ID: 1006984166

View in Genome Browser
Species Human (GRCh38)
Location 6:38166578-38166600
Sequence CCCTCCACCTCCCCCACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006984162_1006984166 -6 Left 1006984162 6:38166561-38166583 CCCTCCGCACAGCAGAGCCCTCC No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984161_1006984166 -5 Left 1006984161 6:38166560-38166582 CCCCTCCGCACAGCAGAGCCCTC No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984156_1006984166 7 Left 1006984156 6:38166548-38166570 CCCTCCACCTTCCCCCTCCGCAC No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984157_1006984166 6 Left 1006984157 6:38166549-38166571 CCTCCACCTTCCCCCTCCGCACA No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984158_1006984166 3 Left 1006984158 6:38166552-38166574 CCACCTTCCCCCTCCGCACAGCA No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984163_1006984166 -7 Left 1006984163 6:38166562-38166584 CCTCCGCACAGCAGAGCCCTCCA No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984154_1006984166 30 Left 1006984154 6:38166525-38166547 CCTCGCCGCTGCGCACAGCAGAG No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984160_1006984166 -4 Left 1006984160 6:38166559-38166581 CCCCCTCCGCACAGCAGAGCCCT No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984159_1006984166 0 Left 1006984159 6:38166555-38166577 CCTTCCCCCTCCGCACAGCAGAG No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984155_1006984166 25 Left 1006984155 6:38166530-38166552 CCGCTGCGCACAGCAGAGCCCTC No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data
1006984164_1006984166 -10 Left 1006984164 6:38166565-38166587 CCGCACAGCAGAGCCCTCCACCT No data
Right 1006984166 6:38166578-38166600 CCCTCCACCTCCCCCACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006984166 Original CRISPR CCCTCCACCTCCCCCACCAC CGG Intergenic
No off target data available for this crispr