ID: 1006996813

View in Genome Browser
Species Human (GRCh38)
Location 6:38268795-38268817
Sequence GCTGGTAGTAAGTCTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006996813_1006996817 16 Left 1006996813 6:38268795-38268817 CCTCCTTCAGACTTACTACCAGC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006996817 6:38268834-38268856 TCCTCCTTCAGGTTCTCCCTTGG 0: 1
1: 0
2: 3
3: 22
4: 307
1006996813_1006996816 5 Left 1006996813 6:38268795-38268817 CCTCCTTCAGACTTACTACCAGC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006996816 6:38268823-38268845 CTGCGACTCGTTCCTCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006996813 Original CRISPR GCTGGTAGTAAGTCTGAAGG AGG (reversed) Intronic
900280118 1:1861662-1861684 GCTGGAAGCAACCCTGAAGGAGG + Intronic
901333049 1:8425020-8425042 GCTGGCAGAAAGGCTGAAGCTGG + Intronic
903295806 1:22342455-22342477 GCAGGGAGCAAGGCTGAAGGAGG + Intergenic
906587858 1:46995677-46995699 GATGGGAGTAAGACTTAAGGTGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
908699785 1:66886646-66886668 ACTGGTAGTAAGTGTGGAGAAGG + Intronic
910321139 1:85945724-85945746 GCCTATAGGAAGTCTGAAGGTGG - Intronic
912446127 1:109738230-109738252 GCTGGTAGTTTGTCTGAGAGTGG - Intronic
913275142 1:117130234-117130256 GCTGGAACCTAGTCTGAAGGAGG - Intergenic
914449176 1:147775506-147775528 GCTGGGAGATAGTCTGAAAGTGG + Intergenic
916080092 1:161226878-161226900 GCTGGGAATACATCTGAAGGGGG - Exonic
916747068 1:167692875-167692897 GCTGGTAGGAGGTGGGAAGGTGG + Intronic
1062963198 10:1589246-1589268 GCTGGCGGTCAGGCTGAAGGTGG - Intronic
1067202475 10:44185316-44185338 GATGGTAGTAAACCTGATGGGGG + Intergenic
1067210650 10:44258192-44258214 GCTGGGAGTGAGTCTGCAGGAGG - Intergenic
1070289366 10:75104637-75104659 GTGGGTAGAAGGTCTGAAGGGGG - Intronic
1072388158 10:94954044-94954066 GTTTGTAGTAAGTTTGAAGTTGG + Intronic
1073866654 10:107812391-107812413 GCTGGTGTTAATTCTGAGGGAGG + Intergenic
1074421002 10:113309033-113309055 GCTGGTAGTAATGCCGAAGTTGG + Intergenic
1077904631 11:6520311-6520333 GGGGGTAGGAAGGCTGAAGGAGG + Intronic
1078775222 11:14387828-14387850 CCTGATAGAAAGTCTGCAGGTGG - Intergenic
1079998035 11:27317333-27317355 GCTGGTTAAAATTCTGAAGGAGG + Intergenic
1083607738 11:63988808-63988830 GCAGGAAGCAAGTCTGAAGCAGG - Intronic
1087008171 11:93489035-93489057 GATTGGAGTAAGTCTGAGGGAGG + Intronic
1087257428 11:95972119-95972141 GCTGGAACGTAGTCTGAAGGAGG - Intergenic
1087557000 11:99733686-99733708 GCTGGTGCTAACTCTGATGGAGG + Intronic
1088843182 11:113643714-113643736 GCTGGTAGTGAGGCGGCAGGGGG + Intergenic
1090687871 11:129144399-129144421 GCTGTTATCAAGTCTGATGGAGG - Intronic
1090915347 11:131157956-131157978 CCTGGTAGAAAGTCTGAGTGAGG - Intergenic
1092013060 12:5132256-5132278 GCTGGTAATAAAGATGAAGGTGG + Intergenic
1092954973 12:13541373-13541395 GGTGGGAGCCAGTCTGAAGGAGG + Exonic
1096490812 12:52011882-52011904 GCTGCTGGTAAGTGGGAAGGAGG - Intronic
