5:105688596-105688618 AGGAGCTGCCTCACTGATGGAGG + Intergenic
997602434 5:135149815-135149837 GGGGACTGCCTCTTTGTGGAGGG + Intronic
997854865 5:137364174-137364196 TGAGGCTGCCTCACTGGAGAAGG + Intronic
999152572 5:149436001-149436023 GAGAGCTGCCTCTCTGAGAAGGG + Intergenic
999252785 5:150192542-150192564 GGAGGCTGGCACAGTGAGGATGG - Intronic
1001980024 5:176031522-176031544 GGTGGATGCCTAAGTGAGGAAGG + Intronic
1002060053 5:176620682-176620704 GGGGGTTGCCTCAGAGCGGAAGG + Exonic
1002237358 5:177812141-177812163 GGTGGATGCCTAAGTGAGGAAGG - Intergenic
1002276072 5:178105063-178105085 GGTGGATGCCTAAGTGAGGAAGG + Intergenic
1002724558 5:181286113-181286135 GGTGGATGCCTAAGTGAGGAAGG - Intergenic
1004570619 6:16841085-16841107 AGGGGCTACCTCTCTGAGGCTGG + Intergenic
1005307793 6:24530588-24530610 GGGTTGAGCCTCACTGAGGATGG + Intronic
1006377573 6:33680116-33680138 GAGGACTGCATCACTGAGGTGGG + Exonic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1007703439 6:43777600-43777622 GGGGGCTGCTGCAATGACGAGGG + Exonic
1009622421 6:66094707-66094729 GGGGGCTGCGACTCAGAGGAAGG + Intergenic
1014544959 6:122723750-122723772 TGGGAATGCCTCACTGAGAAGGG - Intronic
1015440327 6:133240919-133240941 GGGGGCTGCCCCACAGAAGCAGG + Intronic
1017916693 6:158836799-158836821 GGGGCCTGACTCATTGAGCAGGG + Intergenic
1019406480 7:886793-886815 GGGGCCTGGCTCACTGAGACCGG - Intronic
1019580251 7:1758429-1758451 GGAGGCTGGCTGGCTGAGGATGG + Intergenic
1019580262 7:1758468-1758490 GGAGGCTGGCTGGCTGAGGATGG + Intergenic
1019630139 7:2044767-2044789 GGGGTCTGTCTCACTGAGCTGGG - Intronic
1019795051 7:3043155-3043177 GGGGCCTGGCTCAGGGAGGAAGG - Intronic
1020005746 7:4783099-4783121 GGGAGCTGCATCGCTGAGGCTGG - Intronic
1022049113 7:26647918-26647940 GGGAGCTTCCTCACTGAGGGTGG - Intergenic
1023035431 7:36127390-36127412 TGAGGATGCCTCACTGAGGTGGG + Intergenic
1025606418 7:63043072-63043094 GGGAGCTGACTGACTGGGGAGGG - Intergenic
1026645641 7:72165742-72165764 GAGGGCTGTCTCCTTGAGGAAGG + Intronic
1027790316 7:82633264-82633286 GGGCGTTGCCTCACTTGGGAAGG + Intergenic
1030092297 7:105868201-105868223 TGGGGGGGCCTCACTGAGGTAGG - Intronic
1031971817 7:128070173-128070195 AGGTGGTGCCACACTGAGGAAGG - Intronic
1032404100 7:131643304-131643326 CGGGGCTGCCACACTTGGGAAGG + Intergenic
1033374720 7:140747129-140747151 TGGGGCAGCTTCACTGAGGATGG + Intronic
1034794444 7:154000343-154000365 GGGGCCAGCTGCACTGAGGATGG + Intronic
1036729895 8:11253531-11253553 GAGGCCTGCTCCACTGAGGAAGG - Intergenic
1036778714 8:11631120-11631142 GGGAGCTGGCTGACTGGGGAGGG + Intergenic
