ID: 1006991051

View in Genome Browser
Species Human (GRCh38)
Location 6:38215108-38215130
Sequence CTCTTTCTGATTCTATTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006991051 Original CRISPR CTCTTTCTGATTCTATTGTC AGG Intronic
900890105 1:5443475-5443497 ATCTTGTTAATTCTATTGTCTGG + Intergenic
903254965 1:22090722-22090744 CTGCTTCTGATTTTATTGTGAGG + Intronic
909309296 1:74125828-74125850 CTTTTTCTGATTCTTTTATCAGG + Intronic
909497585 1:76296115-76296137 CCCTTTCTGATTCTCTAATCAGG - Intronic
909894451 1:81049167-81049189 ATTCTTCTGATTCAATTGTCTGG - Intergenic
909994950 1:82267936-82267958 ATCTTTCTTTTTCTTTTGTCTGG + Intergenic
910273644 1:85424243-85424265 CTCTCTCTGCTTCTGTTTTCTGG + Intronic
910353253 1:86324198-86324220 CTCTCTCTGATTCTTTGCTCTGG - Intergenic
912141279 1:106731275-106731297 TTCTCTCTGATTCTATTTTTTGG - Intergenic
912531440 1:110326398-110326420 CTCTTGCTGTTTCTAGTGTCTGG - Intergenic
913433411 1:118820988-118821010 TTCTTTCTGATGCTATAGCCAGG + Intergenic
914976596 1:152370138-152370160 CTCTGTCTGATTTTAGTATCAGG - Intergenic
916603526 1:166317563-166317585 TTCCTTCTGATTCTATCTTCTGG + Intergenic
917006734 1:170423743-170423765 TTCTTTCTTCTTCTATTGTTTGG + Intergenic
918389735 1:184046375-184046397 CTCTTTTTGGTTCTGTTCTCTGG + Intergenic
918727973 1:187949846-187949868 CTATTTCAGATTATGTTGTCAGG + Intergenic
919028848 1:192212997-192213019 TTCCTTCTGCTTCTATTTTCTGG - Intergenic
922253033 1:223867379-223867401 GTCTTTCTTTTTCTATTGTTGGG + Intergenic
924159638 1:241217544-241217566 CTCTTGCTGATCCTATTATGGGG - Intronic
1063442130 10:6081336-6081358 CTATTTCTGATTCTCTTTTATGG - Intergenic
1065365481 10:24931881-24931903 CTTTTTCTGATTCTGGTATCAGG - Intronic
1066412337 10:35184675-35184697 CTGTTTCTCATTTTATTTTCTGG - Intronic
1068681018 10:59820128-59820150 CCCTTTCTGCTTCTTTGGTCAGG - Intronic
1068906552 10:62331688-62331710 CTCTTTCTGTTACTATTTGCAGG + Intergenic
1069107044 10:64395713-64395735 CACTTTATGTTTCTATTGTGAGG - Intergenic
1069202707 10:65642011-65642033 CTTTCTCTGATTGTATTGACTGG + Intergenic
1072312367 10:94168898-94168920 CACATTCTGATTCAATTTTCAGG + Intronic
1073028136 10:100503340-100503362 GAGTTTCTGATTGTATTGTCTGG - Intronic
1075739695 10:124687162-124687184 CTATTCCTGTTTCTTTTGTCTGG - Intronic
1076486965 10:130827986-130828008 CTCCCTCTGCTTCTATTTTCTGG - Intergenic
1077418687 11:2438092-2438114 CTTTTTCTGAATCTATTGAGAGG - Intergenic
1077693833 11:4375325-4375347 CTCTCTCTGACTCTGTTCTCGGG - Intergenic
1079425427 11:20337492-20337514 CTCTTGCTGATTATTTTGTCTGG + Intergenic
1079674915 11:23214947-23214969 CTCTTTAAGATTCTTTTGGCTGG - Intergenic
1079954167 11:26842164-26842186 CTTTTTCTGATTCTACTTACTGG + Intergenic
1080220462 11:29896897-29896919 CTCTTTTTTATCCTATTGTCAGG - Intergenic
1080499753 11:32859230-32859252 GTCTTTCTCATTCCATTGTCTGG - Intergenic
1080989462 11:37513162-37513184 TTGTTTCTGATTCTAATGTCAGG - Intergenic
