ID: 1007006950

View in Genome Browser
Species Human (GRCh38)
Location 6:38373104-38373126
Sequence TTGTGAATATGTATCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007006950 Original CRISPR TTGTGAATATGTATCTACCA AGG (reversed) Intronic
905838715 1:41154246-41154268 CTGAGAATATGTATTTTCCAAGG + Intronic
908743510 1:67353268-67353290 TTGTAAATATGTATTTAAGATGG - Intronic
909680652 1:78287778-78287800 TTGTTAATATGTTTTTCCCAAGG + Intergenic
910934824 1:92479216-92479238 GTGTGGATATGTATTTGCCATGG - Intronic
911552269 1:99297639-99297661 TTGTGTATAATTATCTACTAGGG - Intronic
913387609 1:118276915-118276937 TTGTGATTTTGTATCTCACAAGG - Intergenic
916872691 1:168934203-168934225 TGGTATATATGTATATACCATGG - Intergenic
917501963 1:175593799-175593821 TTGAGAATATTTCTCTATCATGG - Intronic
919028391 1:192206569-192206591 TTTTGAATCTGTCTTTACCATGG + Intergenic
919684394 1:200469590-200469612 TTGTGAATGTGTATATCCTAGGG - Intergenic
922638637 1:227203478-227203500 TTATGAATATATATATACCCAGG - Intronic
924292322 1:242549568-242549590 TTCTGACTATATATCCACCATGG + Intergenic
924742004 1:246799675-246799697 CTGTGAATATTTATCATCCATGG - Intergenic
1068983152 10:63082753-63082775 TGGTGTATATATATATACCATGG + Intergenic
1069088721 10:64173566-64173588 TTGTGAATATGCATAAAGCAGGG - Intergenic
1071197654 10:83179701-83179723 TTATGTAAATGTTTCTACCATGG + Intergenic
1071739623 10:88342304-88342326 TAGGGAATATGTATTAACCAGGG - Intronic
1072385219 10:94918193-94918215 TTTTGAGTATATATCTAGCAGGG + Intergenic
1072400308 10:95091701-95091723 TTCTGATTATCTATCTACAATGG + Intergenic
1072601309 10:96932874-96932896 TTGTGAATATGTTTCAAGAAAGG + Intronic
1074423814 10:113333258-113333280 TTGTGAATATTTATGTTACATGG + Intergenic
1074846111 10:117399516-117399538 TTGTGACTGTGTAACCACCATGG + Intergenic
1075258588 10:120944432-120944454 TGATGAAGATGTATTTACCAAGG - Intergenic
1075515585 10:123105556-123105578 TGGTGAATATGTTACTTCCATGG + Intergenic
1079251006 11:18787978-18788000 TAGGGACTATGAATCTACCAGGG - Intronic
1079461900 11:20688590-20688612 TGGTATATATGTATATACCAAGG - Intronic
1081144734 11:39548733-39548755 GTGTGTATATATATCCACCATGG + Intergenic
1081952543 11:47057453-47057475 CTGTGAAGAAGTATCTACTAAGG + Intronic
1082664598 11:55959862-55959884 TTGTAAATATGTATTTACTTGGG - Intergenic
1086186155 11:84019462-84019484 TTTTCGCTATGTATCTACCAGGG - Intronic
1087573205 11:99957205-99957227 TGGTGAATATTTCTCAACCATGG - Intronic
1088564662 11:111156936-111156958 TTGTTAATTTGTATCTTTCAAGG + Intergenic
1088622618 11:111701860-111701882 TTGTGAATCTGTATCTACAAAGG - Intronic
1089102388 11:115974369-115974391 TTAGGAATCTGTTTCTACCAGGG - Intergenic
1090990928 11:131816119-131816141 TTTTGATTATGTAACGACCAAGG + Intronic
1092457789 12:8659735-8659757 TTTTCCATATGTATATACCAGGG - Intronic
1092931803 12:13322533-13322555 TTGGGAAAATGTATTTAGCAGGG + Intergenic
1093304563 12:17498022-17498044 CTGTGAATATTTACCTTCCATGG + Intergenic
1098161730 12:67651949-67651971 ATGGGAATATGGATCTACAAAGG - Intronic
1099364877 12:81756432-81756454 TTGTGAATGTTTATATCCCATGG - Intronic
1101749208 12:107569420-107569442 TTGTGAAAATTTATCAACCATGG - Intronic
