ID: 1006996594

View in Genome Browser
Species Human (GRCh38)
Location 6:38266978-38267000
Sequence GGCAGATGGCCTTGCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006996594 Original CRISPR GGCAGATGGCCTTGCTGGAG AGG (reversed) Intronic
900615065 1:3561754-3561776 GTCAGATGGCCTGGCAGGACAGG - Intronic
900732541 1:4271746-4271768 AGGAGAGGGCCCTGCTGGAGAGG + Intergenic
901691489 1:10976246-10976268 GCCAGACGGCCCTGCGGGAGAGG + Exonic
901883501 1:12207446-12207468 TGCAGAGGGGCTTTCTGGAGAGG + Exonic
902168877 1:14594802-14594824 GGCAAATGGGCTTGCAGGAGGGG + Intergenic
902514218 1:16981040-16981062 GGCAGCAGGCTTGGCTGGAGAGG - Intergenic
902536558 1:17122218-17122240 GGCAGGGGCGCTTGCTGGAGGGG - Intergenic
902802751 1:18840436-18840458 GGCAGCTGGTCTTCCTGGAATGG - Exonic
902807689 1:18871400-18871422 GGTGGATGGTCTTTCTGGAGGGG - Intronic
904011167 1:27391460-27391482 GGCAGATGGCGTTGGGGAAGAGG + Intergenic
904212375 1:28894543-28894565 GGCAACTGGACTTCCTGGAGAGG + Intronic
905307515 1:37029774-37029796 GGCAGCTTGCATTTCTGGAGTGG + Intronic
905307521 1:37029802-37029824 GGCAGCTTGCATTTCTGGAGGGG + Intronic
906201895 1:43965914-43965936 GGCAGATGGCCTGCCCCGAGTGG - Intronic
906960071 1:50414932-50414954 GGCAGAGTGCCTTGCGGAAGTGG + Intergenic
907400307 1:54221165-54221187 GAAAGGTGGACTTGCTGGAGGGG + Intronic
908705332 1:66947753-66947775 TGCAGGTGGCCTTGCTGGCCTGG - Intronic
911171623 1:94776373-94776395 GGAAGAAGGCCCTGCTGGATAGG + Intergenic
911718668 1:101165998-101166020 GGCAGATTGCCTGACTGGAGTGG - Intergenic
912529880 1:110312605-110312627 TGGAGAGGTCCTTGCTGGAGAGG + Intergenic
913569885 1:120109872-120109894 GGCAGCTGACCTTGCTGGGGAGG + Intergenic
913586421 1:120279315-120279337 AGCAGTTGGCCTGGGTGGAGTGG + Intergenic
913621765 1:120619055-120619077 AGCAGTTGGCCTGGGTGGAGTGG - Intergenic
914290694 1:146270837-146270859 AGCAGCTGACCTTGCTGGGGAGG + Intergenic
914551738 1:148721620-148721642 AGCAGCTGACCTTGCTGGGGAGG + Intergenic
914568429 1:148891177-148891199 AGCAGTTGGCCTGGGTGGAGTGG + Intronic
914604396 1:149239074-149239096 AGCAGTTGGCCTGGGTGGAGTGG - Intergenic
915121314 1:153631020-153631042 GTCAGATGGCTTTCCTGAAGAGG + Exonic
915404007 1:155645249-155645271 AGCAGACAGGCTTGCTGGAGAGG - Intergenic
919315433 1:195966460-195966482 GGAAGATGGCTCTCCTGGAGAGG - Intergenic
919753457 1:201052619-201052641 GGAAGATCGCCTTGGTGGATGGG - Exonic
919919775 1:202161011-202161033 GGGAGAGGGCCTTGAGGGAGAGG - Exonic
919919780 1:202161026-202161048 GGGAGAGGGCCTTGAGGGAGAGG - Exonic
919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG + Intronic
920228967 1:204457820-204457842 TGCAGATGGCCTTGACGGACTGG + Exonic
