ID: 1007011949

View in Genome Browser
Species Human (GRCh38)
Location 6:38426521-38426543
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 5, 1: 4, 2: 6, 3: 135, 4: 333}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007011949_1007011956 14 Left 1007011949 6:38426521-38426543 CCATCCACCACTGCTGTTTTGCC 0: 5
1: 4
2: 6
3: 135
4: 333
Right 1007011956 6:38426558-38426580 ACCGCTGACTTCCATTCTTCCGG No data
1007011949_1007011959 24 Left 1007011949 6:38426521-38426543 CCATCCACCACTGCTGTTTTGCC 0: 5
1: 4
2: 6
3: 135
4: 333
Right 1007011959 6:38426568-38426590 TCCATTCTTCCGGATCCGGCAGG 0: 1
1: 6
2: 19
3: 93
4: 221
1007011949_1007011958 20 Left 1007011949 6:38426521-38426543 CCATCCACCACTGCTGTTTTGCC 0: 5
1: 4
2: 6
3: 135
4: 333
Right 1007011958 6:38426564-38426586 GACTTCCATTCTTCCGGATCCGG 0: 2
1: 4
2: 26
3: 121
4: 173
1007011949_1007011961 25 Left 1007011949 6:38426521-38426543 CCATCCACCACTGCTGTTTTGCC 0: 5
1: 4
2: 6
3: 135
4: 333
Right 1007011961 6:38426569-38426591 CCATTCTTCCGGATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007011949 Original CRISPR GGCAAAACAGCAGTGGTGGA TGG (reversed) Intronic
901292050 1:8131637-8131659 GTCAAAACAGCAGTGTGGGCCGG - Intergenic
901324546 1:8358807-8358829 GGCACAGCAGCAATGGTGGTTGG + Exonic
901760171 1:11465854-11465876 GGGAAATGAGCAGTGGCGGATGG - Intergenic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
905557668 1:38899922-38899944 GGCAGAAAAGCAGAGGAGGACGG - Intronic
906582989 1:46952010-46952032 GGGAAAACAGACGTGGTGAATGG - Intergenic
906800328 1:48731609-48731631 GGCAAAGCAGCACAGATGGAAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907934189 1:59027594-59027616 GGCAAAGGAGCAGAGGTGGTGGG - Intergenic
908121592 1:60991061-60991083 GGAAAATCTGCAGTGCTGGAGGG - Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910341817 1:86197124-86197146 TGCAAGGCATCAGTGGTGGAAGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912391778 1:109307838-109307860 GGAGAGGCAGCAGTGGTGGAGGG + Intergenic
913305387 1:117425066-117425088 GACAAAACAGGAGAGGGGGAAGG + Intronic
913393954 1:118345706-118345728 GACTAATCAGCAGTGGTGAATGG + Intergenic
914289905 1:146263504-146263526 TGCAAAAAAGCAGTTCTGGAGGG + Intergenic
914550948 1:148714287-148714309 TGCAAAAAAGCAGTTCTGGAGGG + Intergenic
915900678 1:159844565-159844587 GGGAAAAAAGCAGTGTAGGAGGG + Intronic
916310411 1:163392197-163392219 GGCAATAAATCAGTGGTGGCTGG + Intergenic
917110668 1:171544060-171544082 GGCAATGCAGCAGTGGTGAGAGG - Intronic
917196090 1:172467210-172467232 GGGAACACAGCACAGGTGGAAGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920595824 1:207268936-207268958 AGCAAATCAGCATTGATGGATGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921168934 1:212528436-212528458 GGCAAGACAGGAGAGGAGGAGGG - Intergenic
921277516 1:213534528-213534550 AGCAGAAGAGCAGTGGTTGAAGG - Intergenic
922237520 1:223733250-223733272 GGAAAGACAGCAGTAGCGGAAGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923588350 1:235295932-235295954 GCCAAAACAGCAGTGCTGAAAGG + Intronic
923641192 1:235762784-235762806 GGCATTCCAGCAGTGGAGGAAGG - Exonic
924504232 1:244666217-244666239 GGTAAAACAGTGGTGGTGGAAGG - Intronic
1063199458 10:3774064-3774086 GGCGAGACAGCAGTGTGGGATGG + Intergenic
1063275154 10:4557760-4557782 GGCAATGCAGCTGGGGTGGAGGG + Intergenic
1063370232 10:5516451-5516473 GGTAAAACAGAAGTGATGGGAGG + Intergenic
1063894270 10:10662712-10662734 AACAAACCAGCAATGGTGGAGGG + Intergenic
1064678233 10:17783091-17783113 GGCAAAACAGAAGCTGGGGATGG + Intronic
1064750528 10:18523717-18523739 GGCAAGACAGCAATAGAGGATGG + Intronic
