ID: 1006990458

View in Genome Browser
Species Human (GRCh38)
Location 6:38210927-38210949
Sequence GACCCACTTGGTGTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006990458_1006990465 30 Left 1006990458 6:38210927-38210949 CCCTCCTGAACACCAAGTGGGTC 0: 1
1: 0
2: 2
3: 6
4: 120
Right 1006990465 6:38210980-38211002 TCCCCTCCCCTTCCCCATTCTGG 0: 1
1: 0
2: 7
3: 81
4: 670
1006990458_1006990462 -2 Left 1006990458 6:38210927-38210949 CCCTCCTGAACACCAAGTGGGTC 0: 1
1: 0
2: 2
3: 6
4: 120
Right 1006990462 6:38210948-38210970 TCACACACATCTGAGTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006990458 Original CRISPR GACCCACTTGGTGTTCAGGA GGG (reversed) Intronic
901720125 1:11190492-11190514 GAGTCCCTTTGTGTTCAGGAAGG + Intronic
902650227 1:17832593-17832615 GCCCCACCTGGTGTTCAGCAAGG - Intergenic
904610569 1:31723972-31723994 TTCCCACTTGGGGTTGAGGAAGG + Intergenic
905430494 1:37919260-37919282 GACCTAATAGGTGCTCAGGAAGG - Intronic
905657475 1:39694111-39694133 GGCCCCCTTGCAGTTCAGGAGGG - Intronic
906143395 1:43546485-43546507 GACCCACATGGTTGGCAGGAAGG + Intronic
911582064 1:99645424-99645446 GACACTCTTGGCTTTCAGGAAGG - Intergenic
912309620 1:108607221-108607243 CAGCCACCTGGTGTCCAGGAGGG - Intronic
916483664 1:165237486-165237508 GATCCAGATGGTGTTCAAGATGG - Intronic
923048268 1:230371311-230371333 GACCCAGTTGCTGGGCAGGAGGG + Intronic
924423503 1:243931004-243931026 GACTCACTGGCTGCTCAGGATGG - Intergenic
1063126045 10:3137525-3137547 AACCCACTTGCTTCTCAGGACGG + Intronic
1063685115 10:8229537-8229559 GACACACATGGTGGTCATGAAGG + Intergenic
1063733986 10:8731742-8731764 ACCCAACTTTGTGTTCAGGATGG - Intergenic
1074436417 10:113438153-113438175 GACCCTCTTGGAGTCCACGAAGG + Intergenic
1075793097 10:125099505-125099527 GCTCCAGTTGGAGTTCAGGATGG - Intronic
1076270504 10:129148556-129148578 GACCGAGTGGGTATTCAGGAGGG - Intergenic
1078783600 11:14464134-14464156 GATACACTTGGAGTTCAGAATGG - Intronic
1083682587 11:64358309-64358331 GGCCCCATTGGTGGTCAGGAAGG + Intergenic
1083720978 11:64603412-64603434 GACCCCCTTGGTGAGCTGGAGGG - Intergenic
1084684994 11:70688147-70688169 GGCGCACTTGGTCTTCAGGTTGG - Intronic
1086174693 11:83876717-83876739 CACCCACTTGGTGATAAGGTAGG - Intronic
1086756306 11:90567219-90567241 GCCTGACTTGCTGTTCAGGATGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1098563555 12:71904904-71904926 GACCCACTTGATGTTAGTGATGG + Intronic
1103329936 12:120147184-120147206 GACAAACTTGGTGTCCAGCAGGG + Exonic
1103546971 12:121709097-121709119 GGCCCTCCAGGTGTTCAGGAAGG + Intergenic
1105007633 12:132731099-132731121 GTCCCGTTTGGTGTTCACGATGG + Intronic
1107697437 13:43013874-43013896 CACACACTTGGTTTCCAGGAGGG + Intergenic
1108064627 13:46564582-46564604 GATCCACTTGGACCTCAGGAAGG + Intronic
1114217394 14:20667152-20667174 CCCCCACTAGGTGTTCAGCAGGG - Intergenic
1121774901 14:96584173-96584195 GACCCACCTGCTGTTCTGGGAGG - Intergenic
1123769377 15:23513131-23513153 GGTCCACTTGGTGGTCTGGATGG + Intergenic
1124874572 15:33579905-33579927 GACCCAGTGGGTGTTCATCAGGG + Intronic
1127621631 15:60739789-60739811 GCCCCACTAGGTATTGAGGAAGG + Intronic