920266272 1:204725800-204725822 GGGAGATGGCATTGTGGGAGTGG - Intergenic
921149245 1:212386525-212386547 GGCAGAGGGCTTCTCTGGAGAGG - Intronic
922517069 1:226215429-226215451 GGAATATGGGCTTGGTGGAGAGG - Intergenic
1063141808 10:3262518-3262540 GGCAGATGTCCTGGCAGAAGTGG + Intergenic
1063620863 10:7647401-7647423 GGCAGATGGCTGCTCTGGAGGGG - Intronic
1064898118 10:20262222-20262244 GACTGAAGGCCTTGGTGGAGTGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067807598 10:49404064-49404086 GGCAGAGGGCAGTCCTGGAGAGG - Intergenic
1067947156 10:50696781-50696803 GGCAGATGCCCTTGCTGTGATGG - Intergenic
1069652400 10:70059320-70059342 GGGAGCTGTCCTGGCTGGAGTGG - Intronic
1070536185 10:77379212-77379234 GGCAGTTGTCCTTGATAGAGTGG - Intronic
1070882465 10:79861769-79861791 GGCAGATGCCCTTGCTGTGATGG - Intergenic
1071649037 10:87378080-87378102 GGCAGATGCCCTTGCTGTGATGG - Intergenic
1071917758 10:90314928-90314950 GGCAGATGACCCTTATGGAGTGG - Intergenic
1073035244 10:100560300-100560322 GGAAGACAGCCTGGCTGGAGGGG - Intergenic
1073480956 10:103785725-103785747 GGCAGAAGCCCTTGCAGGGGAGG - Intronic
1073941703 10:108706670-108706692 TACAGATGGTCTTCCTGGAGTGG + Intergenic
1075326189 10:121533963-121533985 GGCTGTTGGACTTGCAGGAGAGG - Intronic
1075516502 10:123112885-123112907 GGCTGGTGGCCGTGCTGGTGAGG + Intergenic
1075521717 10:123147589-123147611 GGCTCCTGGCCATGCTGGAGAGG + Intergenic
1076738137 10:132467856-132467878 GGCAGGTGGCCTTGGTGGACGGG - Intergenic
1077333784 11:1994536-1994558 GGCAGGTGGCCTTGGGGCAGAGG - Intergenic
1077941682 11:6849552-6849574 GGCATATTGCATGGCTGGAGCGG - Intergenic
1078582460 11:12549092-12549114 GGCAGATGGTCTTCCAGAAGGGG + Intergenic
1080434002 11:32223344-32223366 GGCAGATGACCTTCCTGTGGAGG - Intergenic
1080870470 11:36232603-36232625 GGCAGATGTCCCTGCTGCATTGG - Intergenic
1083389336 11:62336695-62336717 GGGAGAAGGCTTTGCAGGAGGGG + Intergenic
1086833858 11:91598379-91598401 GGGAGATTGCGGTGCTGGAGTGG + Intergenic
1087102670 11:94380457-94380479 TGCGGATGACCTTGCTGGACAGG + Exonic
1087219405 11:95530160-95530182 GGAAGATGCCGTTGCTTGAGTGG + Intergenic
1089493789 11:118898709-118898731 GACAGATGTCCTTGCTGGGCAGG - Exonic
1089635489 11:119808991-119809013 GGCTGAGCCCCTTGCTGGAGAGG + Intergenic
1090837255 11:130462513-130462535 GGGAGATGGGCTTGCTGGGTTGG - Exonic
1202816765 11_KI270721v1_random:49718-49740 GGCAGGTGGCCTTGGGGCAGAGG - Intergenic
1091792883 12:3281555-3281577 TGCAGCTGGCCTTGCGGGTGGGG + Intronic
1092525260 12:9305882-9305904 TGCAGTGGGCCTTGCTGGGGTGG + Intergenic
1092532235 12:9354101-9354123 GACAGCTGGCATTGCAGGAGGGG - Intergenic
1092930662 12:13312491-13312513 GACAGAAGGCCTTGCTGATGAGG - Intergenic