1102805926 12:115780638-115780660 TTGTTAATATGTATCTTTCAAGG + Intergenic
1102828384 12:115970870-115970892 TTTTGAATGTGTATTTATCATGG - Intronic
1102878653 12:116467291-116467313 TTGTGAATATGTGTGGACGACGG - Intergenic
1107311096 13:39079182-39079204 TGGTGTATATATATATACCATGG + Intergenic
1107741763 13:43457917-43457939 ATGTGTATATGTATGTACCAAGG + Intronic
1108283901 13:48886910-48886932 TTATGAAGGTGTATTTACCAAGG - Intergenic
1111480289 13:88815178-88815200 TTGTGCATCTGTATTCACCAGGG - Intergenic
1113174872 13:107551805-107551827 GTATGAATATGTTTCTAACAAGG + Intronic
1117093189 14:52270231-52270253 TTTGTAATATGTATCTACTAAGG - Intronic
1121209345 14:92196006-92196028 TGGTGTATATATATATACCATGG - Intergenic
1126247187 15:46521696-46521718 TTTTGAAAATATATCTGCCAAGG - Intergenic
1126318218 15:47393536-47393558 TGGTGAATTTGTAACTGCCATGG - Intronic
1127551139 15:60039584-60039606 TCGTGCATATGTAACAACCAGGG - Intronic
1130824545 15:87530595-87530617 TTTTGAATATTTATCTTCTATGG - Intergenic
1131204575 15:90432043-90432065 ATGGGAAAATGTATCTAACAAGG - Intronic
1132996925 16:2828226-2828248 TTGGGAATAGGTATCAACCAGGG + Intergenic
1134781368 16:16899634-16899656 TTTTGCATCTGTATTTACCAAGG + Intergenic
1136017898 16:27417073-27417095 CTGTGAATATTTGTCTACAATGG + Intronic
1138471003 16:57236360-57236382 TTTTGGATATATATCTACTATGG - Intronic
1138960886 16:62027851-62027873 TTCAGAATATGTTTCTGCCAAGG - Intronic
1139185626 16:64803208-64803230 TTGTGAGTGTGTCTGTACCAGGG + Intergenic
1139869585 16:70095475-70095497 TTATGAGTATGTATCTACTGGGG - Intergenic
1140062699 16:71584964-71584986 TTGTGACTAAGAATTTACCATGG - Intergenic
1140385801 16:74536745-74536767 TTATGAGTATGTATCTACTGGGG + Intronic
1141311398 16:82916627-82916649 TTATGAGAATGTATCTATCATGG - Intronic
1144154512 17:12486084-12486106 TTGTGAATCTGTATCTCCGGTGG - Intergenic
1146900742 17:36585868-36585890 TTGTGGATATTCATCTAGCATGG + Exonic
1149232196 17:54547360-54547382 TTCTGAATATGCATCTGGCATGG - Intergenic
1156172953 18:34508027-34508049 TCATTAATATGTATCAACCAAGG - Intronic
1156366008 18:36427967-36427989 TTGTAGATATGTATCTTCCTTGG + Intronic
1158314952 18:56201633-56201655 TTGTGAATTTATAACTACAAGGG - Intergenic
1158761413 18:60392316-60392338 TTGTGAATTTGTATCAACTCTGG + Intergenic
1159481159 18:68992764-68992786 GTGTGAATATGTGTCAACCCAGG + Intronic
1162678928 19:12323743-12323765 ATGTGAAATTTTATCTACCAGGG - Intronic
926624151 2:15076463-15076485 TTGTGAAGGTGTCTCTCCCAGGG + Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931015854 2:57979651-57979673 TTGTGAATATGTCTGGTCCAGGG + Intronic
931654816 2:64501457-64501479 TTGTGTATCTTTATCTCCCAGGG - Intergenic
931689887 2:64826689-64826711 TTTTGCATATGTATCTATCTGGG - Intergenic
931959416 2:67465597-67465619 CTTTGAATATGTATCTATCTTGG + Intergenic
934166624 2:89299848-89299870 CTGGGAATGTTTATCTACCAGGG - Intergenic
934200657 2:89882609-89882631 CTGGGAATGTTTATCTACCAGGG + Intergenic
936898538 2:117457326-117457348 TTTTGGGTATGTACCTACCAAGG + Intergenic
941112984 2:161437880-161437902 TAGTGAGTATGTACTTACCAAGG + Intronic
941343905 2:164343702-164343724 ATGTGAATAACTATCTACTAAGG - Intergenic
941798001 2:169622590-169622612 TTATTAATATGTATCTGCCCAGG + Intronic