1065100712 10:22329357-22329379 GGCAAACAAGAAGAGGTGGAGGG - Exonic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067661025 10:48236312-48236334 GGGAAAACAGCAGCAGTGGGAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069285859 10:66714587-66714609 CTCAAAAAAGCAGAGGTGGATGG - Intronic
1069555403 10:69394536-69394558 GTCACTACAGCAGTGGTGGTGGG + Intronic
1070583391 10:77742037-77742059 GGCCACTCAGCAGTGGTGGTAGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071504459 10:86224223-86224245 GTCACAACAGCATTGGTTGAAGG + Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073611263 10:104946329-104946351 GGGACAACAGCAGAGGAGGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075310324 10:121408260-121408282 TGCAATACAGCAGGGATGGATGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077756296 11:5031569-5031591 TACAAAATAGTAGTGGTGGAGGG + Intergenic
1078738684 11:14046115-14046137 GGCAAAATAACAGTGAAGGAGGG + Intronic
1079318082 11:19426743-19426765 GCCAAAACAGCAGTTGTGGGAGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080078102 11:28176082-28176104 GGAATAATGGCAGTGGTGGAAGG + Intronic
1080583044 11:33658925-33658947 GGCACAGCAGCAGTGGTGGGGGG - Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081608211 11:44540821-44540843 GGCACAAGAGCAGAGGAGGAAGG + Intergenic
1082118437 11:48352593-48352615 TGCAAAACAGCAGAGGTGAGTGG - Intergenic
1082255889 11:50032703-50032725 TGCAAAACAGCAGAGGTGAGTGG + Intergenic
1083451933 11:62752132-62752154 GACAGAGCAGCAGTGGTGGAGGG - Exonic
1083616886 11:64030707-64030729 TACAAAACAGAAGTGGAGGAGGG + Intronic
1084409864 11:69000595-69000617 GGCATAAAAGCAGAGATGGATGG + Intergenic
1084442652 11:69183798-69183820 GGCCACAGAGCAGTGCTGGAGGG + Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088887827 11:114021394-114021416 GGGAAGCCAGCTGTGGTGGAGGG + Intergenic
1090239929 11:125174810-125174832 GCCCAAATAGCGGTGGTGGAAGG + Intronic
1091070421 11:132557800-132557822 GGCAAAATAGCAGGGGTGGATGG + Intronic
1092248984 12:6881294-6881316 GTAAAAACGGCAGTGGTGGGAGG - Intronic
1092997436 12:13963372-13963394 GGCATGACAGCTGTAGTGGAGGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095126744 12:38488106-38488128 GGCAAAGCCGCAGTCGTGAAAGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097191310 12:57220861-57220883 GGCAAAACAGAGATGGGGGATGG - Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098023983 12:66183608-66183630 GGCAAAGCAGCAGAGTGGGAAGG + Intergenic
1098077946 12:66753447-66753469 AGCAGGTCAGCAGTGGTGGAAGG - Intronic
1098146636 12:67504214-67504236 GTCAAAACAACAGTGGAGGAGGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1100916710 12:99432050-99432072 GGCAAAACTCCAGTGGTGTCTGG - Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103948571 12:124540200-124540222 GGCGACCCAGCAGTGGTGGGAGG + Intronic
1105058393 12:133125548-133125570 GTCAAAAAGGCAGTGGTGAAAGG + Intronic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109198513 13:59405891-59405913 CCCAAAGCAGCAGTGTTGGAAGG + Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111195949 13:84874545-84874567 GGGAAAACATGTGTGGTGGAAGG + Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112846789 13:103653358-103653380 GGCAAGAAAGGAGTGGGGGAGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114479366 14:23022620-23022642 CGCAAAACAGCAGAGGTGCTTGG + Intronic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115339721 14:32280342-32280364 GGAAAAAAAGCAGGGGTGTAGGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116414955 14:44668383-44668405 GGCAAAACGGCAGAGTTGAATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118003773 14:61547102-61547124 TTCGAAACAGCAGTGGTGGGGGG + Intronic
1118944623 14:70372921-70372943 GGCAGAATAGCAGGGGTGGAGGG + Exonic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119453730 14:74736061-74736083 GGCAAAACAGCATCAGTGGCTGG - Exonic