1081267665 11:41046360-41046382 CTCTTTCTGACTCTAATTTTGGG + Intronic
1083002604 11:59308924-59308946 CAGTTTCTGATTCTCTTTTCTGG + Intergenic
1083702531 11:64489275-64489297 ATCTTTCTGATTCTAGAGCCAGG + Intergenic
1084361587 11:68671937-68671959 GTCTTTCTTTTTCTATTGTTTGG + Intergenic
1086368511 11:86132924-86132946 TTTTTTCTGAGTCTATTGTGTGG - Intergenic
1087279144 11:96191069-96191091 CTCTTTCTGCATCTATAGCCTGG - Intronic
1090551098 11:127820964-127820986 CTCTGTCTCATTCTCTTCTCAGG + Intergenic
1091894918 12:4094241-4094263 CTCTTTCTGGTTTTAATATCAGG - Intergenic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1093568409 12:20635886-20635908 CTCTTAATGGTTCTATTATCTGG + Intronic
1095313061 12:40723924-40723946 CTCTTTCTCTTTCTATTGGAAGG - Intronic
1095331097 12:40965511-40965533 CTCTTTCTGTTCCTACTATCTGG + Intronic
1095763827 12:45871636-45871658 TTCCCTCTGCTTCTATTGTCTGG + Intronic
1096312427 12:50532960-50532982 CTATTTCTGATTCATTTGACAGG + Intronic
1098610536 12:72452110-72452132 CGATTTCTGTTTCTTTTGTCAGG + Intronic
1098906316 12:76166410-76166432 GTCTCTCTTTTTCTATTGTCTGG + Intergenic
1099642429 12:85309128-85309150 TTCTTTCTGATTCTCTTGGCAGG + Intergenic
1100238966 12:92690861-92690883 CTCTTTGTGATGCTAATATCAGG + Intergenic
1101141818 12:101803076-101803098 CACTTTCTGAGTCTACTTTCTGG - Intronic
1101410162 12:104460719-104460741 CTCTCTCTGATTCTAATCTGGGG + Intronic
1102945076 12:116979697-116979719 CTCTTTCTGTTTCTCTAGTGTGG + Intronic
1106063998 13:26326312-26326334 GTCTGTATGAGTCTATTGTCAGG - Intronic
1107592627 13:41924351-41924373 CTGTTTCTGTTTCTTTTGACTGG - Intronic
1110795858 13:79637300-79637322 CTATTTCTGGTTCTCTTTTCTGG - Intergenic
1110907705 13:80913659-80913681 TTCTTTCTTCTTCTCTTGTCTGG + Intergenic
1111456353 13:88488857-88488879 CTCTTTCTGGATCTATTTTGTGG + Intergenic
1111561546 13:89955638-89955660 CTCTTTCTGATTATAATTTAAGG + Intergenic
1112152263 13:96776799-96776821 GTCTGTCTGTTTCTATTGTTTGG - Intronic
1114472318 14:22972317-22972339 CTCTTTCTTACTCTCTTCTCAGG - Exonic
1114915538 14:27259882-27259904 TTCTGTCTGATTTTATTATCAGG - Intergenic
1115124535 14:29975941-29975963 GTCTCTCTGTTTCTATTGTTTGG - Intronic
1116112877 14:40609198-40609220 GTCTTTCTTTTTCTATTGTTTGG + Intergenic
1117812593 14:59564640-59564662 CTCTCTCTGATTCATTTATCAGG + Intronic
1118133723 14:62998017-62998039 CTCTCTCTGCTTCTATTATCTGG + Intronic
1118428809 14:65693723-65693745 TTCCTTCTGTTTCTATTTTCTGG + Intronic
1118433177 14:65742874-65742896 CTCATTCTGAATCTGTTGACTGG - Exonic
1120647946 14:87096121-87096143 CTCTTTCTCATTCCATGCTCTGG - Intergenic
1121352961 14:93188325-93188347 ATCTTTCTGATTTTCTTTTCTGG + Intronic
1121788816 14:96683397-96683419 CTCTTTCTTATTCTCTGGTAGGG + Intergenic
1122002489 14:98671628-98671650 CTCTTTCTTATTACATTGTAAGG + Intergenic
1122062997 14:99149135-99149157 CTCTTTCTCCCTCTCTTGTCAGG - Intergenic
1122764828 14:104060411-104060433 TTCCTTCTGCTTCTATTTTCTGG + Intergenic