1094491091 12:30961162-30961184 GGAAGAGGGACTTGATGGAGTGG - Intronic
1094510996 12:31096504-31096526 TGCAGTGGGCCTTGCTGGGGTGG + Intronic
1096411960 12:51383461-51383483 GTCAGGAGGCCTTCCTGGAGGGG - Exonic
1096531992 12:52248289-52248311 GGCCCAGGGCCCTGCTGGAGGGG + Intronic
1096638286 12:52975050-52975072 GGGAGAGGGGCTTCCTGGAGGGG + Intergenic
1098157830 12:67618512-67618534 GGAAGATGGCATGACTGGAGAGG - Intergenic
1098730800 12:74035345-74035367 GGGAGATTGCGATGCTGGAGTGG + Intergenic
1100151385 12:91742178-91742200 GGCAAATGGAGGTGCTGGAGAGG + Intergenic
1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG + Exonic
1102460163 12:113095059-113095081 CGTAGATGGCCTTGCAGGTGGGG - Exonic
1102823000 12:115924072-115924094 TGCAGATGGCCGGGCTGGGGAGG - Intergenic
1106958837 13:34973983-34974005 GACTGAAGGCCCTGCTGGAGTGG + Intronic
1108589754 13:51902634-51902656 GGCAGGTGGCCTTGCTTCTGGGG - Intergenic
1110808647 13:79788729-79788751 GGCTGAAGGCCCTGGTGGAGTGG - Intergenic
1111337410 13:86840919-86840941 AGCTGATGGCCCTGCTTGAGGGG + Intergenic
1112035917 13:95496586-95496608 GGCAGATTGAGTTCCTGGAGAGG + Intronic
1112312346 13:98330162-98330184 AACAGCTGGCCTGGCTGGAGAGG + Intronic
1114527123 14:23373361-23373383 GGGAGATGGCCCTGCTGTTGAGG - Exonic
1115455078 14:33592556-33592578 GGCAGAAGGGCATCCTGGAGGGG + Intronic
1115514810 14:34174712-34174734 GGCAGGTTGCCTTGATGCAGGGG + Intronic
1116713072 14:48394122-48394144 TGCAGATGGGCCTGCTGGAATGG + Intergenic
1116932398 14:50703108-50703130 GTCAGAAGGCCCTGGTGGAGTGG + Intergenic
1117159985 14:52979819-52979841 TGCAGATGGCCCTGATGGGGAGG - Intergenic
1117491028 14:56248530-56248552 GGCAGGGAGCCTTGGTGGAGAGG + Intronic
1118850789 14:69581769-69581791 GGCAGATGGCCCAGCAGGAGAGG - Intergenic
1119026240 14:71155191-71155213 GGCGGATGAGCTGGCTGGAGGGG - Intergenic
1120701805 14:87706308-87706330 GCCAAGTGGCCTTGCAGGAGAGG - Intergenic
1122649775 14:103220198-103220220 TGGAGATGGCCTGGCTGGAGGGG + Intergenic
1122785484 14:104161435-104161457 GGCAGTTGGCCTTGATGGTGAGG - Intronic
1126096195 15:45092486-45092508 GGCATTTGGCCTGGCTGAAGAGG + Intergenic
1128599657 15:68985241-68985263 GGCAGATGGACTTTCTGGTCAGG + Intronic
1129409490 15:75341264-75341286 GGCAGATGGGCTTCCAGGACTGG + Intronic
1131078851 15:89517130-89517152 GGCAGTTAGCCTTAGTGGAGAGG + Intergenic
1131590370 15:93741470-93741492 GACTGAAGGCCTTGGTGGAGTGG + Intergenic
1131663489 15:94544250-94544272 GACAGAAGGCCAAGCTGGAGGGG - Intergenic
1133987406 16:10678932-10678954 GACAGCTGGCTTTGCTGGAGAGG + Intronic
1134206114 16:12239125-12239147 GGCACATGGCCTTTCTGAATAGG + Intronic
1134424335 16:14125315-14125337 CAGAAATGGCCTTGCTGGAGGGG - Intronic
1137538976 16:49349092-49349114 GGCAGCTGACCTGGCAGGAGTGG + Intergenic
1138436005 16:57000427-57000449 AGAAGATGGCCTTGTTGGACTGG + Intronic
1138595839 16:58028521-58028543 GGCAGATGGGCTGGCTGCTGAGG - Intronic
1139504303 16:67391452-67391474 GGCACAAGGCCTTGCTTGGGTGG + Exonic
1139517535 16:67460663-67460685 GGCAGATGGCATGGGGGGAGGGG - Intronic
1142615950 17:1135196-1135218 GGGAGAGGGCCGTGCTGGAGAGG + Intronic
1142669215 17:1479769-1479791 AGCAGATGGCCATGCAGGGGTGG + Intronic
1143165509 17:4895446-4895468 AGCAGATGGATGTGCTGGAGGGG + Exonic
1143508673 17:7383634-7383656 GGCAGCTGGCCTGGATGAAGCGG - Intronic
1145798362 17:27668586-27668608 GGCAGAGGGTCTTGCTTGTGTGG + Intergenic
1147671120 17:42177538-42177560 GGCACATGCCCTAGCTTGAGGGG + Intronic
1148157122 17:45430898-45430920 GTCCGAGGGCCTTGCTGTAGAGG + Intronic
1148378048 17:47168040-47168062 GGCAGGTGGCTTGCCTGGAGAGG - Intronic
1149996857 17:61410215-61410237 GGCAGCTGTCCTTGCAGGAGTGG - Intergenic
1151382770 17:73736960-73736982 GGCAGATGGGGTTGGTGGGGAGG + Intergenic
1151571832 17:74930313-74930335 GGCAGACGGCCGTGCTGCAGAGG - Exonic
1151573870 17:74941510-74941532 GGCAGAAGTCCTGGCTGGTGAGG + Exonic
1152451936 17:80387080-80387102 TGCAGATGGCCCTGCAGGAGAGG - Intronic
1152498757 17:80694313-80694335 CGCAGATGGCTTTGCTGGCCTGG + Intronic
1155679467 18:28472352-28472374 GGCAGGTAACCTTGCTGCAGAGG + Intergenic
1157791234 18:50533005-50533027 GTCAGATGGGGTGGCTGGAGAGG + Intergenic
1158366557 18:56743902-56743924 GGCAGTTGGCCTTGATGTGGAGG + Intronic
1159036704 18:63284930-63284952 GGCGTCTGCCCTTGCTGGAGTGG - Intronic
1159695164 18:71548291-71548313 GGCATATGGCCTAGCTAGAAAGG + Intergenic
1160763837 19:798317-798339 GGGACACGGCCTTTCTGGAGGGG - Intronic
1161198453 19:3000603-3000625 GGCACATGGCCCTGCCAGAGTGG + Intronic
1161211036 19:3065847-3065869 GGCAGGTGGCCTCCCAGGAGAGG - Intergenic
1161780402 19:6287871-6287893 GGATGATAGCCTTGCTGGGGAGG + Intergenic
1162804656 19:13131063-13131085 AGCAGATGGCCTTGGTGGTAGGG - Intronic
1162929970 19:13952793-13952815 GGGAGATGGCTTGGATGGAGGGG + Intronic
1163559488 19:18010329-18010351 GGCTGGGGGCCTTGCCGGAGCGG + Exonic
1165178698 19:33949109-33949131 TGCAGAAGGCCTTGCAGGATGGG - Intergenic
1165386132 19:35511661-35511683 GGAATATGGCCTGGGTGGAGAGG - Intronic
1165711156 19:38011937-38011959 TGCTGATGGCCTTGCTGTGGAGG + Intronic
1166317007 19:41994663-41994685 GGGAGAGGGCCCTGCAGGAGGGG + Intronic
1166919728 19:46221072-46221094 GGCTGCTTGCCTTTCTGGAGGGG + Intergenic
1167421083 19:49403760-49403782 GGCAGCAGGCCTTCCTGGTGGGG - Intronic
1167909654 19:52691089-52691111 GGAAGGTGGCCTTGCGGGAGGGG - Intergenic
