ID: 1006985585

View in Genome Browser
Species Human (GRCh38)
Location 6:38173448-38173470
Sequence CATCAGAGGGCTACCGGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006985585_1006985591 0 Left 1006985585 6:38173448-38173470 CCTGCCCCGGTAGCCCTCTGATG 0: 1
1: 0
2: 0
3: 10
4: 207
Right 1006985591 6:38173471-38173493 TCTGCCATCCTGTGTTCACACGG 0: 1
1: 0
2: 2
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006985585 Original CRISPR CATCAGAGGGCTACCGGGGC AGG (reversed) Exonic
900609829 1:3539812-3539834 CAACAGATGGCTCCCGGGCCAGG + Intronic
900999551 1:6142013-6142035 CCTGGGAGGGCTACCGAGGCCGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903273952 1:22209029-22209051 CATCTGAGGGCTTCGGGGCCGGG + Intergenic
903605573 1:24572873-24572895 AATCACAGAGCTACTGGGGCAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906580419 1:46930914-46930936 AATTAGAAGGCTACAGGGGCTGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923821992 1:237455014-237455036 CAGGAGAGGGCTACCGGAGTAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1067533654 10:47092612-47092634 CATCAGAGGGCCACTGAGGGAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1071354885 10:84784308-84784330 GATCACAGGGCTATTGGGGCTGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073043729 10:100624035-100624057 AAACAGAGGGCTTCTGGGGCTGG - Intergenic
1073540756 10:104314938-104314960 CCTCAGAGGGCTCCCTGGGAAGG + Exonic
1076838449 10:133032866-133032888 CAGCAGAGGGTTCCCTGGGCTGG - Intergenic
1076891701 10:133287980-133288002 CTTCACTTGGCTACCGGGGCCGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1084325111 11:68395767-68395789 CATCCGAGGTGTCCCGGGGCAGG - Intronic
1084328402 11:68415050-68415072 CGTCAGCGGGCTACAGTGGCTGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088334019 11:108683509-108683531 CATCTGAGAGCTACCAAGGCAGG - Intronic
1090393256 11:126403093-126403115 CATTCCAGGGCTTCCGGGGCTGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091233979 11:134007424-134007446 CATCTGAAGGTGACCGGGGCTGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101431984 12:104634438-104634460 CACCACAGGGCTGCCGGGCCTGG + Intronic
1104652695 12:130548035-130548057 CACCAGAGGGTGACCAGGGCAGG - Intronic
1106133461 13:26958140-26958162 CAGCAGAGGGCTCCATGGGCAGG + Intergenic
1112586103 13:100720388-100720410 CAGCAGATGGCTTCCTGGGCTGG - Intergenic
1112657737 13:101470090-101470112 CATCAGATGGCAACAGGAGCTGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1119387360 14:74266004-74266026 CAGCAGAGAGCTACAGGGGCAGG + Intergenic
1119646248 14:76350644-76350666 CATCAGAGGGCTTCAGGCTCTGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123683001 15:22775916-22775938 CATCAGAGGGGACCTGGGGCTGG + Intronic
1124334751 15:28848440-28848462 CATCAGAGGGGACCTGGGGCTGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129064833 15:72893416-72893438 GGTCAGAGGGCTACAGGGGCAGG - Intergenic
1130783676 15:87072520-87072542 CATCAGACTGCAACAGGGGCTGG - Intergenic
1132357797 15:101185567-101185589 CATGGGAGGGCTACCTGGGAAGG - Intronic
1134041872 16:11075300-11075322 CACCAGAGGGCTTCCAGGGAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1142691310 17:1607493-1607515 CATCAGAGGCCTCAGGGGGCAGG + Intronic
1142709100 17:1714097-1714119 TCTCAGAGGTCTACTGGGGCAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146731061 17:35194202-35194224 CATCAGAGGGCTGGCAGCGCTGG + Exonic
1147327084 17:39674802-39674824 GTTCAGAGGGCTCCAGGGGCAGG - Intronic
1147555831 17:41478534-41478556 CTTCAGAGAGCTACAGAGGCCGG + Intronic
1151935091 17:77256611-77256633 CTTCAGAAGGCTCCAGGGGCAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152383033 17:79952063-79952085 CATCTAAGGGCAGCCGGGGCTGG - Intronic
1152509442 17:80775532-80775554 CATCAGTGGGAAACCAGGGCTGG - Intronic