1098752742 12:74316576-74316598 GGTGGTGGTAAGTGTGAAGAAGG - Intergenic
1099083531 12:78216592-78216614 GATGGTAGAAAGTCTCTAGGAGG + Intergenic
1100210778 12:92396386-92396408 GCTGGGGGAAAGTGTGAAGGGGG + Intergenic
1107324405 13:39225792-39225814 GCTGGTAGCAAGGGTGAGGGAGG - Intergenic
1109060669 13:57615557-57615579 GATGGCAGTAAGTCTACAGGGGG - Intergenic
1109397490 13:61779076-61779098 GCTGGTAGTGAGCATGAAGAGGG + Intergenic
1109431290 13:62238885-62238907 CCTAGTAGTAAGTATTAAGGTGG + Intergenic
1110302150 13:73941160-73941182 GCTTGAAGAAAGCCTGAAGGTGG - Intronic
1111605362 13:90531729-90531751 GATTAGAGTAAGTCTGAAGGAGG - Intergenic
1114388268 14:22278519-22278541 GCTGGTACTAGCACTGAAGGAGG - Intergenic
1115040791 14:28923629-28923651 CCTGTTAGTAAGTCTAAATGGGG + Intergenic
1118317794 14:64736499-64736521 GTTGCTAGTTGGTCTGAAGGGGG + Intronic
1119081850 14:71702039-71702061 GCTGTGAGTAAGTCTGAACTTGG + Intronic
1121204452 14:92150537-92150559 GCTGGTAGGAAGGCTGAGGCAGG - Intronic
1124953698 15:34346029-34346051 GATGGAGGTAAGTCTGCAGGTGG + Exonic
1125795287 15:42399821-42399843 GCTGGTAGCAACTTTGAAGCAGG + Intronic
1126299576 15:47181197-47181219 ACTGCTAGTAAGTAAGAAGGAGG - Intergenic
1129323583 15:74788018-74788040 GCTGGTAGGAGCTCTGAAGCTGG + Intronic
1129350973 15:74955911-74955933 GCTGGAGGTACATCTGAAGGTGG + Exonic
1130714537 15:86318960-86318982 GCTGGTAGCAAGACTGTACGGGG - Intronic
1131507574 15:93031101-93031123 GCTGGAAGTAGGGATGAAGGAGG - Intergenic
1132364120 15:101243672-101243694 GCTGGGAGTGGGTCTGAAAGTGG - Intronic
1134616857 16:15658183-15658205 GCTGGAGGTAAGCCTGAAGCCGG - Intronic
1134840475 16:17397752-17397774 GCTGTTTGTATGTCTGAAGAGGG - Intronic
1135568781 16:23532259-23532281 GCTGGATGTAAGGCTGAGGGTGG + Intronic
1141316616 16:82968426-82968448 GCTGGTAGTAGGGATGAAGGGGG + Intronic
1142398171 16:89844899-89844921 GCTGGGAGTAAGAGTGAAGGAGG - Intronic
1144053326 17:11516508-11516530 GCTGGTAGACAAGCTGAAGGAGG + Intronic
1147528597 17:41251691-41251713 GCTGGTAGGAGGTCCGAAGAAGG - Intronic
1150382210 17:64729751-64729773 GCCGGTAAGAACTCTGAAGGCGG + Intergenic
1151978487 17:77495704-77495726 GCTGCTGGTCAGTCTGCAGGAGG + Intronic
1153375271 18:4369999-4370021 GCAGGGAGCAAGACTGAAGGCGG + Intronic
1159627594 18:70712941-70712963 CCTTGTATTAAGTGTGAAGGTGG + Intergenic
1160718449 19:587000-587022 GCTGGGAGAAGGCCTGAAGGAGG - Intergenic
1162118573 19:8446931-8446953 GCTGGTAGGATTTCTGAGGGTGG + Intronic
926882491 2:17562359-17562381 GCTGGGGTGAAGTCTGAAGGTGG - Intronic
927640257 2:24841374-24841396 GCTGGTGGTATTTCTGAAAGGGG + Exonic
928132606 2:28663728-28663750 GCTGCTAGAAAGGCTGAAGGTGG - Intergenic
929115075 2:38437172-38437194 GCTACTCGGAAGTCTGAAGGGGG - Intergenic
932132648 2:69201697-69201719 GAGGGTAGAAAGTGTGAAGGAGG + Intronic
932203187 2:69851496-69851518 GCTGCTAGGGAGGCTGAAGGAGG + Intronic
933265094 2:80173134-80173156 GGTGGTAGTAAGTGTGTTGGTGG - Intronic