942052261 2:172150929-172150951 GTGTGTATATATATATACCATGG - Intergenic
942853289 2:180516628-180516650 TGTTGATTATGTATCTCCCATGG + Intergenic
943786424 2:191882713-191882735 TTGTGAATGTGAATCTTCTAAGG - Intergenic
943852111 2:192737210-192737232 TTGTGAATTCGTATTTACCTAGG + Intergenic
944630809 2:201622172-201622194 TTGATAATATGTAACTGCCATGG - Exonic
947260262 2:228213739-228213761 TTTTAAATATGTAACTACAAAGG + Intergenic
1170045596 20:12082077-12082099 TTGTACATATGGATGTACCAAGG - Intergenic
1173713980 20:45185651-45185673 TTGTGAATGTAAATCTCCCAAGG + Intergenic
1175672167 20:60913036-60913058 TTGAGAATATCTATGTACTAAGG - Intergenic
1177598784 21:23283381-23283403 TTATGCATATGTAACTTCCAAGG + Intergenic
1182794805 22:32984237-32984259 TTATGAAATTGTATCTGCCAAGG - Intronic
1183158289 22:36092526-36092548 CTGTGAATGTGTATGTACAATGG - Intergenic
951492006 3:23281299-23281321 TTATGAATATGGAACTACAATGG - Intronic
952630611 3:35461552-35461574 TCGTGAATATGAATCTTCAAAGG - Intergenic
952697965 3:36292292-36292314 TTGTAAATGTTTATCTAGCATGG + Intergenic
956212737 3:66818355-66818377 ATTTGAATACTTATCTACCAAGG - Intergenic
957384341 3:79476545-79476567 TGGTGTATATATATATACCATGG + Intronic
957548451 3:81671319-81671341 TTGTCATTATTTTTCTACCATGG - Intronic
965836330 3:172857114-172857136 TTGAAAATATATAGCTACCAAGG - Intergenic
968033877 3:195528331-195528353 TGGTATATATGTATGTACCATGG - Intronic
968207279 3:196814782-196814804 TTGTGAATCTGGATCTTCAAAGG - Intronic
969047762 4:4349549-4349571 TTGTTACTATGTATCTCTCAGGG - Intronic
970099161 4:12501509-12501531 TTGAAAATATGTAACTAACAGGG - Intergenic
971557404 4:28031402-28031424 CTGTGAATCTGTCTCTTCCAGGG + Intergenic
972868877 4:43270759-43270781 TTGTAAATATATTTCTAACAAGG + Intergenic
973324230 4:48841467-48841489 GTGTGAAGTTGTATCTACCCGGG + Intronic
974417938 4:61635169-61635191 TTGTGCATATGTACCTATGATGG - Intronic
974687535 4:65249329-65249351 CTGTGAATATTTATCTTCCATGG - Intergenic
976415203 4:84765012-84765034 TTGAGAATATCTATTTACCTTGG - Intronic
977405171 4:96588716-96588738 TTGGGTAGCTGTATCTACCAGGG - Intergenic
978345530 4:107764184-107764206 TGGTGTATATGTATATACCATGG - Intergenic
979653154 4:123159959-123159981 TTTAGAATATGAATCTAACATGG + Intronic
979835124 4:125357732-125357754 TTGTGAATATGTTTGAATCAAGG + Intronic
980888687 4:138790691-138790713 TTGTGATGATCCATCTACCAAGG + Intergenic
981799780 4:148642054-148642076 TTGTGAAGTTTGATCTACCAAGG + Intergenic
981950831 4:150404810-150404832 ATTTGAATATTTTTCTACCATGG + Intronic
984659089 4:182353543-182353565 TTGTAAATGTATATCTATCAAGG - Intronic
989416455 5:41183095-41183117 TTGTGCATATATTCCTACCATGG + Intronic
989659307 5:43781706-43781728 TTGTGCATATATATATGCCATGG + Intergenic
989843732 5:46112862-46112884 ATGTGCATATGAATCTACCGTGG - Intergenic
992754786 5:79894142-79894164 TTGTTATTATCTATCTACCAAGG - Intergenic
993004407 5:82415213-82415235 TTGTGCAAATATATCTATCATGG + Intergenic
994227002 5:97264490-97264512 GTGTGAATAGGTATTAACCATGG - Intergenic
994552169 5:101249569-101249591 TTTTGCATATGTATTTACAAGGG - Intergenic
995986568 5:118183007-118183029 TTCTGAATCTCTATCTACTAAGG + Intergenic