1119653347 14:76399104-76399126 GTCCAAACAGCAGATGTGGATGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1123104396 14:105831571-105831593 GGAAACACAGTCGTGGTGGAAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123405962 15:20019630-20019652 GGCACAACATCATGGGTGGAGGG - Intergenic
1123515292 15:21026278-21026300 GGCACAACATCATGGGTGGAGGG - Intergenic
1123632827 15:22273927-22273949 GTCAAAACTGAAGTGGTGGCCGG - Intergenic
1123833390 15:24164612-24164634 GGCAAGTCAGCAGTGGAGAAAGG + Intergenic
1123840120 15:24239691-24239713 GGCAAGTCAGCAGTGGAGAAAGG + Intergenic
1123853063 15:24380206-24380228 GGCAAGTCAGCAGTGGAGAAAGG + Intergenic
1123881288 15:24679003-24679025 GGGAAAACAGAAGTGGTGCTGGG - Exonic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124015816 15:25874291-25874313 AGCAAAACAACAGAGATGGAGGG + Intergenic
1124067295 15:26356116-26356138 GGCAAAACAGAAGGGAGGGAGGG + Intergenic
1124415099 15:29467139-29467161 GGAACAGCAGCAGGGGTGGAGGG + Intronic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127291998 15:57579515-57579537 GGCACAACAGCAGTGATGGGAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128570707 15:68731074-68731096 GGCAAAAAACTAGGGGTGGAGGG + Intergenic
1129686503 15:77689163-77689185 GGAGAAGCAGCAGAGGTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130113754 15:80988695-80988717 AACAAAACATCAGTGTTGGAAGG + Intronic
1130822161 15:87507256-87507278 GGCCTCACAGTAGTGGTGGAAGG + Intergenic
1131148643 15:90033055-90033077 TGCAGAACAGCACTGGTGCATGG - Intronic
1131215310 15:90530596-90530618 GGCAGAACAGCAGGGCTCGATGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131922620 15:97346311-97346333 GGCTGAACTGCAGTGGTGCATGG + Intergenic
1132180264 15:99747529-99747551 GGAAAAACAGTGGTGGTGAAGGG + Intergenic
1132316377 15:100893354-100893376 GGCAAAAGTGCAGAGGTGGCTGG + Intronic
1134391362 16:13823256-13823278 AACATAACAGCAGTGGTAGAAGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1138365481 16:56472895-56472917 AGCAAAACTGCTTTGGTGGAAGG - Intronic
1139558138 16:67725606-67725628 GGCCACACAGCAGAGGTAGAGGG - Exonic
1139797892 16:69497839-69497861 GGAAAAACAGGAGCGGTGGCTGG + Intergenic
1140042747 16:71419870-71419892 GCCAAAACTCCAGTGGTTGAGGG - Intergenic
1141970232 16:87476828-87476850 GTCAAAACTGAAGTGGTGGCCGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1144161972 17:12568748-12568770 GGCCAACCAGGAGTGCTGGAGGG + Intergenic
1148011373 17:44484502-44484524 GGCAAACCAGGTGTGGTGGGTGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149039046 17:52165585-52165607 GGCAGAACAGAGGTGGGGGATGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149621994 17:58052515-58052537 GGCAAGTCAGTAGTGGTGGTTGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152009143 17:77700226-77700248 GGGAGAAGAGCAGGGGTGGACGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153699707 18:7680266-7680288 GGCAAAGGAGCAGTGGTGCCAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157634743 18:49140897-49140919 GGCAAAACAGAGGTGGTGTCTGG - Intronic
1157726172 18:49965785-49965807 GGAAAAACAGATGAGGTGGAAGG + Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158943240 18:62425580-62425602 GGGAAAACAGCAGGGAAGGAGGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160347677 18:78147476-78147498 GGCACGGCAGCAGTGGCGGAAGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165722221 19:38087720-38087742 GAAAAAACAGCAGTGTTGGCCGG + Intronic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1166266692 19:41688765-41688787 GGGAAGAGAGCTGTGGTGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925452516 2:3981784-3981806 GTCAAAACAGCTGTGGTGGGTGG - Intergenic
