ID: 1006984156

View in Genome Browser
Species Human (GRCh38)
Location 6:38166548-38166570
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006984156_1006984166 7 Left 1006984156 6:38166548-38166570 CCCTCCACCTTCCCCCTCCGCAC No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006984156 Original CRISPR GTGCGGAGGGGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr