ID: 1006987856

View in Genome Browser
Species Human (GRCh38)
Location 6:38188677-38188699
Sequence CTTCCAAAGAGGAATTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 493}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006987856_1006987869 12 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987869 6:38188712-38188734 ATGGAATGGGATTAGAAGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 351
1006987856_1006987870 19 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987870 6:38188719-38188741 GGGATTAGAAGTGGGGTCTTTGG No data
1006987856_1006987860 -7 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987860 6:38188693-38188715 TTGGAAGCCCTAATCCCTAATGG No data
1006987856_1006987867 10 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987867 6:38188710-38188732 TAATGGAATGGGATTAGAAGTGG 0: 1
1: 0
2: 1
3: 26
4: 248
1006987856_1006987868 11 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987868 6:38188711-38188733 AATGGAATGGGATTAGAAGTGGG No data
1006987856_1006987862 -1 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987862 6:38188699-38188721 GCCCTAATCCCTAATGGAATGGG 0: 1
1: 0
2: 1
3: 9
4: 81
1006987856_1006987861 -2 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987861 6:38188698-38188720 AGCCCTAATCCCTAATGGAATGG No data
1006987856_1006987871 20 Left 1006987856 6:38188677-38188699 CCTCCCAAATTCCTCTTTGGAAG 0: 1
1: 0
2: 1
3: 60
4: 493
Right 1006987871 6:38188720-38188742 GGATTAGAAGTGGGGTCTTTGGG 0: 1
1: 0
2: 8
3: 49
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006987856 Original CRISPR CTTCCAAAGAGGAATTTGGG AGG (reversed) Intronic
900267752 1:1767816-1767838 CTTCAATGTAGGAATTTGGGGGG - Intronic
900698037 1:4024447-4024469 CTCCCAAATATGAATTTTGGGGG - Intergenic
900761421 1:4474095-4474117 CTTCCACACATGAATTTGGAAGG + Intergenic
900853099 1:5159152-5159174 CTTCAACATATGAATTTGGGAGG + Intergenic
900917022 1:5646255-5646277 CTTCCAGAGAGGAGTTTCAGGGG + Intergenic
901430496 1:9211213-9211235 CTTCAATATATGAATTTGGGGGG + Intergenic
902257590 1:15200042-15200064 CTTCAACAAAGGAATTTGGCGGG - Intronic
903698150 1:25225025-25225047 CTTCCACAGAGGAAATTGACAGG - Exonic
904404490 1:30277077-30277099 CTTCAACACAGGATTTTGGGGGG - Intergenic
904434666 1:30486596-30486618 CTTCAACATATGAATTTGGGGGG - Intergenic
904672040 1:32173228-32173250 CTTCCAAAGGGCAATTTAGTAGG + Exonic
904782016 1:32957026-32957048 CTTCCAGAATGGAATTTGGATGG - Intronic
905697469 1:39985863-39985885 CTTCAACATATGAATTTGGGGGG + Intergenic
905954169 1:41978296-41978318 CTTCAACATATGAATTTGGGGGG - Intronic
905957637 1:42012302-42012324 CTTCAACATATGAATTTGGGGGG - Intronic
907344460 1:53763095-53763117 CTTTCAATCAGGAATTTGGTTGG + Intergenic
907612196 1:55882706-55882728 CTTCCACATATGAATTTGCGGGG - Intergenic
907792096 1:57676946-57676968 CTTCAATACATGAATTTGGGAGG - Intronic
907978679 1:59459354-59459376 CTTTCAAGGAGGTATTTGGATGG + Intronic
908559735 1:65293465-65293487 CTTCAACATAGGAATTTTGGAGG + Intronic
909317686 1:74245130-74245152 CTTCCAAAAAGAAAGGTGGGGGG + Intronic
909447525 1:75764605-75764627 CTTCAACATAGGAATTTTGGAGG + Intronic
909870059 1:80728093-80728115 CTTCAAAATATGAATTTTGGGGG + Intergenic
909975406 1:82040893-82040915 CATCCAAAAAGGATTTTGTGAGG - Intergenic
911149455 1:94583216-94583238 CTTCAAAATATGAATTTGTGGGG + Intergenic
911174340 1:94804080-94804102 CTTCAACATATGAATTTGGGGGG + Intergenic
911517443 1:98884665-98884687 CTTCAACATACGAATTTGGGGGG - Intergenic
912664554 1:111567520-111567542 CTTCAATAGATGAATTTTGGGGG - Intronic
913112589 1:115669949-115669971 CTTCCACATATGAATTTGGGGGG - Intronic
913192027 1:116420930-116420952 GTTCTAAAGAGAAATCTGGGTGG - Intergenic
913677183 1:121151817-121151839 CTTCAACATATGAATTTGGGAGG - Intergenic
914029021 1:143939446-143939468 CTTCAACATATGAATTTGGGAGG - Intergenic
914160430 1:145128504-145128526 CTTCAACATATGAATTTGGGAGG + Intergenic
914398355 1:147291977-147291999 CTTCAATATATGAATTTGGGGGG + Intronic
914833410 1:151187888-151187910 CTTCCAAAAAGGATTTAAGGAGG - Intronic
915041004 1:152968227-152968249 CTTCCAAGGAGGGAATCGGGAGG + Intergenic
915212312 1:154319498-154319520 CTCCCAAGGGGGAATCTGGGTGG + Intergenic
916014656 1:160739287-160739309 CTTCCAGAGAGCAATATGGCTGG + Exonic
916300360 1:163267062-163267084 CTTCAACATATGAATTTGGGTGG - Intronic
916373809 1:164129374-164129396 TTTCAAAATATGAATTTGGGGGG + Intergenic
917063479 1:171066305-171066327 CTTTATAAGAGGAATATGGGAGG + Intergenic
917642096 1:176992858-176992880 CTTCAACATAGGAATTTGGGTGG - Intronic
917968286 1:180192130-180192152 CTTCAACATAGGAATTTGGGGGG + Intronic
918209691 1:182339888-182339910 CTTCCAAAGAGGAAGATGTATGG - Intergenic
920464486 1:206170332-206170354 CTTCAACATATGAATTTGGGAGG - Intergenic
920643056 1:207772909-207772931 CTTCCTAAAATGAATTAGGGAGG + Intronic
921314953 1:213881741-213881763 CTTCAACATATGAATTTGGGAGG - Intergenic
921410990 1:214836201-214836223 CTTTAAAATATGAATTTGGGTGG - Intergenic
921458743 1:215403927-215403949 CTTCAAAATAAGAATTTGAGGGG + Intergenic
921779341 1:219143113-219143135 CTTCCTATGAGGCAGTTGGGAGG - Intergenic
921934564 1:220785246-220785268 TTTTCAAAGAGGAATTCAGGAGG + Intergenic
922257222 1:223902912-223902934 CTTCCTTCAAGGAATTTGGGGGG - Intergenic
922325689 1:224526245-224526267 GTTTCAAATATGAATTTGGGGGG - Intronic
923560511 1:235036810-235036832 CTTCAACATATGAATTTGGGGGG - Intergenic
923623709 1:235597402-235597424 TTTCAATATAGGAATTTGGGGGG - Intronic
923941922 1:238837425-238837447 CTTCAAAGTAGCAATTTGGGGGG - Intergenic
924215717 1:241819740-241819762 CTTCCACAGTGGCATTTGAGGGG + Intergenic
924380308 1:243457025-243457047 CTTCCAAAAAGGAAAATGGGCGG + Intronic
924494325 1:244571969-244571991 CTTCAACACAAGAATTTGGGGGG + Intronic
924800507 1:247326659-247326681 CTTCAACATAGGAATTTGAGAGG - Intronic
1063087458 10:2832570-2832592 CTTCCACATAGGAATTTGCGGGG - Intergenic
1063267656 10:4472600-4472622 CTTCTACATAGGAATTTTGGGGG - Intergenic
1063624473 10:7676325-7676347 CTTCAACATAGGAATTTGGGGGG - Intergenic
1063786863 10:9394510-9394532 TTTCCACACAGGAATTTGGGAGG + Intergenic
1064314808 10:14245521-14245543 CTTCAACAGATGAGTTTGGGGGG - Intronic
1064347857 10:14548865-14548887 CTTCAACATAGGAATTTTGGGGG - Intronic
1065310848 10:24414885-24414907 CTTCTAAAGAGGCATTTAAGAGG - Intronic
1065350976 10:24795465-24795487 CTTCATCATAGGAATTTGGGAGG + Intergenic
1066413102 10:35192761-35192783 TTTCAACAGAGGAAATTGGGTGG + Intronic
1067278056 10:44851868-44851890 CTTCAACATAGGAATTTGGGGGG + Intergenic
1069631932 10:69902494-69902516 CTTCCAAAGAGGAGTTGCTGCGG - Intronic
1073032975 10:100542751-100542773 CCTCCAGGGAGGAAATTGGGAGG - Intronic
1073928702 10:108547936-108547958 CTTCCAAGGGGGAACTTGAGAGG + Intergenic
1074492695 10:113953478-113953500 GTTCCAAAAAGGAATTAAGGTGG - Intergenic
1074570032 10:114615929-114615951 CTTGCAGGGAGGAGTTTGGGTGG + Intronic
1075400890 10:122160672-122160694 CTTCAACACATGAATTTGGGAGG + Intronic
1075595051 10:123723225-123723247 CTTCTACAGAGGAATATTGGAGG - Intronic
1076065380 10:127444045-127444067 CTTCAACATAGGAATTTAGGTGG + Intronic
1076071575 10:127494182-127494204 TTTCAACATAGGAATTTGGGGGG + Intergenic
1076464614 10:130670385-130670407 CTTCAAAACATGAATTTTGGAGG - Intergenic
1076657560 10:132035171-132035193 CTTCAAAATATGAATTTTGGGGG - Intergenic
1077675182 11:4188644-4188666 CTTCAGCATAGGAATTTGGGGGG + Intergenic
1078146487 11:8725145-8725167 TTTCCACATAGGAATTTTGGGGG - Intronic
1078904668 11:15672655-15672677 CTTCAACATAGGAATTTGAGAGG - Intergenic
1079501372 11:21105045-21105067 CTTCCACATATGAATTTGGGGGG + Intronic
1079976153 11:27093903-27093925 CTTCAACATATGAATTTGGGGGG + Intronic
1080240186 11:30118738-30118760 CTTCAACATAGGAATTTTGGAGG + Intergenic
1080427029 11:32164893-32164915 CTACCAAGGAGCAGTTTGGGTGG - Intergenic
1080571710 11:33563050-33563072 CTTCAAAATAGGAATCTGGGGGG + Intronic
1080878914 11:36301229-36301251 CTTCCAAATTGGAACTTGGTAGG + Intronic
1081038981 11:38186656-38186678 CTTATACAGAGGAATTGGGGTGG + Intergenic
1081953448 11:47067412-47067434 CTTCAACATGGGAATTTGGGGGG - Intronic
1083235529 11:61348507-61348529 TTTCAACACAGGAATTTGGGGGG - Exonic
1083970086 11:66069663-66069685 ACTCTAAAGAGGCATTTGGGGGG + Intergenic
1084714423 11:70864608-70864630 CTTCAACATATGAATTTGGGGGG - Intronic
1085185837 11:74575493-74575515 CTTTGAAATATGAATTTGGGAGG + Intronic
1085292832 11:75412246-75412268 CTTCAACATAAGAATTTGGGGGG - Intronic
1086339787 11:85837186-85837208 CTTCAACATATGAATTTGGGAGG - Intergenic
1086975361 11:93126041-93126063 CTTCCACATATGAATTTGGGAGG + Intergenic
1088333302 11:108675499-108675521 CTTCAACATAGGAATTTTGGGGG + Intronic
1089575839 11:119442320-119442342 ATTCAACAGATGAATTTGGGGGG + Intergenic
1090036276 11:123252455-123252477 GCTCCAGAGAGAAATTTGGGTGG - Intergenic
1090876954 11:130798779-130798801 CTTCAACAGATGAATTTTGGGGG - Intergenic
1091039420 11:132262688-132262710 CTTCAACATAGGAATTTTGGAGG + Intronic
1091410300 12:234860-234882 CTCACAAGAAGGAATTTGGGGGG - Intronic
1091443006 12:526314-526336 CTTTCAAAGAGGAAGTTTAGTGG - Intronic
1092728945 12:11510310-11510332 CTTCCATACATGAATTTTGGGGG + Intergenic
1093465209 12:19440905-19440927 CTACAAATGAGGGATTTGGGAGG - Intronic
1093596542 12:20969048-20969070 CTCCCAAAAAGGAGTCTGGGAGG + Intergenic
1093881006 12:24404783-24404805 CTTCAACATATGAATTTGGGGGG - Intergenic
1093995874 12:25642220-25642242 CTTCAACAGATGAATTTTGGGGG - Intronic
1095348648 12:41183573-41183595 CTTCCAATGACGATTTTGAGTGG - Intergenic
1095384105 12:41630083-41630105 CTTCCACATATGAATTTGGGAGG - Intergenic
1098704916 12:73675011-73675033 CTCACAAAAATGAATTTGGGAGG - Intergenic
1099661702 12:85571927-85571949 CTTCAATATATGAATTTGGGCGG - Intergenic
1099948325 12:89271246-89271268 CTTCAACATAGGAATTTTGGGGG - Intergenic
1099971493 12:89504558-89504580 CTTGCAGAGAGGGATTTGGCAGG - Intronic
1100365064 12:93912786-93912808 CTTCAATATATGAATTTGGGGGG - Intergenic
1100792824 12:98149323-98149345 CTTCAACATATGAATTTGGGGGG + Intergenic
1101235623 12:102786720-102786742 GGTCCTAAGGGGAATTTGGGTGG - Intergenic
1101558252 12:105831094-105831116 CTCCAAAATAGGAATTTTGGAGG - Intergenic
1102476041 12:113189175-113189197 CTTCAACATATGAATTTGGGTGG + Intronic
1102702025 12:114847694-114847716 TTTCCAAACAGGAGTTGGGGGGG + Intergenic
1103978837 12:124722570-124722592 CTTCAACAAAGGAATTTTGGAGG + Intergenic
1105449571 13:20486944-20486966 CTGTTAAAGAGTAATTTGGGGGG - Intronic
1105560136 13:21482700-21482722 CTTCAATATACGAATTTGGGGGG + Intergenic
1106229156 13:27808431-27808453 CTTCAACATATGAATTTGGGCGG - Intergenic
1106953646 13:34912034-34912056 CTTCAACATATGAATTTGGGTGG + Intergenic
1107084626 13:36413320-36413342 CTTCAACACAGGAATTTGGGAGG - Intergenic
1107193746 13:37622290-37622312 CTTCCAAGGAAGTATTTGAGTGG + Intergenic
1107962579 13:45571621-45571643 CTTCAACATATGAATTTGGGTGG - Intronic
1108014592 13:46061389-46061411 CTTCAACATAGGAATTTGGGAGG - Intronic
1108702427 13:52955061-52955083 CTCCCACAGAGCAACTTGGGGGG + Intergenic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1108823376 13:54380935-54380957 CATGCAAATGGGAATTTGGGGGG + Intergenic
1110727322 13:78840159-78840181 CTTCAACATAGGAATTTGGGGGG + Intergenic
1111487328 13:88920595-88920617 TTTCAACAGAGGAATTTGGGAGG + Intergenic
1111551812 13:89822337-89822359 CTTGCAAAGAGGAAAATGTGAGG + Intergenic
1111632742 13:90863443-90863465 CTTTTAAAGTGGATTTTGGGAGG - Intergenic
1111812180 13:93104852-93104874 TTTCCACATAGGAATTTTGGAGG - Intergenic
1111832958 13:93353141-93353163 CTACCAAAGAGGAAACTGAGGGG + Intronic
1111982384 13:95030468-95030490 CTTCAACATAGGAATTTAGGGGG - Intronic
1112108854 13:96272446-96272468 ATTCTAAACAGGAATTGGGGAGG - Intronic
1112236167 13:97639246-97639268 CTTCAACACATGAATTTGGGAGG + Intergenic
1112483896 13:99802291-99802313 CTTCCATGTAAGAATTTGGGGGG + Intronic
1112683603 13:101796488-101796510 CTTCAATATATGAATTTGGGGGG - Intronic
1112775864 13:102843597-102843619 CTTCCACAGATGAATTTTGGAGG + Intronic
1113004700 13:105687043-105687065 CTTCCCGAGAGGAATTTTAGTGG - Intergenic
1113168114 13:107466350-107466372 TTTCAAAATAGGAATTTTGGAGG + Intronic
1113601720 13:111574092-111574114 TAACCAAAGAGGAATTAGGGAGG + Intergenic
1117250476 14:53931944-53931966 CTTCAACATATGAATTTGGGGGG + Intergenic
1117670776 14:58103315-58103337 TTTCCAAACATGAATTTTGGAGG - Intronic
1118845655 14:69546129-69546151 CTTCAACATAGGAATTTGGAGGG + Intergenic
1119469689 14:74887657-74887679 CTACCCAAGAGGCATTCGGGGGG - Intronic
1120044970 14:79795418-79795440 CTCCCACAGAGAAATGTGGGAGG - Intronic
1121081222 14:91109806-91109828 CTTCAACACAGGAATTTGGAGGG + Intronic
1121566249 14:94911939-94911961 CTTCAACATATGAATTTGGGAGG + Intergenic
1122281594 14:100626086-100626108 CTTCAAAATATGAACTTGGGGGG + Intergenic
1122281851 14:100628212-100628234 CTTCAACATATGAATTTGGGGGG + Intergenic
1122958071 14:105081541-105081563 TTTAAAAAGAGGAAGTTGGGAGG - Intergenic
1124080687 15:26492107-26492129 CTTCAACATATGAATTTGGGGGG - Intergenic
1124440442 15:29681919-29681941 CTTCAACATATGAATTTGGGGGG + Intergenic
1125049463 15:35279816-35279838 CTTCAACATATGAATTTGGGGGG - Intronic
1125768235 15:42149164-42149186 CTTCAACACAGGAATTTGGAGGG - Intronic
1126070114 15:44858791-44858813 CTTGCAGAGAGGAAAATGGGTGG + Intergenic
1126087919 15:45026302-45026324 CTTGCAGAGAGGAAAATGGGTGG - Intronic
1126402915 15:48292850-48292872 CTTCGACACATGAATTTGGGTGG + Intronic
1126675546 15:51156922-51156944 CTTCAACATATGAATTTGGGGGG - Intergenic
1127647105 15:60969835-60969857 CTTCCAAATATAAATTTGGAAGG - Intronic
1128540564 15:68526852-68526874 CTTCAACATAGGAATTTTGGGGG - Intergenic
1130101682 15:80899415-80899437 CTATCAAAGTGGAATATGGGAGG + Intronic
1130309271 15:82738768-82738790 CTTCGACACATGAATTTGGGGGG + Intergenic
1130386581 15:83417313-83417335 CTTCAACATATGAATTTGGGGGG + Intergenic
1130394104 15:83487040-83487062 CTTCAACAAATGAATTTGGGAGG + Intronic
1130628227 15:85538315-85538337 CCCTCAAAGAGAAATTTGGGTGG + Intronic
1131680952 15:94722768-94722790 CTTCAACAGATGAATTTTGGGGG - Intergenic
1132331444 15:101014844-101014866 CTTCGACACAGGAATGTGGGGGG + Intronic
1132601734 16:775855-775877 CTTCCCAAGTGGACTCTGGGTGG + Intronic
1132736625 16:1389210-1389232 CTTCCACGTAGGAATTTGGGGGG - Intronic
1133632722 16:7636994-7637016 CTTCCACATATGAATTTGAGTGG + Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134332961 16:13267029-13267051 CTGAAAAAGAGGACTTTGGGTGG + Intergenic
1134430002 16:14194495-14194517 CTTCCATGTAGGAATTTGAGAGG + Intronic
1135677581 16:24430218-24430240 CTTCAAAAAAGGAATTTTGAGGG - Intergenic
1137366477 16:47863899-47863921 CTTCAACAGATGAATTTGGGGGG - Intergenic
1137521977 16:49202269-49202291 CTTCAACAGAGGAATTTTGTAGG - Intergenic
1137668103 16:50263408-50263430 CTTCCAAGGAGAAAGCTGGGCGG + Intronic
1138088191 16:54153102-54153124 CTTCCATATAGGAATGTGGGAGG - Intergenic
1138088442 16:54154926-54154948 CTTCAATATAGGAATTTGGGAGG - Intergenic
1139479916 16:67224871-67224893 CATTGAAAGGGGAATTTGGGAGG - Intronic
1140534955 16:75701405-75701427 CTGCCCAAGATGAATTTGGAGGG - Intronic
1140557242 16:75936039-75936061 CTTCAACACAAGAATTTGGGAGG + Intergenic
1140752754 16:78040867-78040889 CTTCAACATAGGAATTTGAGGGG + Intronic
1140831731 16:78757934-78757956 TTTCCAAATATGAGTTTGGGGGG + Intronic
1141062607 16:80887901-80887923 CTTCAACATATGAATTTGGGGGG + Intergenic
1142224396 16:88870556-88870578 CCTGCAAAGGGGACTTTGGGGGG - Intergenic
1142939420 17:3370097-3370119 CATCCAAAGAAGAATTGGGCTGG - Intergenic
1144041612 17:11416160-11416182 CTTCAACATAGGAATTTGAGAGG + Intronic
1144444085 17:15310338-15310360 CTTCAACATAGGAATTTTGGGGG - Intronic
1145923800 17:28631076-28631098 CTTCAACATATGAATTTGGGGGG - Intronic
1146892821 17:36517712-36517734 CTTCAAAATATGAATTTGAGGGG - Intronic
1147881103 17:43654082-43654104 CTTCAACATAGGAATTGGGGAGG - Intronic
1147895283 17:43746632-43746654 ATTCCATGGAGGAATTTGAGCGG + Intergenic
1149503922 17:57177306-57177328 CTTCAATATATGAATTTGGGGGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150906620 17:69345179-69345201 CACCCACATAGGAATTTGGGTGG + Intergenic
1151355261 17:73554303-73554325 CTTCAACAGATGAATTTTGGGGG - Intronic
1151621688 17:75249338-75249360 CTTCTAAAGAGGAACCTAGGCGG - Intronic
1152747396 17:82047750-82047772 CTTCCAAAGAAGAGTCTGGTGGG + Intergenic
1153090270 18:1334998-1335020 CTTCAACATAGGAATTTGTGGGG + Intergenic
1153337809 18:3942550-3942572 CTTCCTAAGACAAATTTGGTTGG - Intronic
1153637361 18:7124247-7124269 CTTCAACACATGAATTTGGGGGG + Intergenic
1155169216 18:23254856-23254878 CATCCACATACGAATTTGGGGGG + Intronic
1155860412 18:30890941-30890963 CTTCAAAAGACTCATTTGGGAGG - Intergenic
1156838295 18:41582010-41582032 CTTCAACACATGAATTTGGGAGG - Intergenic
1157541834 18:48516132-48516154 CTTCAACATATGAATTTGGGAGG - Intergenic
1157674393 18:49558283-49558305 CTTCAACATAGGAATTTGAGGGG - Intergenic
1157883104 18:51340995-51341017 CTTCAACACAGGAATTTGTGAGG - Intergenic
1157946993 18:51991521-51991543 CTTCCACAGATGAATTTGAAGGG + Intergenic
1159579016 18:70214020-70214042 CTTCAACACATGAATTTGGGAGG + Intergenic
1159808001 18:72978740-72978762 CTTCCACATATGAATTTGGGCGG + Intergenic
1160001508 18:75028512-75028534 CTTCAACACAGGAATTTGAGGGG + Intronic
1160267324 18:77350756-77350778 CTTCATAAAATGAATTTGGGAGG + Intergenic
1161259886 19:3331966-3331988 CTTCAACATATGAATTTGGGGGG + Intergenic
1164834075 19:31345996-31346018 CTGCCAAAGAGAAACCTGGGCGG - Intronic
1164954829 19:32373198-32373220 TTTCCACATAGGAATTTCGGGGG + Intronic
1164954852 19:32373330-32373352 TTTCCACATAGGAATTTCGGTGG + Intronic
1166621834 19:44308271-44308293 TTTCCAAAGAGGTTTTCGGGAGG + Intergenic
1166967846 19:46541034-46541056 CTTCAACACAGGAATTTGGAGGG + Intronic
1167815146 19:51873878-51873900 TTTCCTAGGAGAAATTTGGGGGG - Intronic
1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG + Intronic
925067617 2:940708-940730 CTTCAACATATGAATTTGGGGGG + Intergenic
925409929 2:3634103-3634125 CTTCAACAGAGGAATTTGGTGGG + Intronic
925708903 2:6718312-6718334 CTTGCATAGAGGAATATTGGTGG + Intergenic
925781016 2:7381997-7382019 CTTCCACATAGGAATTTTGGGGG + Intergenic
926130149 2:10297914-10297936 CTTCAACAAAGGAATTGGGGTGG + Intergenic
926297646 2:11580215-11580237 AATTCAAAGTGGAATTTGGGCGG + Intronic
926395896 2:12441922-12441944 CTTCAACATATGAATTTGGGAGG - Intergenic
926798557 2:16639059-16639081 CTTCAAAAGAATAAATTGGGAGG + Intronic
926963471 2:18385191-18385213 CTTCCACAGATGAAGTTGGTGGG - Intergenic
927364419 2:22277244-22277266 CTTCCAAGGAAGAGTTTGGTAGG - Intergenic
927401085 2:22711166-22711188 CATCCAAATAGGAAATTAGGAGG - Intergenic
928169994 2:28997645-28997667 CTTCCAAAAAGGAATTGGCAAGG + Intronic
928210023 2:29316805-29316827 CTTCCAAAAAGGATTTAAGGTGG + Intronic
929477144 2:42262514-42262536 TATCCAAAGAGCAATTTAGGAGG - Intronic
930267867 2:49220792-49220814 CTTCAAAATAGAAATTTTGGGGG + Intergenic
930438735 2:51379645-51379667 CTTCCAAGTAGGAATGTGGTAGG - Intergenic
931121971 2:59229926-59229948 CTTCAAAATATGATTTTGGGGGG + Intergenic
931603737 2:64030771-64030793 CTTCAACATATGAATTTGGGTGG + Intergenic
932125267 2:69139661-69139683 CTTGGAAAGGTGAATTTGGGTGG - Intronic
932131376 2:69190278-69190300 CTTAGCAAGAGCAATTTGGGTGG + Intronic
932533849 2:72570016-72570038 CTTCAACATAGGAATTTGCGGGG - Intronic
933207217 2:79521053-79521075 CTTTCAAATAGGAATTTGACAGG - Intronic
933843923 2:86309838-86309860 CTTCAAAATACGAATTTGGGGGG + Intronic
934972573 2:98774957-98774979 CTTCAACATAGGAATTTGGGGGG + Intergenic
935176669 2:100654884-100654906 TTTCCACACAGGAATTTGCGGGG + Intergenic
936004209 2:108867608-108867630 CTTCCAAAAAGGAATGAGGGTGG + Intronic
938810689 2:134850087-134850109 CTTCGACATATGAATTTGGGGGG - Intronic
939104356 2:137932138-137932160 TTTCAACATAGGAATTTGGGGGG + Intergenic
939956779 2:148533977-148533999 CTTCAACATAGGAATTTTGGGGG + Intergenic
940254600 2:151715418-151715440 CTTCAACATATGAATTTGGGGGG - Intronic
941150887 2:161914753-161914775 CCTCAACAGAGAAATTTGGGAGG - Intronic
941170068 2:162125454-162125476 GGTCCTAAGAGGACTTTGGGAGG - Intergenic
942073092 2:172332831-172332853 CTTCAACATATGAATTTGGGTGG - Intergenic
943592304 2:189813491-189813513 TTTCCAAAAAGGATTTTGGGAGG - Intronic
944137177 2:196412441-196412463 CTTCAACATATGAATTTGGGGGG + Intronic
944427265 2:199596162-199596184 CTTATAAAGAGGAAGATGGGAGG + Intergenic
944862117 2:203824957-203824979 CTTCAACACATGAATTTGGGAGG - Intergenic
945604535 2:211912018-211912040 TTTCTAAAGAGGTTTTTGGGAGG + Intronic
946216197 2:218185677-218185699 CTTCAAAATATGAATTTGCGGGG + Intergenic
947716007 2:232339159-232339181 CTTCCTAACAGGAACTGGGGAGG - Intronic
947735030 2:232449900-232449922 CTTCCTAACAGGAACTGGGGAGG - Intergenic
948259253 2:236590719-236590741 CTTCAAAATATGAATTTTGGGGG + Intergenic
949042528 2:241855899-241855921 CTTCCACATAGGAATCTGTGGGG - Intronic
1169684111 20:8251265-8251287 TTTCAACATAGGAATTTGGGGGG + Intronic
1169842778 20:9958310-9958332 CTTCCAAAGAAAGATTTTGGAGG + Intergenic
1171727706 20:28640820-28640842 CTTCAACATAGGAATCTGGGGGG + Intergenic
1173071491 20:39772196-39772218 TTTCCAGAGAAGAATTTTGGTGG - Intergenic
1173459780 20:43233865-43233887 CGTCAATATAGGAATTTGGGGGG - Intergenic
1174328477 20:49798619-49798641 CTTCCCATTAGGAATTTGGGTGG + Intergenic
1174557083 20:51403531-51403553 CTTCAATATAGGAATTTGGCTGG - Intronic
1175238590 20:57529495-57529517 CTTCAACATATGAATTTGGGGGG - Intergenic
1175546376 20:59780612-59780634 CTTCAACATAGGAATTTTGGGGG + Intronic
1175724902 20:61310962-61310984 CTTCAAAATAGGAATTTGACGGG + Intronic
1176314232 21:5227128-5227150 CTTCAACATAGGAATCTGGGGGG + Intergenic
1177016086 21:15789016-15789038 ATTCCAAAAAGGAAGTTGGAAGG - Intronic
1178014775 21:28331773-28331795 CTTCAACACACGAATTTGGGGGG - Intergenic
1178599886 21:33986167-33986189 CTTCAAAGGATGAATTTGGGTGG + Intergenic
1178738301 21:35172299-35172321 CTTCAAAATATGAATTTGGGAGG - Intronic
1179065490 21:38020799-38020821 CTTCAACATATGAATTTGGGGGG + Intronic
1179279403 21:39921588-39921610 CTTCCACATATTAATTTGGGTGG - Intronic
1179313000 21:40213446-40213468 CTTCCTAACAGGTATTTTGGTGG - Intronic
1179343650 21:40536237-40536259 CTTCAACATAGGAATTTAGGGGG - Intronic
1179446637 21:41436377-41436399 CTTCAACATAGGAATTTGGAGGG + Intronic
1179593649 21:42427905-42427927 CTTCGAGATAGGAATTTTGGAGG - Intronic
1180044256 21:45295889-45295911 CTTCAACACAGGAATTTTGGGGG + Intergenic
1180392045 22:12293247-12293269 CTTCAACATAGGAATCTGGGGGG + Intergenic
1180407701 22:12571509-12571531 CTTCAACATAGGAATCTGGGGGG - Intergenic
1181343316 22:22199754-22199776 CTCCCAAAGAGGCATCTGAGTGG + Intergenic
1181529698 22:23510301-23510323 CTTCAACACAAGAATTTGGGAGG - Intergenic
1183265988 22:36825809-36825831 CTTCGACACAGGAATCTGGGGGG - Intergenic
1184145008 22:42604838-42604860 CTTCAACAGAGGAATTTTGGGGG - Intronic
1184456604 22:44614398-44614420 CTTCAACATATGAATTTGGGGGG - Intergenic
1184538894 22:45106833-45106855 CTTCAACAGAGGAATTAGAGGGG - Intergenic
1184543810 22:45151301-45151323 CTTCAAAAGATGAATTTTGGGGG + Intergenic
949406125 3:3716544-3716566 CTTCCATAAATGAATTTCGGGGG + Intronic
949879125 3:8648086-8648108 CTTCCTATGTGGTATTTGGGGGG - Intronic
952717202 3:36492085-36492107 CTTCACAAGAGGAATTTAGGGGG - Intronic
952862303 3:37823348-37823370 TTTCCACTGAGGAATTTTGGTGG + Exonic
952905757 3:38138309-38138331 CTTCCACGGAGGAATCTGAGGGG - Intergenic
955351688 3:58198125-58198147 CTTCAACATAGGAATTTGGCCGG - Intronic
955859806 3:63316243-63316265 CTTCATAAAATGAATTTGGGAGG + Intronic
958058255 3:88441965-88441987 CTTTAAAAAAGTAATTTGGGAGG + Intergenic
958081771 3:88754888-88754910 CTTACAAAGAAGCTTTTGGGTGG - Intergenic
958597398 3:96245210-96245232 CTTCAACAGAGGAATTTGATAGG - Intergenic
959805416 3:110546489-110546511 CTTCAATAGATGAATTTAGGAGG + Intergenic
960056578 3:113280108-113280130 CTTCATCAGTGGAATTTGGGAGG + Intronic
960678148 3:120217570-120217592 CTTCAACATATGAATTTGGGGGG + Intronic
960960006 3:123063991-123064013 CTTCAACATATGAATTTGGGGGG + Intergenic
961007823 3:123416645-123416667 CTTCAACAGAGGAATTTTGGGGG - Intronic
961476889 3:127152601-127152623 CTTCCACATATGAATTAGGGGGG + Intergenic
961519141 3:127456739-127456761 CTGCCAGAGAGGAAGTGGGGAGG + Intergenic
961708798 3:128810731-128810753 CTTCAACACAGGAATTTTGGAGG + Intronic
962169063 3:133081482-133081504 CTTCAACATATGAATTTGGGGGG + Intronic
962240733 3:133748717-133748739 CTTCAAAAGTGGAAATGGGGAGG + Intronic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
963842528 3:150122321-150122343 TTTCCAAACAGGAATTTTGGAGG - Intergenic
963916714 3:150865618-150865640 CTTCCAAGAAGGACTTGGGGTGG - Intergenic
964141842 3:153411172-153411194 CTTCAAGAGAGGATTATGGGTGG - Intergenic
964661811 3:159128227-159128249 ATTCATAAGAGAAATTTGGGAGG + Intronic
965561925 3:170070075-170070097 CTTCAACATATGAATTTGGGGGG + Intronic
966380103 3:179336217-179336239 CTTCAACATATGAATTTGGGAGG + Intergenic
968228295 3:196989601-196989623 CTTCAACACAGGAATTTGGGAGG - Intronic
968571379 4:1343407-1343429 CTTCGACATAGGAATTTGGTAGG + Intergenic
969079787 4:4609558-4609580 CTTCAGAATAGGAATTTGTGGGG - Intergenic
969569842 4:8001845-8001867 ATTCCACAGAGGAAGTGGGGAGG - Intronic
970287925 4:14539239-14539261 CTTCAAAATATGAATTTGTGGGG - Intergenic
970347242 4:15164455-15164477 CTTCCACATAAGAATTTTGGGGG - Intergenic
970501311 4:16679993-16680015 CTTCAATACAGGAATTTGGGGGG - Intronic
970816657 4:20164028-20164050 CTTCAAAAGTGGAATTTCAGAGG + Intergenic
970845939 4:20537435-20537457 CTTCAAAATACGAATTTGAGGGG + Intronic
971056175 4:22915253-22915275 CTTCCAAAGAGGCAGTGGGATGG + Intergenic
971456469 4:26850101-26850123 CTTCAACATATGAATTTGGGAGG - Intergenic
971823095 4:31585096-31585118 TTTCAATACAGGAATTTGGGTGG + Intergenic
972011192 4:34184237-34184259 ATTCCAAAGAGGAAAATGAGTGG + Intergenic
972332668 4:38078458-38078480 CTTCAACATAGGAATTTTGGGGG - Intronic
972739495 4:41877228-41877250 CATCCGCAGAGGAATATGGGAGG - Intergenic
973755288 4:54067924-54067946 CTTCAACATATGAATTTGGGGGG - Intronic
974137078 4:57832365-57832387 CTCCCAAAGAGCAAAATGGGAGG + Intergenic
974339494 4:60596926-60596948 CTTCAAAATATGAATTTTGGCGG - Intergenic
974638240 4:64592961-64592983 CTTCCAAAGGGTAATCTGTGAGG - Intergenic
975182670 4:71364707-71364729 CTTCAACAGAAGAATTTTGGGGG + Intronic
976967093 4:91056605-91056627 TTTCCACACATGAATTTGGGTGG + Intronic
977008501 4:91603994-91604016 CTTCAACATATGAATTTGGGGGG + Intergenic
977248336 4:94660192-94660214 CTTCAAAAGTGTAATTTGGCCGG - Intronic
977927225 4:102714989-102715011 CTTCAACATATGAATTTGGGGGG + Intronic
979606305 4:122642478-122642500 CTTCCAATGAGGTATTTTAGGGG + Intergenic
981063834 4:140460137-140460159 CTTTCAAAGAGGGATTTAGATGG - Intronic
981074503 4:140577795-140577817 CTTCAACATATGAATTTGGGGGG + Intergenic
981404488 4:144352528-144352550 CTTCCTAAAAGGAATTAAGGTGG + Intergenic
981687903 4:147475516-147475538 CTTCAACATATGAATTTGGGAGG + Intergenic
981773069 4:148332824-148332846 CTTCCAAAGAGTTCTTTTGGAGG + Intronic
981938038 4:150255065-150255087 CTTTCTAAGATGAACTTGGGTGG - Intronic
982237362 4:153263972-153263994 CTTCAACATATGAATTTGGGAGG + Intronic
982392187 4:154876854-154876876 CTTCAACAGAGGAATTTGGAGGG - Intergenic
982872277 4:160596219-160596241 CTCTTAAAGAGGAATTTGGGCGG - Intergenic
983864587 4:172749603-172749625 TTTAAAAAGAGGGATTTGGGGGG - Intronic
984943665 4:184954839-184954861 CTTCAACACAGGAATTTCGGGGG + Intergenic
985362207 4:189187440-189187462 CTCCCAAATAGGATATTGGGAGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985835654 5:2270117-2270139 TTTCAAAATAGGAATTTGGTGGG + Intergenic
986000724 5:3628768-3628790 TTTCAGCAGAGGAATTTGGGGGG - Intergenic
986280825 5:6320999-6321021 CTTCAAAATATGAATTTGGGAGG + Intergenic
986961734 5:13220938-13220960 CTTCAACAAATGAATTTGGGGGG + Intergenic
987917655 5:24236141-24236163 TTTCCAAATATGAATTAGGGAGG + Intergenic
988172386 5:27675675-27675697 TTTCAAAATAGGAATTTGAGGGG - Intergenic
988503931 5:31805695-31805717 CTTCAACAGATGAATTTTGGGGG - Intronic
988614736 5:32764489-32764511 CTTCAAAAAAAGAATTTGGCCGG + Intronic
989058527 5:37387378-37387400 TTACCTAAGAGGAACTTGGGGGG + Intronic
989360831 5:40599530-40599552 CTTCAACATATGAATTTGGGGGG + Intergenic
990650984 5:57899325-57899347 CTTCAACATATGAATTTGGGGGG - Intergenic
991021198 5:61981988-61982010 CTTCAACATATGAATTTGGGGGG - Intergenic
992321322 5:75615841-75615863 CTTCAACATAGGAATTTTGGAGG + Intronic
992761984 5:79958705-79958727 TTTCAACATAGGAATTTGGGGGG - Intergenic
993751375 5:91672420-91672442 CTTCAACACATGAATTTGGGAGG - Intergenic
995831104 5:116357258-116357280 CTTCCAAAGAGGTATATTGGAGG - Intronic
996439309 5:123471761-123471783 CTTCAAGATAGGTATTTGGGGGG + Intergenic
998153365 5:139769797-139769819 CTTCCAAGGAGGACTGTGGCTGG - Intergenic
998442021 5:142170554-142170576 CTTCAACACATGAATTTGGGGGG + Intergenic
998614967 5:143730031-143730053 TTTACAAAGAGGGATTTGAGAGG - Intergenic
999254754 5:150204131-150204153 CTTGCAAAGAGGAAGATGGAGGG - Intronic
999320549 5:150612210-150612232 CTTCCAGACAGGAATCTGGTGGG + Intronic
1000354940 5:160385245-160385267 CTTCAACATATGAATTTGGGGGG + Intergenic
1001117253 5:168950062-168950084 CCTCTACAGATGAATTTGGGCGG - Intronic
1001303558 5:170555281-170555303 CTTCCAAGGAGGATCTTTGGGGG + Intronic
1001768676 5:174275904-174275926 CTTCAACATATGAATTTGGGGGG + Intergenic
1002558431 5:180062470-180062492 CTTCAACATATGAATTTGGGTGG + Intronic
1003235288 6:4289762-4289784 CTTCAACACAGAAATTTGGGGGG + Intergenic
1003539075 6:7002379-7002401 CTTCCAGGTAGGAAGTTGGGGGG + Intergenic
1003651568 6:7966071-7966093 CTTCAACACAGGAATTTTGGGGG - Intronic
1003965319 6:11247148-11247170 ATTCCAAAGAGGAATTCAGAAGG - Intronic
1005383701 6:25264216-25264238 CTTCAAAATATGAATCTGGGGGG - Intergenic
1005466008 6:26114039-26114061 CTTCAATATATGAATTTGGGGGG + Intergenic
1006585218 6:35106087-35106109 CTTCAACATATGAATTTGGGAGG - Intergenic
1006837929 6:37010448-37010470 CTTCAACACAGGAATTTGGTTGG + Intronic
1006977783 6:38119806-38119828 CTTCAAAAGAGCAATTTGTAAGG + Intronic
1006987856 6:38188677-38188699 CTTCCAAAGAGGAATTTGGGAGG - Intronic
1007920479 6:45605055-45605077 CTTCCAAAAAGAAATATGGTAGG + Intronic
1009251177 6:61301327-61301349 TATGCAAAGAGAAATTTGGGAGG - Intergenic
1009409630 6:63350997-63351019 TTTCCACATATGAATTTGGGTGG - Intergenic
1009560301 6:65232775-65232797 CTTCAACATATGAATTTGGGTGG + Intronic