1123196307 14:106619571-106619593 CTCTTTCTTATTCTCTCGTATGG + Intergenic
1124178444 15:27449338-27449360 CTCTTGCTGATTGAATTCTCCGG - Intronic
1127013063 15:54651129-54651151 CTTTTTCTGATTTTATTATTAGG - Intergenic
1129169788 15:73800623-73800645 CTCTGGCTAATTCTTTTGTCTGG + Intergenic
1129882285 15:79015403-79015425 CTCTCTCTGATTCCAGTGTGTGG - Exonic
1131345309 15:91642180-91642202 CTCATTCTGATTTTTTTTTCTGG + Intergenic
1131806774 15:96130705-96130727 CACGTTCTGATACTACTGTCTGG - Intergenic
1132133664 15:99309998-99310020 CTCTGACTGATTCTGTTTTCTGG - Intronic
1132286216 15:100664771-100664793 CTCTTGCTGATTTTTTTTTCTGG + Intergenic
1135942802 16:26837308-26837330 ATCTTTCTGCTTCTATCTTCTGG - Intergenic
1136985199 16:35096706-35096728 CTCTTTTAGATTGTTTTGTCTGG + Intergenic
1139098829 16:63740304-63740326 GTCTCTCTGTTTCTATTTTCTGG - Intergenic
1139310340 16:66023145-66023167 CTCTTTCTCAGTCTCTTCTCTGG + Intergenic
1140297532 16:73724081-73724103 CTCCTTCCTATTCTTTTGTCTGG + Intergenic
1141326253 16:83062166-83062188 ATCTTTCTCATTTTACTGTCTGG + Intronic
1142423335 16:89987013-89987035 CTCTCTCAGATTCTAGTGGCAGG + Intergenic
1143967853 17:10769728-10769750 CTTGTCCTAATTCTATTGTCTGG + Intergenic
1145297755 17:21606518-21606540 TTTTTTTTGATGCTATTGTCTGG - Intergenic
1145352503 17:22096904-22096926 TTTTTTTTGATGCTATTGTCTGG + Intergenic
1145364932 17:22252931-22252953 CTTGTTCTGATTCAATAGTCTGG - Intergenic
1146019561 17:29265773-29265795 GTTTTTCTGATACTATTTTCAGG - Intronic
1146060397 17:29602509-29602531 CTCTTTCAGATTCTGGTGACTGG + Intronic
1148699218 17:49577934-49577956 TGCTTTCTTATTCCATTGTCTGG + Intronic
1148843103 17:50511740-50511762 CTCTTTCTGGTTCTTTGGTCTGG - Intronic
1148943001 17:51231346-51231368 CTTATTCTGACTCTATTTTCAGG + Intronic
1152002873 17:77657546-77657568 CTGTTTCTGCTTCTACTGTTAGG + Intergenic
1153825754 18:8873164-8873186 TTCTTTTTGATGCTATTGTAAGG + Intergenic
1155417572 18:25616140-25616162 ATCTTTGTGATTCTATTGCTGGG - Intergenic
1155833488 18:30547845-30547867 TTCTTCCTGATTCCTTTGTCAGG + Intergenic
1157830434 18:50852296-50852318 CTCTCCCTGATTCTATTTTTTGG + Intergenic
1157942002 18:51939475-51939497 CTCATGCTGTTTCTACTGTCTGG - Intergenic
1162160631 19:8712327-8712349 CTTTTTCTGGTTGTAGTGTCAGG + Intergenic
1164220601 19:23190131-23190153 TTATTTCTGATTCTTTTGTCTGG - Intergenic
1164456640 19:28413044-28413066 TTCATTCTGATTCAAATGTCAGG + Intergenic
1165760489 19:38318644-38318666 GTGTTACTGATTCTATTATCAGG + Intergenic
1167214005 19:48151881-48151903 CCCTTTCAGATTCTATTTTGGGG - Intronic
1167699244 19:51032688-51032710 CTCTTTCTGATTCTCTCGGCTGG + Intronic
1167963133 19:53123332-53123354 TTCTTTCTGCTTCCACTGTCTGG - Intronic
925175314 2:1779322-1779344 CTTTTTCTGAATCTACTGTGAGG - Intergenic
927234703 2:20860340-20860362 CTCTTTCTCATTCTAACATCAGG - Intergenic
927438274 2:23089042-23089064 TTCTTTTTTATTGTATTGTCAGG + Intergenic
929170122 2:38923446-38923468 CTCTATCTCATTTTATTTTCTGG + Intronic