1168291217 19:55358618-55358640 GCCAGCTGTCCTTACTGGAGGGG - Exonic
928252579 2:29694884-29694906 CCCAGATGGACTTGCTGGATGGG - Exonic
929818127 2:45252134-45252156 GTCAGACCACCTTGCTGGAGAGG - Intergenic
929893526 2:45938261-45938283 TGTAGATGGCTTGGCTGGAGGGG + Intronic
931228074 2:60351301-60351323 GGCTGAGGGCCGTGCTGGTGTGG - Intergenic
932740977 2:74290957-74290979 GGCAGGTGAGCTGGCTGGAGAGG + Intronic
932809869 2:74816110-74816132 GCCAGAAAGCCTTGCAGGAGAGG - Intergenic
934790223 2:97053570-97053592 GGCACGTGGCCTTGGTGGTGTGG + Intergenic
934816245 2:97328967-97328989 GGCACGTGGCCTTGGTGGTGTGG - Intergenic
934821451 2:97379517-97379539 GGCACGTGGCCTTGGTGGTGTGG + Intergenic
935658078 2:105441954-105441976 GTCAGAGGGCCTTGCTGCTGAGG - Intergenic
935845883 2:107165061-107165083 TGCAGATGGGCTCTCTGGAGTGG - Intergenic
937104012 2:119293748-119293770 GGCTGATGGCCTGGCTGTGGGGG + Intergenic
937775778 2:125774291-125774313 GGCAGATGGCTTACCTGGACAGG + Intergenic
938092342 2:128441799-128441821 GGCTGAGGGCCTGGCTGGAGGGG - Intergenic
938344785 2:130559251-130559273 GTGAGAAGGCCCTGCTGGAGTGG - Intergenic
938345048 2:130561469-130561491 GTGAGAAGGCCCTGCTGGAGTGG + Intergenic
940902456 2:159138080-159138102 AGCAATTGGTCTTGCTGGAGTGG + Intronic
942766132 2:179459338-179459360 GGCATCTGGGCTTGGTGGAGTGG + Intronic
945947997 2:216013121-216013143 GGGAGGTGGGCTTGCTGGAAGGG - Intronic
946539951 2:220673300-220673322 GGCAGATGGCGGTGCAGAAGGGG + Intergenic
948036055 2:234858962-234858984 GGCAGAGGGCTTTTCTGAAGGGG + Intergenic
1169073779 20:2749627-2749649 GGCTGATGGCCTTGATGCAGGGG - Exonic
1170551328 20:17480019-17480041 TGGAGATGGCCTTCTTGGAGTGG - Intronic
1171301154 20:24061406-24061428 AGCAGATGACCTTACTGGATGGG - Intergenic
1171404344 20:24899984-24900006 GGCAGCTGGCCTCACTGCAGTGG + Intergenic
1171486823 20:25491414-25491436 GGCAGAGGGCCGCGCTGGAGTGG - Exonic
1172408983 20:34708908-34708930 GGCAGATGGCCTAGCAGCGGAGG + Intronic
1172770596 20:37380231-37380253 GCCAGATGGCCTTGGAAGAGGGG - Intronic
1173643349 20:44618517-44618539 GGCAGAGGGCTTTCCCGGAGTGG - Exonic
1174174575 20:48636696-48636718 GGCAGGAGGCCTTGCTGGAGGGG + Intronic
1174255000 20:49248014-49248036 GGCTTAAGGCCCTGCTGGAGAGG - Exonic
1174287830 20:49484443-49484465 TGCAGGTGGCCTGGGTGGAGAGG - Intergenic
1175984981 20:62760231-62760253 CGCGGGTGGCATTGCTGGAGAGG - Exonic
1176019796 20:62956825-62956847 TGCAGATGGGCATGCTGGAGCGG - Exonic
1181276238 22:21688854-21688876 GTCAGCTGGGCTTGCTGGGGTGG + Intronic
1181668266 22:24413081-24413103 GGCAGATGGACCTGCTGGTGTGG - Intronic
1183157270 22:36085121-36085143 GGCAGGTGTCCCTGCTGGAAGGG - Intergenic