1009641136 6:66337990-66338012 CTCCAAAATAGGAATTTGAGAGG + Intergenic
1009744555 6:67796611-67796633 TTTCAAAATAGGAACTTGGGGGG - Intergenic
1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG + Intergenic
1010750832 6:79614649-79614671 CTTCAACATAGGAATTTGGGAGG - Intergenic
1012376592 6:98569282-98569304 CTCACAAAGAGGTTTTTGGGGGG + Intergenic
1012412039 6:98969621-98969643 TTTCAAAAGGGTAATTTGGGAGG + Intergenic
1013095670 6:106942847-106942869 CTTCAAGATATGAATTTGGGAGG - Intergenic
1013223454 6:108101054-108101076 CTTCAATATATGAATTTGGGAGG - Intronic
1013665765 6:112346705-112346727 CTTCCAAAAAAGGATTTGGAGGG - Intergenic
1013930411 6:115524205-115524227 CTTCCACATATGAATTTTGGGGG - Intergenic
1013961633 6:115907848-115907870 CTTCTACATATGAATTTGGGGGG + Intergenic
1015275595 6:131380633-131380655 CTTCAAGACATGAATTTGGGTGG - Intergenic
1015921079 6:138266907-138266929 CTTCCAAAGAACAACTTGAGAGG - Intronic
1016002701 6:139058328-139058350 CCTCCAAAGAGAAATATAGGAGG - Intergenic
1016859706 6:148705494-148705516 CTTCAAAACATGAATTTTGGGGG - Intergenic
1017270841 6:152503237-152503259 CTTCTAAAGTGAAATTTGTGGGG - Intronic
1017870941 6:158486149-158486171 CTTCCCAATATGAATTTTGGGGG - Intronic
1018758067 6:166866744-166866766 CCTCCACACAGGAATCTGGGAGG - Intronic
1019951135 7:4373627-4373649 CTTCAACATAGGAATTTGAGTGG + Intergenic
1019967895 7:4514989-4515011 CTTCAACATACGAATTTGGGAGG + Intergenic
1020135814 7:5587288-5587310 TTTGCAAAGAGGGATGTGGGTGG - Intergenic
1021062436 7:16130793-16130815 CTTCAACACAGGAATTTTGGGGG - Intronic
1021432229 7:20573063-20573085 CTTCAATATATGAATTTGGGAGG + Intergenic
1021538154 7:21728115-21728137 CTTCAAGAGATGAATTTTGGAGG + Intronic
1022954141 7:35366153-35366175 CTTGCAAAGAGGACTGTGGTTGG + Intergenic
1023040294 7:36167219-36167241 CTTCAACACAGGAATTTGGGGGG + Intronic
1024202951 7:47125127-47125149 CTTGCAGAGAGGAAGGTGGGAGG - Intergenic
1024756031 7:52532482-52532504 CAGGTAAAGAGGAATTTGGGAGG - Intergenic
1026365424 7:69643778-69643800 CTTCAACATACGAATTTGGGGGG - Intronic
1027518432 7:79171461-79171483 CTTCAGCATAGGAATTTGGGAGG + Intronic
1028511983 7:91635258-91635280 CTTCCACACACAAATTTGGGGGG - Intergenic
1029237456 7:99132819-99132841 CTGCCAGAGAGGAATATGGCAGG + Intronic
1029632655 7:101762790-101762812 CTCCCAAATAGAAATTGGGGGGG + Intergenic
1029746963 7:102521356-102521378 CCCCCAGAGAGGACTTTGGGAGG + Intergenic
1029764916 7:102620445-102620467 CCCCCAGAGAGGACTTTGGGAGG + Intronic
1030641440 7:112010963-112010985 TTTCCAAAGAAGGATCTGGGAGG - Intronic
1030688769 7:112511819-112511841 CTTCAACACATGAATTTGGGAGG + Intergenic
1030980431 7:116179690-116179712 CTTCAATATATGAATTTGGGGGG + Intergenic
1031136355 7:117888461-117888483 TATCCAAAGAGGAATTGGGTTGG - Intergenic
1031411465 7:121444672-121444694 ATTCCAAAGTGGATTTTGGGGGG + Intergenic
1031441943 7:121805423-121805445 TTTCAACAGAGGAATTTTGGAGG - Intergenic
1031682605 7:124692803-124692825 CTTACCAAGAGGAATTTGGATGG + Intergenic
1031908403 7:127487396-127487418 CTTCAACAGAGGAATTTTGTGGG - Intergenic
1032140664 7:129327097-129327119 CTTCAACATATGAATTTGGGAGG - Intronic
1032851484 7:135799145-135799167 CTCTCAAAGAGGAATTTTGGTGG + Intergenic
1034149620 7:148904153-148904175 TTTCCAACAAGGAATTTTGGGGG + Intergenic
1034189588 7:149203711-149203733 CTTCAAAAGAGGAATTAAGGAGG - Intronic
1034697837 7:153069716-153069738 TTCCCAAAGAGGAATCTGGGTGG + Intergenic
1035600968 8:896515-896537 CTTCAACATAGGAATTTGGGGGG - Intergenic
1036107850 8:5860704-5860726 CTTTCAAAGAGGCATATTGGGGG + Intergenic
1036112671 8:5921341-5921363 TATAGAAAGAGGAATTTGGGAGG + Intergenic
1036484574 8:9167581-9167603 CTTCCACATATGAATTTTGGGGG + Intronic
1036511127 8:9401333-9401355 CTTCAACATATGAATTTGGGGGG + Intergenic
1036608657 8:10330870-10330892 CTTCAACATATGAATTTGGGGGG - Intronic
1037610299 8:20470383-20470405 CTTCAACATATGAATTTGGGAGG + Intergenic
1037737980 8:21582049-21582071 CTTCAACGCAGGAATTTGGGAGG - Intergenic
1038165547 8:25081900-25081922 CTTCAACATACGAATTTGGGGGG + Intergenic
1038178586 8:25204906-25204928 CTTCAACATAGGAATTTGTGAGG - Intronic
1038285097 8:26199304-26199326 ATTCAACATAGGAATTTGGGAGG + Intergenic
1038373747 8:27017010-27017032 CTTCAACATATGAATTTGGGGGG + Intergenic
1038421235 8:27435368-27435390 CTTCAACAAAGGAATTTGGGAGG + Intronic
1039105871 8:33988843-33988865 CTTCCACACAGGAATTTTGCAGG + Intergenic
1039722949 8:40184543-40184565 ATTTCAAATAGGAATTTTGGAGG - Intergenic
1040851949 8:51909975-51909997 CTTCAACAAATGAATTTGGGTGG + Intergenic
1040946595 8:52891690-52891712 CTTCAACATAGGAATTTGGGGGG - Intergenic
1041343428 8:56870422-56870444 CTTCAACATATGAATTTGGGGGG - Intergenic
1041428292 8:57748475-57748497 CTTCCGAAGAGGAGTTTTGATGG + Intergenic
1041767260 8:61432319-61432341 CTTCAACAGACGAATTTGGGGGG - Intronic
1042172766 8:66008533-66008555 CTTCCACATATGAATTTTGGGGG - Intergenic
1042454272 8:68982419-68982441 CTTCCATATATGAATTTTGGAGG - Intergenic
1042455850 8:69001647-69001669 CTTCCATATAGGAATTTGGGGGG + Intergenic