929171395 2:38936404-38936426 CTCTTTCTGTTTCTCTTCCCAGG + Intronic
929767766 2:44863114-44863136 CTCCCTCTGATTCTATCTTCTGG - Intergenic
931459216 2:62435661-62435683 CTCTTTCTGAGTCTACTCCCTGG + Intergenic
932536199 2:72599007-72599029 ATCTTTCTGCTTCTATTTTTTGG - Intronic
932743474 2:74310832-74310854 TTCCTTCTGCTTCTATTTTCTGG + Intronic
933191801 2:79342226-79342248 CTCTTCCTGATGCTATAGGCAGG + Intronic
934214338 2:90016116-90016138 TTCTTTCTTTTTCTATTGTGTGG - Intergenic
934649050 2:96078281-96078303 TTCTCTCTGATTATATTTTCTGG + Intergenic
934842224 2:97633841-97633863 TTCTCTCTGCTTCTATTTTCTGG + Intergenic
934930842 2:98421590-98421612 TTCTTTCAGTTCCTATTGTCAGG + Intergenic
935438200 2:103059810-103059832 TTCTTTCTTTTTCTATTGTTTGG - Intergenic
935998773 2:108803353-108803375 CTCTTCCTGATTATCTTGCCAGG + Intronic
936166824 2:110128182-110128204 CTCCTTCTGTTTCTGCTGTCAGG + Intronic
937489790 2:122353854-122353876 TTCTTTCTGCTTCTATTTTTTGG - Intergenic
938128026 2:128688464-128688486 CTCTGTCTGCTTCTATTATCTGG + Intergenic
938385854 2:130866616-130866638 CTCTTTCTGCATCTATTGATTGG + Intronic
938878568 2:135560339-135560361 TTCTTTCTGAATCTTTTTTCAGG + Intronic
942710235 2:178826459-178826481 TTCTCTCTGCTTCTATTTTCTGG + Intronic
943169148 2:184373354-184373376 TTCCTTCTGCTTCTATTATCTGG - Intergenic
943181616 2:184550752-184550774 GTATTTCTGCTTCTATTTTCAGG + Intergenic
943503149 2:188717493-188717515 TTCCTTCTGCTTCTATTTTCTGG + Intergenic
944895517 2:204159916-204159938 TTCCTCCTGATTCTATTTTCAGG - Intergenic
945229476 2:207570334-207570356 CAATTTCTGTTTCTATTGTGAGG + Intronic
945324882 2:208471170-208471192 CTCTTTTTTATTGCATTGTCAGG - Intronic
945481238 2:210348101-210348123 GTCTCTCTTATTCTATTGTTTGG + Intergenic
947305809 2:228745470-228745492 ATATTTCTAATTCTATTGTGTGG + Intergenic
1169806408 20:9564003-9564025 CTCTTTGTCTTTCTATTGTAAGG - Intronic
1170337150 20:15282329-15282351 CTCTTTTTTATCGTATTGTCAGG + Intronic
1171188806 20:23143503-23143525 GTCTTTGGGATTCTATTATCTGG + Intergenic
1171966103 20:31531951-31531973 GTTTTTCTGCTTTTATTGTCAGG - Intronic
1172101568 20:32486876-32486898 CTCTTTCTGGATTTCTTGTCTGG - Intronic
1172862479 20:38065781-38065803 CTCTTTATGCTTGTTTTGTCAGG + Intronic
1173115009 20:40233021-40233043 CTCTTTCTGAGTCTGTTTCCTGG - Intergenic
1173179378 20:40791909-40791931 CTTTTTCTGATTTCATTTTCAGG + Intergenic
1175685578 20:61025689-61025711 CACCTTCTGAGTCTATTGTCTGG - Intergenic
1176889398 21:14296036-14296058 CTCTTTCTGACTCTAAGGGCAGG - Intergenic
1177613770 21:23489936-23489958 CTTTTTCAGATTCCATTGTGTGG - Intergenic
1177683086 21:24400685-24400707 TTCTTTCTGCTTCTATTTTATGG - Intergenic
1178209075 21:30507235-30507257 GTCTTTCTTTTTCTATTGTTTGG + Intergenic
1182207070 22:28639247-28639269 ATCTTTCTTATTCTTTTGGCTGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1183657307 22:39194933-39194955 TTCTATCTGTTTCCATTGTCTGG - Intergenic