1183158673 22:36095355-36095377 GGCAGTGGGCCTCACTGGAGGGG - Intergenic
1183294166 22:37019889-37019911 GGCGGCTTGCCTTTCTGGAGGGG + Intronic
1183585010 22:38748420-38748442 AGCAGATGTCCCTGTTGGAGTGG + Intronic
1184426000 22:44409652-44409674 GGGAGATGGCCTCTGTGGAGGGG - Intergenic
1185384389 22:50525205-50525227 GGGCGCTGGCCTTGCTGGGGAGG - Intronic
950425075 3:12920800-12920822 GGCACATGGCCGTCCTGGGGAGG + Intronic
950664150 3:14484794-14484816 GGCAGATGGCCCTGGCGAAGGGG + Intronic
951645635 3:24887876-24887898 AGCTGATGGCCTTGAGGGAGAGG + Intergenic
951802748 3:26614634-26614656 AGGAAATGCCCTTGCTGGAGTGG - Intergenic
953413505 3:42702763-42702785 AGGAGGTGGCCTTCCTGGAGCGG + Exonic
954750431 3:52810447-52810469 GGCAGAAGGCCAGGCTGGACTGG + Intergenic
961386220 3:126524726-126524748 GGGAGATGGCCTTCCCGGATTGG - Intronic
967873548 3:194251406-194251428 GGCTCATGGCCTTTCTGGAGGGG + Intergenic
968904029 4:3443505-3443527 GGCAGGGGTCCTGGCTGGAGGGG + Intronic
969036020 4:4254652-4254674 GGGAGCTGGCCTTGATTGAGAGG + Intergenic
969202878 4:5619715-5619737 GGCTGTGGGCCTTGCTGGAAAGG - Intronic
969619862 4:8273536-8273558 GGCAGATGAGCTTACTGGGGCGG - Intronic
970052362 4:11929009-11929031 GGCAGGTGTTCTTGCTGAAGTGG + Intergenic
972371173 4:38424724-38424746 GGCTGCTGGCCCTGCTGGGGAGG - Intergenic
972419589 4:38874091-38874113 GGCAGATGGCATTGCTGATAGGG + Intronic
975579886 4:75896836-75896858 GACAGATGGCCTTGCTGTTCTGG - Intronic
977002374 4:91519596-91519618 GTCTGAAGGCCTTGGTGGAGTGG + Intronic
978737413 4:112099680-112099702 AGTAGATGGCATTGCTGGAGAGG + Intergenic
981492235 4:145352090-145352112 GGCAGCAGGCTGTGCTGGAGTGG - Intergenic
982211821 4:153043475-153043497 TGCGGAAGGCCTTGCTGAAGAGG + Intergenic
984923048 4:184782784-184782806 TGCAGAAGGCTTTGCTTGAGAGG - Intronic
984941674 4:184937912-184937934 GGCAGAGGGCATGGCTGGATAGG - Intergenic
985525511 5:399473-399495 GGCAAATGGCTGTGCTGGACAGG - Intronic
985662101 5:1162429-1162451 GGCAGCTGGCTTTGCTGACGTGG - Intergenic
986307375 5:6525656-6525678 GGGGGATGGCCTGGCTGCAGAGG - Intergenic
986565495 5:9109582-9109604 GGCAGATAGCCTAGCAAGAGAGG - Intronic
988706259 5:33728560-33728582 GGCAAATGGCCTTGGCAGAGAGG - Intronic
990359764 5:55006967-55006989 GACTGATGGCCCTGGTGGAGTGG - Intronic
991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG + Intergenic
991090389 5:62688747-62688769 GGCAGATGGCATATTTGGAGGGG - Intergenic
993470887 5:88306241-88306263 GGCAGTAGGCCTTGCTGCGGTGG - Intergenic
994510752 5:100700649-100700671 TGCTGGTGACCTTGCTGGAGAGG - Intergenic
995040382 5:107581151-107581173 GGCAGATGAGCATGCTGGGGAGG - Intronic
995593324 5:113722687-113722709 GGCAGATGACTTTGCTGCTGAGG + Intergenic