996077538 5:119214636-119214658 TTCTGATTATGTATCTGACATGG + Intronic
996992687 5:129655087-129655109 TTGTGCATATTAATCTTCCAGGG - Intronic
998605287 5:143627489-143627511 TTGTCAATCTGTATGTACAAAGG - Intergenic
1000163390 5:158623141-158623163 TTATGAATATGTCTATACAAAGG - Intergenic
1001658529 5:173373062-173373084 TTGTGGATATGTATGTTACATGG + Intergenic
1002122193 5:177013853-177013875 TTGTGAAGTGGTATCTACCAGGG + Intronic
1007006950 6:38373104-38373126 TTGTGAATATGTATCTACCAAGG - Intronic
1008111638 6:47501452-47501474 TAGTGAATATGTAACTCCCTGGG + Intronic
1012246580 6:96932992-96933014 TTCTGTATATGTAACTGCCAAGG + Intronic
1015070738 6:129089376-129089398 TTGTGCTTCTGTATTTACCAAGG - Intronic
1015982880 6:138856841-138856863 GTGTGAAAATGAATTTACCAAGG - Intronic
1016900405 6:149095550-149095572 TTATGAAGATGTATCTAACCTGG - Intergenic
1018781753 6:167074511-167074533 TTGGTAATTTGTATCTATCAAGG - Intergenic
1025924970 7:65951047-65951069 TTTAAAATATGTATATACCATGG - Intronic
1030568473 7:111190759-111190781 TTATCAATATGTATGTACGAAGG + Intronic
1037701732 8:21281502-21281524 TTGTGACTATGTACCTTCTATGG + Intergenic
1042425053 8:68638004-68638026 TTGTGGGTAGGTAACTACCAGGG + Intronic
1044169514 8:89031683-89031705 TTTTGAATATATGTCTATCAGGG - Intergenic
1044675818 8:94727697-94727719 TTGTAAAGTTTTATCTACCAGGG + Intronic
1045085890 8:98685008-98685030 CTGTGAAAATATTTCTACCATGG + Intronic
1046100337 8:109606739-109606761 TTGAGAATGTGAATGTACCAAGG - Intronic
1047628978 8:126685054-126685076 ATGTGAATTTCTATCTACCTGGG + Intergenic
1047818155 8:128487649-128487671 TTCTGACTACGTATTTACCATGG - Intergenic
1048362995 8:133714297-133714319 TTGTGATTATGGATGTACCAGGG + Intergenic
1048905877 8:139088165-139088187 TTGTGAAAATGTAGCTACTTTGG + Intergenic
1049877881 8:145038220-145038242 TTATGAATATTTATGCACCAAGG + Intergenic
1050604825 9:7289840-7289862 TTGTGCATATGTATCTTTTAGGG + Intergenic
1055867652 9:80834868-80834890 TGCTGAAAATGTATCTACCAGGG + Intergenic
1059058200 9:111006531-111006553 TTTTGAATATGTAATTACCATGG - Intronic
1060096582 9:120796127-120796149 TTTTGCATGTGTATGTACCAGGG + Intergenic
1186646627 X:11513847-11513869 TCTTTAATATGTAGCTACCAAGG - Intronic
1189662800 X:43320791-43320813 GTGTGTATATATATATACCATGG - Intergenic
1189896340 X:45660222-45660244 TGGTGTATATATATATACCATGG + Intergenic
1190462692 X:50694208-50694230 TTCTGAATATGTACCCAGCAGGG + Intronic
1191888454 X:65914920-65914942 TTGTGTATATGTATACACCATGG - Intergenic
1192089397 X:68137294-68137316 TTGTTAATCTGTATCTTCCAAGG - Intronic
1193386446 X:80877786-80877808 TTTTGAATATTTAGATACCAAGG - Intergenic
1194555009 X:95346641-95346663 TTGTGAAAATGTACATACAAGGG + Intergenic
1194804581 X:98311628-98311650 TTGTGAATATGTAGGCTCCATGG + Intergenic
1195587986 X:106587842-106587864 TTGTGAATATCTCTCATCCAGGG + Intergenic
1195695829 X:107666614-107666636 TTGCCAATCTGTATCTACAAAGG + Intergenic
1197224980 X:123948060-123948082 ATCTGAATATGTAGCTTCCATGG + Intergenic
1197669296 X:129258402-129258424 TTGTGAATAAGTATGTTTCAAGG - Intergenic
1199357570 X:146879592-146879614 TGGTGATTATGTATACACCATGG - Intergenic
1201545720 Y:15159732-15159754 TTGAGAATCTGCATCTATCAAGG - Intergenic