ID: 1006991508

View in Genome Browser
Species Human (GRCh38)
Location 6:38218598-38218620
Sequence TGGACATGGGCCACACCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006991508_1006991514 -1 Left 1006991508 6:38218598-38218620 CCAGTAGGTGTGGCCCATGTCCA 0: 1
1: 1
2: 0
3: 6
4: 91
Right 1006991514 6:38218620-38218642 AGGCCCTGACTTTCCTGGTCTGG 0: 1
1: 1
2: 1
3: 20
4: 167
1006991508_1006991512 -6 Left 1006991508 6:38218598-38218620 CCAGTAGGTGTGGCCCATGTCCA 0: 1
1: 1
2: 0
3: 6
4: 91
Right 1006991512 6:38218615-38218637 TGTCCAGGCCCTGACTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006991508 Original CRISPR TGGACATGGGCCACACCTAC TGG (reversed) Intronic
900618560 1:3576604-3576626 TGGGCAGGGGCTACACCTGCAGG + Intronic
900721477 1:4178732-4178754 TGGCCATGGTCCTCACCTCCTGG + Intergenic
902818050 1:18927248-18927270 TGGAAATGGCCCACACCTTGCGG + Intronic
905377605 1:37534129-37534151 TGGAGATGGGCCGCACCTTGTGG - Intergenic
910209241 1:84776571-84776593 TGGACAGAGGCCACTCCTTCTGG + Intergenic
912712447 1:111959656-111959678 TGGTCATTGCCCACAGCTACTGG - Intronic
912877071 1:113370844-113370866 GGCTCATGGGCCCCACCTACAGG - Intergenic
920844140 1:209579358-209579380 TGGAAAGGAGCCATACCTACTGG - Intergenic
922639268 1:227210858-227210880 TGGACATGGGCTACCCCTGAAGG - Intronic
924672851 1:246147283-246147305 TGGAGAAAGGCCACACCTCCGGG + Intronic
1065865725 10:29913659-29913681 TGGGCATGAGCCACACGTCCAGG + Intergenic
1067262910 10:44709793-44709815 TGGTCATGGTCTACATCTACTGG + Intergenic
1073425937 10:103455508-103455530 TGGAGCTGGGTCACACCCACGGG - Exonic
1076102278 10:127792583-127792605 TGGACATGGGCCAAACAGAGGGG + Intergenic
1076394906 10:130131266-130131288 TGGCCATGGGCCAGACATAGTGG + Intergenic
1076713887 10:132353691-132353713 TGGCCACGGGCCACAGCTGCTGG + Intronic
1076876687 10:133219762-133219784 TGGACTTGGCTCACACCTGCGGG - Intronic
1083264619 11:61541011-61541033 TGGCCATGGGCCACTCGCACGGG + Intronic
1085017410 11:73184088-73184110 AGTACATGTGCCACACCCACTGG + Intergenic
1085320444 11:75570761-75570783 TGGACATGGGCCCCGCCCTCAGG + Intronic
1087934472 11:104016534-104016556 TGGACATGGGCCTCAGCTCGGGG - Intronic
1091393723 12:141179-141201 AGGAAATGGGCCACACCGATGGG - Exonic
1091396174 12:155402-155424 TGGCCATGGGCCCTGCCTACGGG + Intronic
1104552994 12:129774462-129774484 TGGAGATGGGCCTTACCTTCAGG - Intronic
1107630559 13:42338462-42338484 TTCACATGGGCCACCCGTACCGG - Intergenic
1108341921 13:49505292-49505314 TGGATTTGGGTCCCACCTACCGG - Intronic
1109604448 13:64674367-64674389 TGGACATGGGACCCACAGACAGG - Intergenic
1113163459 13:107410346-107410368 GAGACATGGGACACACCAACAGG - Intronic
1114210428 14:20609492-20609514 TGGGCATGGGTGACACCTAGTGG + Intronic
1117373310 14:55098422-55098444 TGGCCATGTGCCACATCTTCTGG + Intergenic
1118349176 14:64961238-64961260 TGCACATGGCCCACACATGCTGG - Intronic
1119406526 14:74402714-74402736 TGGAAAAGGGCCTCACCTAGGGG - Intergenic
1119788196 14:77328031-77328053 TGTACAAGTGCCACACCTGCAGG - Exonic
1124370635 15:29103117-29103139 TGGGGATGGGCCACAGGTACTGG + Intronic
1124891477 15:33737834-33737856 AGGACATGGATCACACCTGCTGG + Intronic
1128225248 15:65996974-65996996 TTCACATGGGCCCCACCTATCGG + Intronic
1136640985 16:31564888-31564910 TGGACATGGCTCACTCCTACTGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137343998 16:47637454-47637476 TGAATATTGCCCACACCTACTGG - Intronic
1138372180 16:56536013-56536035 TGGACATGCGACACACACACAGG + Intergenic
1144699151 17:17325451-17325473 GGGACATGGGACTCACCAACAGG - Intronic
1146518669 17:33509332-33509354 TGGACATTGGCAAAACCTATGGG + Intronic
1147677548 17:42218576-42218598 TGGGCAAGGGCCACAGCAACTGG + Intronic
1151413748 17:73948126-73948148 TGGACATGGGACAGGCTTACTGG + Intergenic