998369435 5:141651371-141651393 GGCTGACCGCCTTGCTGGAGCGG - Exonic
1000031464 5:157405846-157405868 GACTGAAGGCCTTGGTGGAGTGG - Intronic
1001144257 5:169170087-169170109 GGGATGTGGCCTTGCTGGATGGG + Intronic
1001522257 5:172403112-172403134 AGCCGATTGCCTTCCTGGAGTGG + Intronic
1001683661 5:173576848-173576870 GGGTGAGGGCCTTGGTGGAGTGG + Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1002456211 5:179346385-179346407 GGATCAGGGCCTTGCTGGAGAGG - Intergenic
1002473317 5:179450402-179450424 CGCAGAAGGCTTTGCTGGCGGGG - Intergenic
1003625122 6:7734439-7734461 GGCTGTTGGCCAGGCTGGAGTGG + Intronic
1005504389 6:26457463-26457485 GGAAGCTGGCATGGCTGGAGCGG - Intergenic
1006347260 6:33492805-33492827 GGGAGATGGCAATGTTGGAGTGG + Intergenic
1006445292 6:34076585-34076607 GTCAGCTGGCCTTGGTGGAGGGG + Intronic
1006996594 6:38266978-38267000 GGCAGATGGCCTTGCTGGAGAGG - Intronic
1007307809 6:40920653-40920675 TGCAGAGGGCCTTGCGGGATGGG - Intergenic
1009291730 6:61891194-61891216 AGGAGATGGACATGCTGGAGAGG + Intronic
1010812316 6:80314726-80314748 GACAGAGTGCCTTGCGGGAGGGG - Intronic
1011798915 6:90988197-90988219 GGCAGATCTCATTGATGGAGTGG + Intergenic
1013612975 6:111812275-111812297 GGCAGATGGCGATGCTTCAGGGG + Intronic
1014668143 6:124265741-124265763 GGCTGATTGCCTTGCTGGCCTGG - Intronic
1016642421 6:146364459-146364481 GCCAGCTGGGCTGGCTGGAGTGG - Intronic
1018999993 6:168742105-168742127 AGCAAATGGCCTAGTTGGAGGGG - Intergenic
1019357396 7:587765-587787 GGCAGGAGGCCCTGCAGGAGTGG + Intronic
1019645821 7:2128483-2128505 GGAAGATGGCCGTTCAGGAGAGG + Intronic
1022335226 7:29415609-29415631 GGGAGATGGCCAGGTTGGAGAGG + Intronic
1022519274 7:30995358-30995380 GGCAGAAGGCCGTCCTGGACAGG + Intergenic
1023328518 7:39086733-39086755 GACAGATGTCTTTGCTGGAGTGG - Intronic
1023943106 7:44782627-44782649 AGCTGAGGGCCTTGCTGGACAGG + Intergenic
1024929064 7:54650714-54650736 GCCAGATGGCCTTTGTGTAGGGG + Intergenic
1028667345 7:93362285-93362307 GGCAGAAGGCCTCCCTTGAGAGG + Intergenic
1029160647 7:98549170-98549192 GGCACCTGGCCCTGCTCGAGGGG - Intergenic
1031779384 7:125942277-125942299 GGGAGATGGGGATGCTGGAGTGG - Intergenic
1031989698 7:128189568-128189590 AGCAGGTGGCCTTCCTGGTGAGG + Intergenic
1033369994 7:140698685-140698707 GGCAGGAGGCCAGGCTGGAGTGG + Intronic
1034673142 7:152872414-152872436 GTCAGGTGGCCATGCAGGAGGGG + Intergenic
1034901298 7:154909587-154909609 GGCAGATCTCCCTGCAGGAGTGG - Intergenic
1039899998 8:41744857-41744879 GCCATATGGCCATGCTGGACAGG - Intronic
1040572979 8:48625747-48625769 GGGAGAAGGTCTGGCTGGAGTGG - Intergenic
1041040423 8:53841195-53841217 GGCAGGTGGCCTTTTTAGAGTGG - Intronic