1154115440 18:11609679-11609701 CATCAGAGGGCTGGCAGCGCTGG - Intergenic
1157550143 18:48575719-48575741 CATCAAAAGGCATCCGGGGCAGG - Intronic
1160431440 18:78815711-78815733 CATCAGAGGGCTGCCTGGGATGG - Intergenic
1160789788 19:918103-918125 GCTCAGAGAGCCACCGGGGCAGG - Intronic
1160803341 19:980277-980299 AAGCAGAGGGCTACCAGAGCCGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164148926 19:22532286-22532308 CATCAGAGGGATTCTGGGGCTGG + Intronic
1164155842 19:22596449-22596471 CATCAGACGGCACCTGGGGCTGG - Intergenic
1164156348 19:22599831-22599853 CATCAGAGGGCCATGGGGGGTGG + Intergenic
1164637173 19:29800071-29800093 GATCAGAGAGCCACTGGGGCTGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926114995 2:10207334-10207356 GATCAGAGGGGTTCAGGGGCTGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931930142 2:67122700-67122722 CATCAGAGAGATACCATGGCAGG + Intergenic
932317656 2:70796551-70796573 CATCAGAGGGCTGGAGAGGCAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936120249 2:109736199-109736221 CAGAAGGGGGCTACCGAGGCTGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946024456 2:216663679-216663701 AATCAGAGGGGTCCCTGGGCGGG + Intronic
946144352 2:217717783-217717805 CATCAGAGGGCTAACTGGCCTGG + Intronic
947722978 2:232380507-232380529 CATCTGAGGGATGCCAGGGCAGG - Intronic
947727328 2:232408588-232408610 CATCTGAGGGATGCCAGGGCAGG - Intronic
947991891 2:234495356-234495378 CATCAGAGGACTGCCTGGGACGG - Exonic
948459818 2:238123724-238123746 CGTCTGAGGGCCTCCGGGGCTGG + Intronic
948643687 2:239390814-239390836 GGTCAGAGGGCTACCGGGTGTGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1175543274 20:59761535-59761557 CTCAAGAGGGCTACCAGGGCAGG - Intronic
1176039459 20:63056603-63056625 CAGCAGAGGGCTGGCGGGGCTGG + Intergenic
1180625209 22:17189742-17189764 CTTCAGAGGCCTACAGGGGACGG - Intronic
1181312481 22:21952747-21952769 GATTAGAGGGCTGACGGGGCTGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183261935 22:36800754-36800776 CATTAGAGGGCCACAGGGGATGG + Exonic
1184178012 22:42800771-42800793 CCTCTGAGGGCTGCCTGGGCAGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185398305 22:50603698-50603720 CCTCTGAGGGCCTCCGGGGCGGG - Exonic
1185409305 22:50674101-50674123 CATCCGCGGACCACCGGGGCGGG - Intergenic
951232689 3:20198064-20198086 CCTGAGAGGGCTACAGGGCCTGG + Intergenic
951447307 3:22797893-22797915 GATGAGACGGCTACAGGGGCTGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961035618 3:123639538-123639560 CATCAAAGGGCTGCAGAGGCAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966933652 3:184691648-184691670 CATCTGCGGGCTGCCAGGGCTGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969763982 4:9213648-9213670 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969764591 4:9218395-9218417 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969765195 4:9223143-9223165 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969765806 4:9227887-9227909 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969766415 4:9232631-9232653 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969767030 4:9237374-9237396 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969767637 4:9242121-9242143 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969768244 4:9246870-9246892 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969768847 4:9251620-9251642 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969769452 4:9256369-9256391 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969770069 4:9261115-9261137 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969770673 4:9265863-9265885 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969771288 4:9270610-9270632 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969771656 