1183751145 22:39721333-39721355 CACTGTCTGCTTCTATTCTCGGG + Intergenic
951050013 3:18083784-18083806 CACTTTGCAATTCTATTGTCTGG - Intronic
951234051 3:20213802-20213824 CTCTCTCTCTTTCTATTGACAGG + Intergenic
951444170 3:22757723-22757745 CTCTTTCTGATCAGATTCTCGGG - Intergenic
952176019 3:30864158-30864180 CTCTTTCTTACTCTATTTTTAGG - Intronic
953325553 3:42009640-42009662 TTCTTTCTGTATCTATTGACGGG + Intergenic
953787329 3:45921104-45921126 CTCTTTCTGGCCCTTTTGTCTGG - Exonic
953950564 3:47186436-47186458 CTGTTTCTGATTCTCATATCTGG + Intergenic
955150935 3:56366535-56366557 CTGTGTCTGATTCCATTCTCTGG + Intronic
955777477 3:62449104-62449126 TTCATTCTGATTCTATACTCTGG - Intronic
955930698 3:64054009-64054031 CTAATTCTGATTCTTTTGTTGGG + Intergenic
955982031 3:64536529-64536551 GTCTTTTTGATTCTGTTTTCAGG - Intronic
956719198 3:72103074-72103096 CACTTTCTGATGTTCTTGTCTGG + Intergenic
957499676 3:81038146-81038168 ATCTGTATGATTCTCTTGTCAGG - Intergenic
958533763 3:95368277-95368299 GTCTTTCTGGTCCTATTTTCAGG - Intergenic
959095556 3:101951523-101951545 GTCTGACTGGTTCTATTGTCTGG - Intergenic
959442947 3:106401376-106401398 CTTTTTTTGCTTCTATTGTGAGG + Intergenic
962522482 3:136210176-136210198 CTCCTTCTGATTCTCTTTTGTGG - Intergenic
963713590 3:148776720-148776742 CTCTCTCTGTTTCTCTTTTCTGG + Intergenic
964103600 3:153016537-153016559 CTATTTATGATTCTAGAGTCAGG - Intergenic
964467005 3:157005412-157005434 TTCTTTCTTATTCAATTTTCAGG - Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964851611 3:161102205-161102227 CTCTTTCTGTGTCTGTTATCTGG - Intronic
965213275 3:165824325-165824347 CTCTTTCTGCTTCTATTGAAAGG - Intronic
965392972 3:168128264-168128286 CTTTTTTTCATTCTAATGTCTGG - Intergenic
967200385 3:187067543-187067565 CACTTTCTGTTTCTCTTCTCTGG + Intronic
968876908 4:3274616-3274638 TTCTTACTGATTATTTTGTCTGG + Intergenic
969219104 4:5747957-5747979 TTCTTTCTGGTTCCATTGTCTGG - Intronic
969229548 4:5820477-5820499 CTCTTTCTTCTTGTATTGTATGG - Intronic
970012251 4:11471794-11471816 CACTGTCTCATTCTATTGTGCGG + Intergenic
970480235 4:16465332-16465354 CTCTTTCTAATTCTGTTAACTGG - Intergenic
970879014 4:20906130-20906152 CTCTTTCTCTCTCTCTTGTCGGG + Intronic
971160404 4:24127911-24127933 CTTTGTCTGATTCTATTCTCTGG - Intergenic
971388197 4:26160898-26160920 CTCTTTCTGTTTCTCTTGCCCGG + Intergenic
971573349 4:28242574-28242596 CTCTTTCTGCATCTATTGAGAGG + Intergenic
971701836 4:29986972-29986994 ATCTTCCAGATTCCATTGTCAGG - Intergenic
972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG + Intergenic
975201402 4:71594119-71594141 CTCTTTCTATTTATACTGTCTGG + Intergenic
975476426 4:74828724-74828746 GTCTCTCTGTTTCTATTGTTTGG - Intergenic
975847871 4:78543992-78544014 CTCCTGCAGATTCTATTGTTGGG + Intronic
975952907 4:79795820-79795842 CTCATTCTCATTCTAATATCTGG - Intergenic
976148997 4:82074203-82074225 CACTTTCTGATTTTATTATAAGG + Intergenic
977128467 4:93200982-93201004 TTCATTCTGATTCTATTGTGTGG + Intronic