1042620114 8:70694957-70694979 GACCGAAGGCCCTGCTGGAGTGG + Intronic
1043374479 8:79633102-79633124 CCCAGATGGCGTTGCTGGAAAGG - Intronic
1045065105 8:98437405-98437427 GGCAGATGGACTGGCTGCTGTGG - Intronic
1045316917 8:101051510-101051532 GGCAGCAGGCCTTGCTCCAGGGG - Intergenic
1046635374 8:116669594-116669616 GGCAGCTGAGGTTGCTGGAGTGG - Intronic
1047753638 8:127901226-127901248 GGAAGTTGGGCTTGCTGCAGAGG + Intergenic
1048062787 8:130937672-130937694 TGCAAATGTCCTTGCTGGAAAGG - Intronic
1048372926 8:133795391-133795413 CTCTGATGGCCTTCCTGGAGTGG - Intergenic
1049155243 8:141062245-141062267 GGCAGATGTCCAGGCTGCAGTGG - Intergenic
1049178659 8:141209116-141209138 GGCTGATAGCCTTGCCCGAGAGG - Intronic
1049224968 8:141446012-141446034 GACAGACGTCCTTGCTGGTGGGG + Intergenic
1049659301 8:143812616-143812638 GGCAGCTGGTGGTGCTGGAGGGG - Intronic
1049724671 8:144140188-144140210 GGGAGACGGCCTAGCTAGAGAGG - Exonic
1052075212 9:24133062-24133084 GGCAGCTGGCTTTGTGGGAGAGG + Intergenic
1052311863 9:27076218-27076240 GACAGAAGGCCCTGGTGGAGTGG + Intergenic
1052997101 9:34557013-34557035 GGCAGAAGGTCTGGCTGGGGCGG + Intronic
1053473450 9:38363817-38363839 TGCAGATCACCTTGCTGGAGAGG - Intergenic
1055224791 9:73983644-73983666 GGGTGAAGGCCCTGCTGGAGTGG - Intergenic
1057487678 9:95498831-95498853 ACCAGAGGGCCTTGCTGGTGAGG - Intronic
1057814667 9:98285722-98285744 GGCAGATGTGGTTGCTGGACAGG + Intergenic
1058921280 9:109617560-109617582 AGGAGATGGCCATGTTGGAGAGG - Intergenic
1059338389 9:113583478-113583500 GGGAGATGGCCTTGGAGGAAGGG + Exonic
1060192153 9:121599939-121599961 CGCAGATTTCCTTGCGGGAGAGG - Intronic
1060407576 9:123380487-123380509 GGCAGCTGGCCTTCCTGGGTTGG - Exonic
1060895423 9:127213869-127213891 TGCAGATGGCAGTGCTGGTGGGG + Intronic
1060999527 9:127895311-127895333 GTAAGATGCCCTTACTGGAGAGG - Intronic
1062333083 9:136053067-136053089 GGCAGCTGGCCAAGCAGGAGGGG - Intronic
1188898030 X:35694340-35694362 GACTGAAGGCCCTGCTGGAGTGG - Intergenic
1190375187 X:49782366-49782388 TGAAGATGGTCTTGCTGGTGGGG + Intergenic
1192180393 X:68912391-68912413 GGCAGAGGGCCGGGCTGGGGAGG - Intergenic
1194830948 X:98621394-98621416 GGCTGATGGCCCTGATGGAGTGG + Intergenic
1195104939 X:101594311-101594333 GACTGAAGGCCTTGGTGGAGTGG + Intergenic
1197979160 X:132197666-132197688 GGCTGATTGCCTTGTGGGAGTGG + Intergenic
1198221323 X:134605101-134605123 GGCAGAAAGCCAGGCTGGAGAGG - Intronic
1198485422 X:137082468-137082490 GTCAGAGAGCCTTGGTGGAGTGG - Intergenic
1199379709 X:147155775-147155797 GACTGAAGGCCTTGGTGGAGTGG + Intergenic
1200397502 X:155999726-155999748 GACAGAAGACCTTGCTGGACAGG + Intronic
1201436164 Y:13960834-13960856 TGCAGATGGCCATGGTGGGGTGG + Intergenic