1151803078 17:76389080-76389102 TGGACAGGTGCCACAACTCCTGG - Intergenic
1154297501 18:13163210-13163232 TGCACATGGGCCACACCCTGAGG - Intergenic
1159012316 18:63069630-63069652 TGGAGAAGACCCACACCTACAGG - Intergenic
1163260240 19:16185293-16185315 TGGACCCGGGCCACACTTCCGGG - Intergenic
1167393442 19:49211596-49211618 TGGACATGGGGCTCACCTCAAGG - Exonic
1168321505 19:55513037-55513059 TGGACGTGGGACACACCATCAGG + Exonic
925359414 2:3267100-3267122 TGGACTTGGGCCACAGCTTCCGG - Intronic
927928025 2:27026544-27026566 TGGACAGGGGTCCCACCAACTGG - Exonic
929183285 2:39066865-39066887 TGGACATATGCCACTCCTAAAGG + Intronic
934711324 2:96516183-96516205 TGGACGGGGGCCCCACCAACGGG + Intergenic
1168807797 20:682895-682917 TAGCCATGGGCCACACTCACAGG - Intergenic
1168971977 20:1937471-1937493 TGGACATGGTCCACCTCAACCGG + Exonic
1169780189 20:9301349-9301371 TGGACATGTGCCTCACGTTCTGG - Intronic
1176055169 20:63141425-63141447 TGGACATGGGCCTCACCAGGAGG - Intergenic
1176171164 20:63696967-63696989 TGGACACGGGCCACACGTCGTGG - Exonic
1176423205 21:6532696-6532718 TGGAGATGAGCCCCACCTCCAGG + Intergenic
1179698698 21:43141012-43141034 TGGAGATGAGCCCCACCTCCAGG + Intergenic
1181684198 22:24517207-24517229 TGGACATGGACCAGACCTCCAGG - Intronic
949349784 3:3113604-3113626 TGGACATGGACAACTCCTAGTGG + Intronic
950668976 3:14513891-14513913 TGAACCTGGGTCACACCTCCTGG + Intronic
967937751 3:194742371-194742393 TGGGCATGGGCCCCACCCTCGGG - Intergenic
968579199 4:1381972-1381994 TGGAGAGTGGCCACACCTGCAGG + Intronic
968666422 4:1824737-1824759 GGGATATGGGCCACACACACAGG - Intronic
976379329 4:84381559-84381581 GGGACGTGGGCTACAGCTACAGG - Intergenic
977555399 4:98483190-98483212 GTGACATGGGCCACAACTGCTGG + Intronic
985532482 5:442433-442455 TGGCCATGGGCCTCTCCTCCAGG + Exonic
986724018 5:10580988-10581010 AGGACATGGGACCCACCGACTGG - Intronic
987470106 5:18317516-18317538 TGGGCATGGGAAACACCTCCAGG - Intergenic
987645473 5:20666066-20666088 TGAACATGGGGAACACTTACTGG - Intergenic
990197302 5:53333134-53333156 TGTTCATTTGCCACACCTACAGG - Intergenic
992643974 5:78795230-78795252 TGGACATTGGCCACCTCTGCTGG - Intronic
997522089 5:134529404-134529426 TGGAGATGGGGTACACCTTCTGG + Intronic
1002542005 5:179912601-179912623 TGGACCTGGGCCACACCTACTGG + Intronic
1002836653 6:870206-870228 TGGAAATGTGACACACCTTCAGG - Intergenic
1006991508 6:38218598-38218620 TGGACATGGGCCACACCTACTGG - Intronic
1016747709 6:147598803-147598825 TGCACTTGGGACACACCTTCAGG - Intronic
1017019434 6:150128425-150128447 GGGCCATGGGCCACTCCTAATGG - Intergenic
1017154337 6:151309424-151309446 TGAACAAGGGCCATTCCTACTGG + Intronic
1019364452 7:625544-625566 TGGACAAGGGGCATAACTACAGG + Intronic
1019364458 7:625572-625594 TGGACAAGGGGCACCGCTACAGG + Intronic
1019364477 7:625656-625678 TGGACAAGGGACACCACTACAGG + Intronic
1019556845 7:1636132-1636154 TGGAGCTGGGCCTCACCTCCAGG - Intergenic
1031693501 7:124819016-124819038 TGGACAGGGAGCACACATACGGG - Intergenic
1032252055 7:130266363-130266385 TTGGAATGGGCCACATCTACAGG + Intergenic
1034938015 7:155212116-155212138 TGGACAAGGTCCTCTCCTACTGG - Intergenic
1039966333 8:42286884-42286906 TGGGCAAGAGCCACACCTGCAGG - Intronic
1045646600 8:104305540-104305562 TGGACGTGGGCCACCCATACAGG + Intergenic
1049733684 8:144192180-144192202 AGGACATGGGCCCCACCTTGGGG - Intronic
1056731308 9:89168803-89168825 TGGACAAGGGCCACACAAATTGG - Intronic
1062418710 9:136467957-136467979 TGGACATGGGCCACCCCACCGGG - Intronic
1186806320 X:13143528-13143550 TGGGACAGGGCCACACCTACAGG + Intergenic
1188928200 X:36071232-36071254 TGGCCTTAGGTCACACCTACTGG + Intronic
1195656985 X:107341143-107341165 TGGACCTTGGCCACACCCAAGGG - Intergenic
1198217926 X:134573712-134573734 TGGACTTAGGCCACACCTAAGGG - Intronic
1200242235 X:154503033-154503055 GGGACAATGGCCACACTTACTGG + Intergenic