1037607457 8:20449663-20449685 GGGAGCTGCCTTTCTGAGAAGGG + Intergenic
1038216306 8:25564727-25564749 TGTGGCTTCCTCACTGAGAAGGG + Intergenic
1041510774 8:58652670-58652692 GGGGGGTACCTCACAGAGAAAGG - Intronic
1044336563 8:90990439-90990461 GGGGACGGCCTCACAGAGTAAGG - Intergenic
1048316657 8:133368068-133368090 GGGGGGGGCCTCACTGATAAAGG + Intergenic
1049377662 8:142296685-142296707 GGGGAGGGCCTCCCTGAGGAGGG + Intronic
1049389447 8:142360484-142360506 CAGGGCTGCCTCAATGAGGCCGG + Intronic
1049403804 8:142442802-142442824 GGTGGCTGCCCCACTGATGCTGG - Intergenic
1049686216 8:143940292-143940314 GAGGGCTGACTCACGGAGGCCGG + Intronic
1051636360 9:19184192-19184214 CTGGCCTGCCTCACTGAAGAAGG - Intergenic
1052372022 9:27675851-27675873 TGGGGTTGCCTAACTGAGGCAGG - Intergenic
1053128865 9:35604517-35604539 GGGAGGTGTCTCACTGAGGAAGG + Intergenic
1053886696 9:42649486-42649508 GGTGGATGCCTAAGTGAGGAAGG - Intergenic
1054225715 9:62456936-62456958 GGTGGATGCCTAAGTGAGGAAGG - Intergenic
1054807914 9:69411191-69411213 TCGGGCTGCTGCACTGAGGAGGG - Intergenic
1055289826 9:74770959-74770981 GGCGGCTGCTTCACTGAAGTGGG - Intronic
1057272951 9:93660830-93660852 AGAGGGTCCCTCACTGAGGAAGG + Intronic
1057298870 9:93865141-93865163 AAGAGCTGCCTCAGTGAGGAAGG - Intergenic
1058229880 9:102412612-102412634 GTGGGCTGCCTCTTTGACGATGG - Intergenic
1059330535 9:113532733-113532755 GGGGGCTGCCTCAGTATTGAGGG + Intronic
1060656162 9:125374168-125374190 GGGTGAGGCCTCACTGAGGAGGG - Intergenic
1061181546 9:129027807-129027829 GGCGCCTGCCTGGCTGAGGAGGG - Intronic
1061263744 9:129494068-129494090 GGGAGCTGACTCATTGAGGTGGG + Intergenic
1061745055 9:132733585-132733607 GGGGACAGCCTCGCTGCGGAGGG + Intronic
1062059970 9:134490052-134490074 GGGGACAGCCACACTGGGGAGGG - Intergenic
1062240719 9:135536357-135536379 GGGGGCTGCCTGACTGATCTGGG - Intergenic
1062331450 9:136046579-136046601 GGGGCCTGCCTCGCTGCGGGTGG + Intronic
1062338558 9:136083310-136083332 CGGTGCTGCCTCCCTGAGCAAGG - Intronic
1062631480 9:137464999-137465021 CCTGCCTGCCTCACTGAGGAAGG - Intronic
1185520925 X:739255-739277 GGGGTCTGACTCAGTGGGGAGGG - Intergenic
1188849123 X:35110430-35110452 GGGGGCTGCATCCCTGTGGCAGG + Intergenic
1190643468 X:52503145-52503167 GGGGGCTGTCACACTGTGGTGGG + Intergenic
1190955421 X:55188300-55188322 GGGGGCTGTCACACTGTGGTGGG - Intronic
1192220274 X:69193060-69193082 GGGGGAAGGATCACTGAGGAAGG - Intergenic
1194125171 X:90007970-90007992 GGGTGCTGCCTCTCTGTGTATGG + Intergenic
1195654726 X:107323825-107323847 GGGGGCTGCCTCAGTGGAGCTGG + Intergenic
1199991263 X:152988939-152988961 GGGGGGGGCCACACTGAGGGAGG - Exonic