1129748600 15:78043262-78043284 GTCCCACTGGTTTTTCAGGATGG - Intronic
1130694553 15:86117691-86117713 GTCCCATTTGATGATCAGGAGGG - Intergenic
1132213005 15:100039495-100039517 GACCCACTGGTTGTTTAGGAAGG + Intronic
1133281275 16:4666796-4666818 TTCCCACTTGATGTTCACGAGGG + Intronic
1139047569 16:63081314-63081336 GGGCCACTTGGAGTCCAGGACGG - Intergenic
1140158455 16:72458609-72458631 GATCCCCTTGGTGTTCTGGGAGG + Intergenic
1140245730 16:73246238-73246260 GCCATGCTTGGTGTTCAGGATGG - Intergenic
1143741954 17:8960950-8960972 TAGCCACTTGATGTTCAGCATGG - Intronic
1146182434 17:30706817-30706839 GACCCACTGGGTATGGAGGAGGG - Intergenic
1148852885 17:50563185-50563207 GACCCACAAGGTGTAGAGGATGG - Intronic
1149850379 17:60030385-60030407 GAGCCACCTGGCTTTCAGGATGG + Intergenic
1149859787 17:60116139-60116161 GAGCCACCTGGCTTTCAGGATGG - Intergenic
1151843486 17:76634466-76634488 GACCCCCTTGGTGTCCACGAGGG + Intronic
1153534175 18:6083037-6083059 GACCCACTTTGTGCCCAAGATGG - Intronic
1154337667 18:13478384-13478406 AACCCAGTTGATGTTCAGAATGG - Intronic
1157041247 18:44042003-44042025 GACTTACTTGGTCTTCTGGAAGG - Intergenic
1161081903 19:2315348-2315370 ACCCCACTTGGTGGTCATGATGG + Intronic
1161135182 19:2615381-2615403 GTGCCACGTGGTGTCCAGGAAGG - Intronic
1161135599 19:2617649-2617671 GTGCCACGTGGTGTCCAGGAAGG - Intronic
1166318572 19:42002715-42002737 GTCCCACACTGTGTTCAGGAGGG - Intronic
1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG + Intronic
928015205 2:27649538-27649560 CAGGCACTAGGTGTTCAGGATGG - Intronic
931704128 2:64932900-64932922 CACCCACTTGTTATTCTGGAGGG - Intergenic
935236155 2:101139750-101139772 GACCTGCATGGTGTGCAGGAGGG - Intronic
935486611 2:103663895-103663917 TTCCCACTTGGTGCTCTGGAAGG + Intergenic
935707533 2:105870025-105870047 GACCCATGTGGTGGTCGGGAGGG + Intronic
937909691 2:127069402-127069424 GATCCCCTTGGTGGGCAGGATGG - Intronic
937986389 2:127639978-127640000 GACTCAGCTGGTGTGCAGGAGGG + Intronic
941910992 2:170764410-170764432 GAGACTCTTGGTGCTCAGGACGG + Intergenic
943521070 2:188949707-188949729 GACCCCCTTGGCGGGCAGGAGGG - Intergenic
944647706 2:201796060-201796082 GCACCACTCGGTGGTCAGGATGG - Intronic
1180825355 22:18857534-18857556 GACCCACACAGTGGTCAGGATGG - Intronic
1182882370 22:33744641-33744663 GACACACTTGGACTTCTGGATGG + Intronic
1183730526 22:39616088-39616110 GACCCTCTGGGTCTTCAGCACGG - Intronic
950988790 3:17408336-17408358 GTCTCACTTGGTCATCAGGATGG + Intronic
951245039 3:20331099-20331121 GATCCACTTGATCTTCAAGATGG - Intergenic
951788518 3:26452459-26452481 GGCCCCTTAGGTGTTCAGGAGGG + Intergenic
955953109 3:64261911-64261933 GAACCACTAGGTGTTTGGGAAGG + Intronic
961624027 3:128247028-128247050 GACCTACTTGGTGTTCTCTAGGG - Exonic
962920279 3:139944129-139944151 ATCTCACTTGGTGGTCAGGAAGG - Intronic
968609181 4:1549370-1549392 GACCCACTGGGTCTGCAGTAGGG - Intergenic
970536642 4:17036696-17036718 GACCCACTATGTGCTCAGGCTGG + Intergenic
982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG + Intergenic
987485791 5:18524299-18524321 GTCCCACTTGTTGCTCAGGCTGG + Intergenic
993464528 5:88229177-88229199 GAGCCACTTGGTGCTTGGGAGGG - Intronic
997504825 5:134408869-134408891 ACCCCACTTGATTTTCAGGATGG - Intronic