934741064 2:96722906-96722928 GCTGCTTGGAAGTCTGAAGCAGG + Intronic
935765495 2:106363120-106363142 GCAGGTAGAAAGTCTGCATGTGG + Intergenic
936285516 2:111178402-111178424 CCAGATAGTAAGACTGAAGGTGG - Intergenic
937305910 2:120870679-120870701 TCTGGGAGCAGGTCTGAAGGTGG - Intronic
940887691 2:159003822-159003844 GCTGTTGGTAAATCTGAAGCAGG - Intronic
942479973 2:176374913-176374935 GCTGGTTCCAAGTCTGAAGAAGG - Intergenic
943189420 2:184657195-184657217 GCTACTAGGAAGTCTGAAGTGGG - Intronic
943264953 2:185717313-185717335 GCTGGTAGTAAAGAAGAAGGGGG + Intergenic
945148758 2:206765741-206765763 CCTGGAAGTAAGTTTAAAGGAGG + Intronic
947361826 2:229353162-229353184 GCTGATTCTAAGTCTGAAGCAGG + Intergenic
947575767 2:231272995-231273017 GCTGGAGGGAAGGCTGAAGGAGG + Exonic
947905406 2:233757810-233757832 GCTGGTAGTGTGTCTGATGGTGG + Intronic
948090683 2:235292186-235292208 GCTGGTTTCAGGTCTGAAGGTGG + Intergenic
1169182328 20:3580555-3580577 GCTGGTAGAAAGCTGGAAGGAGG + Intronic
1170437036 20:16340995-16341017 GGTGGTATTAAGGCAGAAGGGGG - Intronic
1171963407 20:31512125-31512147 GCTGGTAGTAAGCCTAAAGTGGG + Intergenic
1172098537 20:32472579-32472601 GCTGGTTGTATGTCTCCAGGGGG + Intronic
1172519847 20:35559469-35559491 GCCGGTAGTGAAGCTGAAGGAGG - Intergenic
1173319566 20:41975257-41975279 ACTGGAATTACGTCTGAAGGAGG - Intergenic
1174548936 20:51347214-51347236 GCTGGTAGTAATGCTGATGCAGG + Intergenic
1177158080 21:17518994-17519016 GCTGTTGGTAAATCTGAAGCAGG + Intronic
1177442046 21:21138202-21138224 ACTGATTGTAAGGCTGAAGGTGG + Intronic
1177998111 21:28128609-28128631 GCTGATAATAATTCTGGAGGAGG - Intergenic
953050032 3:39332595-39332617 GCAGATAGTAGGTCTGAAAGGGG - Exonic
954403346 3:50331033-50331055 CCAGGTAAAAAGTCTGAAGGGGG + Intronic
956603468 3:71048463-71048485 CATGGTAGTAAGTCTGAAATTGG - Intronic
956633349 3:71338013-71338035 GCTCATAGTAAGTATTAAGGAGG + Intronic
960264585 3:115605866-115605888 GGTGCTGATAAGTCTGAAGGTGG + Intergenic
966752242 3:183333458-183333480 GCTGGGAGTAAGTGGGAAGGGGG - Intronic
969043736 4:4321362-4321384 GCTGGTGTTAAGGCTGTAGGAGG + Exonic
970384973 4:15546779-15546801 GCTGGTAGGAAGTCGGGTGGCGG + Intronic
970395701 4:15663486-15663508 GCTGGTAGTAAGTAAGAAAGTGG - Intronic
970410934 4:15807244-15807266 GATGGTAGTAAGTCTGTGGTAGG + Intronic
973801987 4:54487332-54487354 GCCGGAAGTGAGTCTTAAGGAGG + Intergenic
976308217 4:83582698-83582720 CCTGGTAATAAATCTGAATGAGG - Intronic
980065748 4:128186951-128186973 TGTGGTAGTAAGCCTGCAGGTGG + Intronic
982174502 4:152692995-152693017 GCTGCTAGTGAGTCTGAGGCAGG + Intronic
987149703 5:15026395-15026417 GCTGGTGATAATTCTGTAGGGGG + Intergenic
987393892 5:17402734-17402756 CCTAGTTGTAAGTCTGAAAGTGG - Intergenic
992853589 5:80837191-80837213 GCTGTTAGTAAAAGTGAAGGTGG + Intronic
994427530 5:99610626-99610648 GCTACAAGTGAGTCTGAAGGAGG + Intergenic
995329854 5:110934399-110934421 GCTGGCAGTGAGGCTGAGGGAGG + Intergenic
995769891 5:115657172-115657194 CCTGGTAGAAAATCTGAGGGAGG + Intergenic