977304150 4:95301749-95301771 ATCTTTCTTTTTCTCTTGTCAGG - Exonic
977632603 4:99260007-99260029 CTCTCTCTTTTTCTATTGTTTGG + Intergenic
977912115 4:102549061-102549083 CTCTTTCGGAGTGTATTATCAGG - Intronic
978686526 4:111451609-111451631 CTCCTTCTGACCCTATTTTCAGG + Intergenic
981114632 4:140975668-140975690 CTCTGCCTGATCCTATTTTCTGG + Intronic
981249943 4:142587795-142587817 TTCTTTCTGATTCTACTTTCTGG - Intronic
981801381 4:148661612-148661634 GTCTTCCTGCTTCTATTTTCTGG + Intergenic
982286068 4:153736543-153736565 CTCCCTCTGTTTCTATTTTCTGG + Intronic
982462167 4:155684465-155684487 CTCTTTCTGATTCTTAAGACAGG - Intronic
983032948 4:162826362-162826384 CTTTTTCTGTTGCTGTTGTCAGG + Intergenic
984517741 4:180761397-180761419 CACCTTCTGATTGTATTTTCTGG + Intergenic
986599814 5:9461511-9461533 CTCTATGCCATTCTATTGTCAGG - Intronic
986619228 5:9653490-9653512 CTGTTTGTGACCCTATTGTCAGG + Intronic
987262578 5:16218680-16218702 TTCTTTCTGCTTCGGTTGTCAGG - Intergenic
989060942 5:37411022-37411044 CTTTTTCTGATTCATTTGCCAGG - Intronic
989783396 5:45297572-45297594 CTCCTTCTGCTTCCATTTTCTGG - Intronic
989949382 5:50279710-50279732 CTCTTTCACACTCTATTTTCAGG + Intergenic
989959215 5:50390588-50390610 TTCTTTCTTTTTCTATTGTTTGG - Intergenic
990616485 5:57513552-57513574 CCTTTTCTTATTCTATTTTCTGG + Intergenic
990814009 5:59762899-59762921 CTCTTTCTCATTTTATAGTATGG + Intronic
991159928 5:63487065-63487087 ATATTTCTGACTCTATTTTCTGG + Intergenic
991540822 5:67726332-67726354 CTCTGCCTGATACTATGGTCGGG - Intergenic
992090832 5:73315012-73315034 CTCTTTCTGATTGTATTTTAAGG - Intergenic
992240202 5:74761287-74761309 GAGTTTCTGATTCTCTTGTCTGG - Intronic
992920943 5:81519605-81519627 TTCTTTCTCCTCCTATTGTCTGG + Intronic
993107724 5:83618334-83618356 CTCTTTCAGCTTATTTTGTCAGG + Intergenic
993577293 5:89618466-89618488 CTCTATCAGATTCTAATGTTTGG + Intergenic
993849401 5:92987841-92987863 CTCCCTCTGCTTCTATTTTCTGG - Intergenic
994914381 5:105955169-105955191 TTCTCTCTCATTCTATTTTCTGG + Intergenic
995265884 5:110160133-110160155 CTATATCTGCTTCTATTGTTTGG - Intergenic
996367496 5:122718649-122718671 CTCTTTCTGATTCTACTACTTGG + Intergenic
996910540 5:128652500-128652522 CTCTCTCTTTTTCTATTGTTTGG + Intronic
997742875 5:136272980-136273002 CTCTTTCTGAGTCTTTTCCCAGG + Intronic
998232955 5:140373124-140373146 CTCTTTCCCATTCTTTTGCCAGG - Intronic
998440425 5:142156369-142156391 CTATTTCAGATTTTATAGTCAGG - Intergenic
998540058 5:142972287-142972309 CTCCTTCTGATTCCCTTGCCAGG + Intronic
999565510 5:152855948-152855970 CTGGTTCTGATTATATTGCCTGG + Intergenic
999688645 5:154125770-154125792 GTCTTTCTTTTTCTATTGTTTGG - Intronic
1000174994 5:158743287-158743309 CTCTTTCTGTTCCTATTGCCTGG - Intronic
1000702780 5:164473851-164473873 CTCTTTTTCCTTCTACTGTCTGG + Intergenic
1000945241 5:167414600-167414622 CTCTATCTGATTGTTGTGTCTGG + Intronic
1001532539 5:172473822-172473844 CTATGCCTGATTCTATTCTCTGG - Intergenic