1042531312 8:69819008-69819030 CTTCCAAAAAGGATTTTTTGTGG + Intronic
1042703960 8:71647115-71647137 CTTCAAAATATGAATTTTGGGGG + Intergenic
1044517585 8:93157054-93157076 GTTCCAAATAGGAAATGGGGTGG + Intronic
1045498081 8:102725325-102725347 CTTCAACATATGAATTTGGGAGG + Intergenic
1045627978 8:104078608-104078630 CTTCAGTATAGGAATTTGGGAGG + Intronic
1045739076 8:105333063-105333085 TTTCCAAATTGGAATTTGGTAGG - Intronic
1045750795 8:105481604-105481626 CTTCCACATAGGAATTTCGGAGG + Intronic
1045842741 8:106598501-106598523 CTTCCACAGAGGAAGCAGGGAGG - Intronic
1047780357 8:128106106-128106128 CTACCAAACAGGAATGTCGGTGG - Intergenic
1048060924 8:130918431-130918453 CTTCAACACAGGAATTTGAGGGG + Intronic
1048561082 8:135538191-135538213 TTTCCAAAGGGGCTTTTGGGTGG + Intronic
1048917993 8:139202720-139202742 CTCCAAAACAGGAATTTAGGTGG - Intergenic
1049966872 9:787784-787806 CTTCAACATAGGAATTTTGGTGG + Intergenic
1050168369 9:2790037-2790059 CTGCCATAGAAGAATTTGAGAGG + Intronic
1050983373 9:12049462-12049484 TTTCAAAATATGAATTTGGGAGG + Intergenic
1051202403 9:14642462-14642484 CTTCAACATAGGAATTTTGGGGG - Intronic
1051675447 9:19553960-19553982 CTTCAACATATGAATTTGGGTGG - Intronic
1052516386 9:29485999-29486021 CTTCCATATATGAATTTTGGGGG + Intergenic
1052761430 9:32596222-32596244 CTTCCAGAGAGGAAGTTCTGTGG - Intergenic
1053483773 9:38436698-38436720 CTTCAACACAGGAATTCGGGAGG - Intergenic
1053722030 9:40956256-40956278 CTTCAACATAGGAATCTGGGGGG - Intergenic
1054343940 9:63895717-63895739 CTTCAACATAGGAATCTGGGGGG + Intergenic
1055109752 9:72548101-72548123 CTTCAACACAGGAATTTTGGGGG + Intronic
1055176994 9:73331782-73331804 CTTCCACATACGAATTTTGGGGG + Intergenic
1055645783 9:78360079-78360101 CTTCAACAGATGAATTTTGGGGG + Intergenic
1056178598 9:84060274-84060296 CTTCAGCATAGGAATTTGGGTGG - Intergenic
1056219313 9:84435636-84435658 TTTCAACATAGGAATTTGGGGGG + Intergenic
1056274183 9:84976432-84976454 CTTCAACATAGGAATTTGGCGGG + Intronic
1057014429 9:91638837-91638859 TTTCAACATAGGAATTTGGGAGG - Intronic
1057669133 9:97073300-97073322 CCTCTAAAGAGAAACTTGGGTGG + Intergenic
1057707067 9:97402423-97402445 TTTCAAAACAGGAATCTGGGGGG + Intergenic
1058414811 9:104776398-104776420 CTTCAACATAGGAATTTTGGGGG - Intronic
1058724799 9:107792266-107792288 CTTCAACATATGAATTTGGGAGG - Intergenic
1059331706 9:113539649-113539671 TTCCCAGAGAGGCATTTGGGTGG - Intronic
1060492030 9:124092160-124092182 CTTCCACATACGAATTTGGGGGG - Intergenic
1060664454 9:125424404-125424426 CTTCAACAGATGAATTTGTGGGG - Intergenic
1060927275 9:127463694-127463716 TTTCCACATAGGAACTTGGGAGG + Intronic
1061071031 9:128310883-128310905 CTACCTAAGAGGAATTCCGGAGG + Exonic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1061254528 9:129446676-129446698 CTTCAACATATGAATTTGGGTGG + Intergenic
1062617457 9:137404219-137404241 CTTCAACATGGGAATTTGGGGGG + Intronic
1203453138 Un_GL000219v1:139703-139725 CTTCAACATAGGAATCTGGGGGG + Intergenic
1185470396 X:378151-378173 CTTCAGAGTAGGAATTTGGGGGG - Intronic
1185800727 X:3008035-3008057 CTTCAGCACAGGAATTTGGGAGG + Intronic
1185942651 X:4338846-4338868 CTTCCACAGATGAATGTGGCTGG - Intergenic
1186632606 X:11366145-11366167 CTTCAACATAGGAATTTTGGTGG + Intronic
1186666472 X:11722115-11722137 CTTCAACATACGAATTTGGGGGG - Intergenic
1187036756 X:15548746-15548768 CTTCCAAAGAGAAAGTTATGAGG + Intronic
1187053167 X:15714339-15714361 CTTCAACATATGAATTTGGGAGG + Intronic
1187178148 X:16915638-16915660 TTTCAAGATAGGAATTTGGGAGG - Intergenic
1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG + Intergenic
1187417065 X:19102678-19102700 CTTCAAAATATGAATTTGGCAGG - Intronic
1187577524 X:20574183-20574205 CTTCCAAAGAGAAATTCTAGGGG + Intergenic
1188138381 X:26518072-26518094 TTTCAAAATATGAATTTGGGAGG + Intergenic
1189356302 X:40312449-40312471 CTTCAACACATGAATTTGGGAGG - Intergenic
1189850863 X:45174840-45174862 CCTCCAAAGAGATTTTTGGGGGG - Intronic
1190089992 X:47429223-47429245 CTTCAACATATGAATTTGGGAGG + Intergenic
1191572953 X:62656316-62656338 CCTACAAAGAGGTATTTGAGAGG + Intergenic
1192246688 X:69378921-69378943 TGCCCAAAGAGGGATTTGGGAGG - Intergenic
1194455458 X:94097850-94097872 CTTCCTCAGGGGAATTTGGAAGG - Intergenic
1195425765 X:104728457-104728479 CTTCCACATATGAATTTGAGGGG - Intronic
1195656712 X:107338332-107338354 CTTCAACATATGAATTTGGGAGG - Intergenic
1196577351 X:117334937-117334959 CTTCAACATATGAATTTGGGAGG + Intergenic
1198156378 X:133965005-133965027 CTTCCTGAGAGGGATGTGGGTGG - Intronic
1198246475 X:134836744-134836766 CTTCAACACAGGAATTTGAGGGG + Intronic
1198656303 X:138917202-138917224 CTTCAACATATGAATTTGGGAGG - Intronic
1198868605 X:141152410-141152432 CTTCAACATAGGAAATTGGGGGG + Intergenic
1199465981 X:148137704-148137726 CTTCCAATGTGGAATATGGGAGG - Intergenic
1199858497 X:151779318-151779340 CTTCAACATAGGAATTTGGGCGG + Intergenic
1199935910 X:152573457-152573479 CTTCAATATAGGAATTTTGGAGG - Intergenic
1202386475 Y:24331339-24331361 CTTCCTTCAAGGAATTTGGGGGG + Intergenic
1202484311 Y:25338789-25338811 CTTCCTTCAAGGAATTTGGGGGG - Intergenic