4:9323411-9323433 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969772269 4:9328156-9328178 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969772885 4:9332902-9332924 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969773502 4:9337649-9337671 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969774117 4:9342394-9342416 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969774732 4:9347139-9347161 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969775348 4:9351884-9351906 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969775962 4:9356629-9356651 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969776573 4:9361374-9361396 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969777191 4:9366120-9366142 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972072319 4:35038009-35038031 CAGCAGAGGGCTACCTGGTGCGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972719769 4:41684458-41684480 CATCAGCTGGATACCGAGGCTGG + Exonic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979157255 4:117412020-117412042 CCTCACAGGGCTAAAGGGGCAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982477218 4:155868230-155868252 CAGAAGAGTGCTACAGGGGCAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986393602 5:7306450-7306472 CATCAGAGGGGACCTGGGGCTGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
996762301 5:126998676-126998698 CATCTGTGGGCTACCTGGGAAGG - Intronic
997625813 5:135329889-135329911 CATCAGAGGGCTTCCTTGCCAGG + Intronic
998095226 5:139392664-139392686 CATCTGAGGGGAGCCGGGGCGGG + Exonic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001458643 5:171888492-171888514 CATCAGAGGGGTTGCGGGGATGG - Intronic
1002048160 5:176553606-176553628 CCTCAGAGGGATGCCTGGGCTGG + Intronic
1002874926 6:1202297-1202319 CACCACAGGGCTTCAGGGGCAGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1006985585 6:38173448-38173470 CATCAGAGGGCTACCGGGGCAGG - Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009814206 6:68710130-68710152 CATCAGGGGGCTACAGAGGCTGG + Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1014478302 6:121902787-121902809 CATCTGAAGGTTACTGGGGCTGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021195320 7:17667853-17667875 CATCAGAAGGATAGCGGGGTGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026893045 7:73993603-73993625 CATCCAAAGGCTGCCGGGGCGGG + Intergenic
1027244749 7:76359268-76359290 CGTCCGAGGGCTGGCGGGGCGGG - Intergenic
1027654906 7:80918858-80918880 CATCAGTTTGCTACCGGGGTTGG + Exonic
1029090037 7:98040801-98040823 CATCATAGGGTTACCGTGGCTGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034531212 7:151697393-151697415 CCTCAGAGGGCTCCCGGGCTCGG - Intronic
1034550034 7:151814647-151814669 CAACAGATGGGGACCGGGGCTGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035344384 7:158188605-158188627 CATCAGGGGGCGAGCGTGGCGGG - Intronic
1036946652 8:13100588-13100610 CATCAGCGTGCCTCCGGGGCTGG + Exonic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045960395 8:107961306-107961328 CATCAGAGGGTGACCTGGGTGGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048149103 8:131876085-131876107 CATCTGAGGGCTCACGGGACTGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1060667476 9:125440574-125440596 AACCAGAGGGCTCCCGGGGGAGG + Intronic
1061545573 9:131302320-131302342 GATGAGAGGGCTCCCTGGGCTGG + Intronic
1062001982 9:134220738-134220760 CAGCAGAGGGCTCCGGGGGAAGG + Intergenic
1062183160 9:135202083-135202105 CATCAGCAGGCTCCCTGGGCAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1192342734 X:70277554-70277576 CATCAGAGGGGTTCTGGGGTGGG - Intronic
1199084749 X:143615771-143615793 CACCAGAGGGCAACAGGGGTGGG - Intergenic
1200000648 X:153058191-153058213 CTTCCCAGGGCTACCGGCGCCGG + Exonic