1001869286 5:175136720-175136742 CTCTCTCTCATCCTATTGTCAGG - Intergenic
1001869975 5:175144712-175144734 CTCCCTCTGTTTCTATTTTCTGG - Intergenic
1003111473 6:3255029-3255051 CGCTTTCTGATTCTCTGGACAGG + Intronic
1003927343 6:10888465-10888487 CACTTTCTGATTTTCCTGTCAGG + Intronic
1006991051 6:38215108-38215130 CTCTTTCTGATTCTATTGTCAGG + Intronic
1009688856 6:66999664-66999686 CTTTGTCTGATTTTATTATCAGG - Intergenic
1009809655 6:68644459-68644481 CTCTCTCTGTTTCTCTTTTCTGG + Intronic
1010376417 6:75176002-75176024 CTCTTTATCTTTCTATTTTCTGG - Intronic
1011694869 6:89903099-89903121 CTCTTTCTGCTTCTATCTTTTGG + Intergenic
1012125929 6:95428237-95428259 TTCTTTTCTATTCTATTGTCAGG - Intergenic
1012804964 6:103882051-103882073 CTCTTCCTGATTGTATTGAGAGG - Intergenic
1013144573 6:107375702-107375724 CTCTTTCTGGTTTTAGTCTCAGG - Intronic
1013750864 6:113404580-113404602 CTCTTTCTTACTCTATGTTCTGG - Intergenic
1013987548 6:116213795-116213817 CTCTTTCTGATCCTTTTGCAGGG - Intronic
1014589552 6:123246695-123246717 GTCCTTCTTATTCTATTGTTTGG - Intronic
1014781749 6:125572955-125572977 CTGTTTTTGAGTCTCTTGTCCGG - Intergenic
1014861865 6:126478814-126478836 CTCTTTCTTACTCTCTTATCTGG + Intergenic
1016346888 6:143123374-143123396 CTCTATCTCAATCTATTCTCAGG - Intronic
1021887300 7:25152148-25152170 CTCTTTCTGATCTTTTTTTCTGG + Intronic
1022307904 7:29166388-29166410 TTCTTTCTGATTTAAGTGTCTGG + Intronic
1022458260 7:30578636-30578658 CTCCTACTGAATCTATTGACTGG - Intergenic
1023046091 7:36211577-36211599 TTCTTTCTGATTTTTTTCTCAGG - Intronic
1023192844 7:37601340-37601362 CTCTTTCTTATGCTATGTTCTGG - Intergenic
1024032404 7:45473576-45473598 GTCCTTCTGCTTCTATTTTCTGG - Intergenic
1024108559 7:46119931-46119953 TTCTCTCTGTTTCTATTTTCTGG + Intergenic
1027869517 7:83688865-83688887 CTGTTTCTTATTCTTTTTTCTGG + Intergenic
1028138865 7:87249779-87249801 GTGGTTCTGATTCTAGTGTCTGG - Intergenic
1028240465 7:88413974-88413996 CACCTTCTGTTTCTATTGTAAGG + Intergenic
1028776731 7:94685580-94685602 CACTTTCTCATACTATTGTTGGG - Intergenic
1030622787 7:111809934-111809956 CTCTTTCTGATTCTGTTTTTTGG - Intronic
1030877514 7:114833681-114833703 CTCTTTCTTTTTCTTTTGACAGG + Intergenic
1031989327 7:128187006-128187028 CTCTTTCCCATTCTATTTTCAGG + Intergenic
1032770985 7:135055789-135055811 TTCTCTCTGTTTCTATTTTCTGG + Intronic
1033863418 7:145659066-145659088 CTCTCTCTGATTCTATTCTATGG - Intergenic
1034213801 7:149387618-149387640 ATCTTTTTTATTCTACTGTCAGG + Intergenic
1034325665 7:150229860-150229882 CTCTTTCTGTTTTTATTATCTGG + Intergenic
1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG + Intergenic
1034767536 7:153739398-153739420 CTCTTTCTGTTTTTATTATCTGG - Intergenic
1035794390 8:2340505-2340527 GTCTTTCTTTTTCTATTGTTTGG - Intergenic
1035798407 8:2381207-2381229 GTCTTTCTTTTTCTATTGTTTGG + Intergenic
1036015352 8:4777108-4777130 CTCACTGTGAATCTATTGTCTGG - Intronic
