ID: 1006983168

View in Genome Browser
Species Human (GRCh38)
Location 6:38161864-38161886
Sequence GGTCAGCCCAAAGGTTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006983168_1006983179 25 Left 1006983168 6:38161864-38161886 CCACCCCAACCTTTGGGCTGACC No data
Right 1006983179 6:38161912-38161934 GAGCCGTCCCTGCCAAGCCCTGG No data
1006983168_1006983177 3 Left 1006983168 6:38161864-38161886 CCACCCCAACCTTTGGGCTGACC No data
Right 1006983177 6:38161890-38161912 TGGTGCCAAGCGGAGCAGATAGG No data
1006983168_1006983175 -7 Left 1006983168 6:38161864-38161886 CCACCCCAACCTTTGGGCTGACC No data
Right 1006983175 6:38161880-38161902 GCTGACCTGGTGGTGCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006983168 Original CRISPR GGTCAGCCCAAAGGTTGGGG TGG (reversed) Intergenic