999299355 5:150481663-150481685 GAGCCACCTGGGGTTGAGGATGG + Intergenic
1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG + Intronic
1006338293 6:33432153-33432175 GACCCAAGTGGTATTCTGGAGGG - Exonic
1006926902 6:37661399-37661421 GGCCCACTTAGTGGTCAAGATGG - Intronic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1008821467 6:55636875-55636897 GACCCACCTGGAGTATAGGACGG + Intergenic
1010020982 6:71159551-71159573 AAACAACATGGTGTTCAGGAAGG - Intergenic
1014006563 6:116426040-116426062 GACCCACTTGGTCATCACCATGG - Intronic
1018916375 6:168134990-168135012 CAGCCACTTGGTGGTCAGGCAGG + Intergenic
1021800028 7:24295828-24295850 GGCCCACTTCTTGTTAAGGAAGG - Intergenic
1023348261 7:39293588-39293610 GGCCCACTTCCTGTTAAGGATGG + Intronic
1024263896 7:47592158-47592180 CACCCACATGGACTTCAGGAGGG + Intergenic
1028420950 7:90632262-90632284 GAGCCACTGGGAGTCCAGGAAGG + Intronic
1028524837 7:91772640-91772662 TAACCAGTTGGCGTTCAGGAGGG + Intronic
1030224930 7:107139573-107139595 GACCCTCTTGGTGCTCTGCAAGG + Intronic
1031802568 7:126266744-126266766 GACCTATTGGTTGTTCAGGAGGG - Intergenic
1035107314 7:156452771-156452793 GTCTCATTTGGTGTTCAGCAGGG - Intergenic
1037513185 8:19604187-19604209 GACCCCCTTGGTAATCAGGGTGG + Intronic
1044617296 8:94155499-94155521 GACCTGCTTGGTGGTGAGGATGG - Intronic
1045527197 8:102951113-102951135 GGCCCACTTGCTGTTCTGTAAGG - Intronic
1046763225 8:118042761-118042783 GTCCATCTTGGAGTTCAGGAAGG - Intronic
1047785559 8:128150940-128150962 CACCCAATTGGTTGTCAGGAAGG + Intergenic
1048405431 8:134114480-134114502 GACCCACTTTTTGTCCATGATGG - Intergenic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1051864811 9:21667765-21667787 GAACTACTTGGTGTTCAGTTTGG - Intergenic
1057273528 9:93664224-93664246 GACCCACCTGGGAGTCAGGAGGG + Intronic
1061070864 9:128309721-128309743 GTCCCACTGGGTCCTCAGGAGGG + Exonic
1061664046 9:132149946-132149968 GACCCATCTGGGTTTCAGGAGGG + Intergenic
1186856898 X:13635483-13635505 GAACCACTTTGTGATCAAGAGGG + Intergenic
1187913465 X:24131876-24131898 GACACACTTGCTCTTCAAGAGGG - Intergenic
1190343814 X:49319505-49319527 GAAGCACTTGATGTTCAGGGGGG + Intronic
1190344908 X:49329047-49329069 GAAGCACTTGATGTTCAGGGGGG + Intronic
1190346002 X:49338612-49338634 GAAGCACTTGATGTTCAGGGGGG + Intronic
1190347255 X:49529646-49529668 GAAGCACTTGATGTTCAGGGAGG + Intergenic
1190348354 X:49539202-49539224 GAAGCACTTGATGTTCAGGGAGG + Intronic
1190349455 X:49548758-49548780 GAAGCACTTGATGTTCAGGGAGG + Intronic
1190350559 X:49558310-49558332 GAAGCACTTGATGTTCAGGGAGG + Intronic
1190351661 X:49567869-49567891 GAAGCACTTGATGTTCAGGGAGG + Intronic
1190352761 X:49577418-49577440 GAAGCACTTGATGTTCAGGGAGG + Intronic
1190353862 X:49586965-49586987 GAAGCACTTGATGTTCAGGGAGG + Intronic
1190354964 X:49596488-49596510 GAAGCACTTGATGTTCAGGGAGG + Intronic
1192192035 X:68996720-68996742 AACTCACCTGGTTTTCAGGAGGG - Intergenic
1192804311 X:74495941-74495963 GATCCCCAAGGTGTTCAGGAGGG + Intronic
1197764129 X:130048500-130048522 GACCTACTTTTTGTTCAGGTAGG + Intronic
1200112988 X:153752539-153752561 GACCCATTGGTTGTTCAGGAGGG - Intergenic