1037551266 8:19974127-19974149 ATGTGTCTGTTTCTATTGTCTGG + Intergenic
1038178678 8:25205664-25205686 CTGTTGCTGATTCAGTTGTCAGG + Intronic
1038908293 8:31932367-31932389 CTCTTTTTGACAATATTGTCGGG - Intronic
1039193586 8:35004834-35004856 CTTTTTTTGATTTTATTGTGTGG + Intergenic
1039665686 8:39524730-39524752 TTCTTTGTGATTCCCTTGTCTGG - Intergenic
1040449961 8:47535237-47535259 CTCCTTCTGCTTCTATTTTCTGG - Intronic
1040701669 8:50074034-50074056 CTCTAACTGACTCTATTGTTAGG - Intronic
1041330877 8:56723119-56723141 CTTTTTCTGAAGCTATTGTTTGG - Intergenic
1041740500 8:61152025-61152047 CTATTTCTTCTTCTATTGGCTGG + Intronic
1041748147 8:61231715-61231737 CAGTTTCAGATTCTGTTGTCTGG - Intronic
1041851582 8:62399144-62399166 CTTTTTTTGTTTCTATTATCTGG + Intronic
1045522358 8:102914285-102914307 CTCTTTCTGTTTCTAGTTTATGG + Intronic
1046050435 8:109015191-109015213 CTCTTACTGTTTCTTTTGCCAGG - Intergenic
1046612042 8:116436758-116436780 CTCTTTGTGTTTCTTTTGTTTGG - Intergenic
1047490484 8:125370201-125370223 CTCTTTTCTATTCCATTGTCAGG + Intergenic
1047494283 8:125398530-125398552 CTCTCTCTGATTCTAATTTGGGG + Intergenic
1048785876 8:138049923-138049945 CTCTAACTGATTCATTTGTCTGG + Intergenic
1049357979 8:142198196-142198218 CTCTTTCTGACTCGCTTGTTGGG + Intergenic
1050135445 9:2458729-2458751 CTCTCTCTGATCCTTTTGTGGGG + Intergenic
1050404812 9:5296630-5296652 TTCTTTCTTTTTCTATTGTTTGG - Intergenic
1050650457 9:7770321-7770343 CTCTTGCTGATTCATTTCTCTGG + Intergenic
1052168265 9:25360276-25360298 TTCTTTCTGCTTCTATCTTCTGG + Intergenic
1056255193 9:84791706-84791728 CTCTTTCTGATTGGATTTTATGG + Intronic
1059027974 9:110657648-110657670 TTCTTTTGGATTCTAGTGTCTGG + Intergenic
1059708516 9:116845887-116845909 CTCTTTAGGATTTTATTTTCAGG - Intronic
1203626242 Un_KI270750v1:27077-27099 TTTTTTTTGATGCTATTGTCTGG - Intergenic
1186149748 X:6661672-6661694 CTCTTTCTGATGCTTTTGAAAGG + Intergenic
1187878746 X:23826739-23826761 CATTTTCTGAATCTTTTGTCAGG - Intergenic
1187984570 X:24796449-24796471 TTCTTTCTGTTACTATTGGCAGG - Intronic
1189499246 X:41539980-41540002 CTATTTGTGATTCTCTAGTCAGG - Intronic
1193446624 X:81613018-81613040 CTTTTTCTGAATCTATTGTGAGG + Intergenic
1194156406 X:90394487-90394509 CTCTTTTTAATCCTATTTTCAGG + Intergenic
1194178000 X:90675714-90675736 TTCTTTCTTATTCTCTTGTGAGG - Intergenic
1194514242 X:94830176-94830198 CTCTCTCTGCTTCTATTGGCTGG - Intergenic
1195145630 X:102013470-102013492 CTTTGTCTGATTCTAATATCAGG - Intergenic
1195686324 X:107589813-107589835 GGCTTTCTGATTTTATTTTCAGG + Intronic
1199351910 X:146811305-146811327 CACTATCTGTTTCTATTTTCTGG + Intergenic
1199351997 X:146813188-146813210 CACTATCTGTTTCTATTTTCTGG - Intergenic
1199797998 X:151220701-151220723 CTATTTCTGATTTTTTTCTCGGG + Intergenic
1200215366 X:154365895-154365917 CTCTTTGAGCTTCTACTGTCTGG - Intronic
1200502753 Y:3971476-3971498 CTCTTTTTAATCCTATTTTCAGG + Intergenic
1200524667 Y:4257870-4257892 TTCTTTCTTATTCTCTTGTGAGG - Intergenic