1004351989 6:14898189-14898211 GCTGGAAGTAGGGCTGTAGGCGG - Intergenic
1005852265 6:29830404-29830426 GCTGCAAGTAAGTATGAAGGAGG + Exonic
1005859634 6:29890290-29890312 GCTGCAAGTAAGTATGAAGGAGG + Intergenic
1005864776 6:29929039-29929061 GCTGCAAGTAAGTATGAAGTGGG + Intergenic
1005867201 6:29945085-29945107 GCTGCAAGTAAGTATGAAGGAGG + Exonic
1005875879 6:30009171-30009193 GCTGCAAGTAAGTATGAAGGAGG + Intergenic
1006855684 6:37131568-37131590 GCTGGCAGCAAGCCTGCAGGAGG - Intergenic
1006996813 6:38268795-38268817 GCTGGTAGTAAGTCTGAAGGAGG - Intronic
1007647604 6:43395044-43395066 GCTGCCAGTAAGTCTGCAGAAGG + Intergenic
1011117552 6:83910368-83910390 GCTGGGAGTCATTCTGAAGTGGG + Intronic
1012566304 6:100658531-100658553 GCTGGCAATAAGTATGAATGGGG + Intronic
1012608132 6:101183385-101183407 GCCAGTAGTAAGCCTAAAGGGGG - Intergenic
1012746019 6:103090450-103090472 GCTGGTAGTAAGTTTGGAGTGGG + Intergenic
1018855506 6:167671754-167671776 GATGGTAGTGAGACTGAAGATGG - Intergenic
1019010023 6:168837468-168837490 GCTGTGAGAAGGTCTGAAGGCGG + Intergenic
1020010982 7:4805638-4805660 GCTGGTAGTGAGTCAGCAGCCGG + Exonic
1022600148 7:31750209-31750231 GCAGGAAGTAAGTCTCAGGGAGG + Intergenic
1022637933 7:32154862-32154884 GTGGGCAGTAAGTCTGAAGAAGG + Intronic
1022879967 7:34576217-34576239 GGTGGCAGTCAGTCTGAGGGAGG + Intergenic
1029680650 7:102106788-102106810 GCTGGTGGTAGGGCTGAAGAAGG - Intronic
1031115406 7:117662523-117662545 GCTGGGAATAAGAGTGAAGGGGG + Intronic
1031455263 7:121971403-121971425 GGTGACAGTAGGTCTGAAGGCGG + Intronic
1033030420 7:137820784-137820806 GCTGGCAGCAACTCTGGAGGTGG + Intronic
1038501103 8:28044562-28044584 GTTGGTAGTAAGTTGGAAGCAGG + Intronic
1039434274 8:37548885-37548907 GGTGGTATTAGGGCTGAAGGAGG - Intergenic
1040064463 8:43133899-43133921 GCTGTTGGTGAGTTTGAAGGTGG - Intergenic
1041143982 8:54852412-54852434 GCTGGAAGTATGTTTGAAAGGGG + Intergenic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048029389 8:130616616-130616638 GCTGCTAGCATGTGTGAAGGAGG + Intergenic
1055687427 9:78791741-78791763 GCTTGTAGTAAGTTAGTAGGCGG + Intergenic
1057336468 9:94159476-94159498 GCTTGTAGTAAGAATGAAGCAGG + Intergenic
1057911499 9:99023443-99023465 GCTGAGAGTGAGTGTGAAGGAGG + Exonic
1058702199 9:107610583-107610605 GCTGCCAGTAAATCTAAAGGAGG - Intergenic
1059667893 9:116466462-116466484 GCTGGTAGGAATTGTGAAGCAGG - Intronic
1061482849 9:130905676-130905698 GCTGGTGGGAAGACTGCAGGAGG + Intronic
1062095881 9:134703096-134703118 GCAGGGAGTAGGTGTGAAGGTGG + Intronic
1192922284 X:75719617-75719639 GGTGGTAGCAAGGCTGAGGGAGG - Intergenic
1198860950 X:141069829-141069851 GCTGCCAGTAAGGCTGAATGAGG + Intergenic
1198901742 X:141517554-141517576 GCTGCCAGTAAGGCTGAATGAGG - Intergenic
1200567817 Y:4788662-4788684 GCTACTAGGAAGTCTGAAGCAGG - Intergenic
1201376156 Y:13322395-13322417 GCTGCTCTTAAGTCTGAGGGAGG - Intronic
1201684302 Y:16683623-16683645 GGTGGCAGTAAGGCTGAGGGAGG + Intergenic