925456327 2:4019603-4019625 GGCAAGACAGCATTTGTGGGGGG + Intergenic
925554232 2:5111545-5111567 TGAAAAAAAGCAATGGTGGAGGG - Intergenic
925683561 2:6448387-6448409 GGGAAAAGAGAAGTAGTGGAGGG + Intergenic
925823514 2:7823606-7823628 GGCAATATGGCAGTGGTTGAGGG - Intergenic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
926884897 2:17588022-17588044 CACAAAACAGGACTGGTGGAAGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930114407 2:47706542-47706564 GGTAAAACAGCAGGGTTGGGTGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933900921 2:86849482-86849504 GGCAAATCTGCAGAGGTAGACGG + Intronic
935344427 2:102092738-102092760 GGCAAAACAGGGATGGTGGGAGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935779621 2:106499749-106499771 GGCAAATCTGCAGAGGTAGACGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937246218 2:120495725-120495747 GGCAAAACAGCAGAAATGCATGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937914080 2:127090404-127090426 AGCACAACTGAAGTGGTGGAGGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939611908 2:144321139-144321161 GGCCAACTAGCAGTGTTGGAGGG - Intronic
939812670 2:146853901-146853923 GACAAACCAGCTGTGGGGGAAGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941176339 2:162201646-162201668 GGCTAAACAGGACTGGTGAAGGG - Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942718969 2:178927675-178927697 GGCAAAAAAGGAGTGGAGGTGGG + Intronic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944191136 2:197005503-197005525 GGCATCACAGCAGCTGTGGAGGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945394995 2:209306584-209306606 AACAAACCAGCAGTGGTGGATGG - Intergenic
946098954 2:217302290-217302312 CCCAAAACAGCAGGGGTGGGGGG + Intronic
946169214 2:217884534-217884556 GGCAGAAGAGCAGTAGTGGAGGG - Intronic
1168908550 20:1426574-1426596 GGCAGAGCAGCAGTGATGGAAGG + Intergenic
1169211484 20:3768249-3768271 GTCGAAACAGGAGTGATGGAGGG - Intronic
1169297036 20:4408866-4408888 GGCAGAACAGCAGGGGAAGATGG + Intergenic
1170381451 20:15764450-15764472 GGCAAAACAGGTTTGGTGGAAGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173082097 20:39877964-39877986 GTCTGAACAGCAGTGGGGGAAGG - Intergenic
1173970121 20:47146145-47146167 GGCAAAACAGAAGAGGTGTTTGG + Intronic
1176300620 21:5097310-5097332 GGGAGACCAGCAGAGGTGGAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178763686 21:35428893-35428915 GGCAAAACCCCAGTGAAGGAGGG - Intronic
1178943331 21:36925624-36925646 GGCAACTCTGCAGGGGTGGAGGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1179730323 21:43363975-43363997 GGCAACACAGAAGTGGGGAAGGG - Intergenic
1179856423 21:44164671-44164693 GGGAGACCAGCAGAGGTGGAGGG + Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1184268692 22:43364909-43364931 GGAAAAACTGCAGGGGTGTAGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950373413 3:12550401-12550423 GGAAAAAGATCAGTGGTTGACGG + Intronic
950780385 3:15386689-15386711 GGCAAAACAGCAGAGTTTAATGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953434152 3:42865404-42865426 GGAAAAGCAGCAGTGAAGGAAGG - Exonic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954572853 3:51656609-51656631 GGCCAGTCAGCAGTGGTGGCAGG + Intronic
954911515 3:54114557-54114579 GGCCAGGCAGCAGTGGTGGGGGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957034656 3:75282634-75282656 TGCAATACAGCAATGGTGGGAGG - Intergenic
957302274 3:78407720-78407742 GGCAAAATAACTGTGGTTGAAGG - Intergenic
957499510 3:81035423-81035445 GGCAGATCAGCAGGGGTGAAGGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957956184 3:87190508-87190530 GGTACAATAACAGTGGTGGAGGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958990581 3:100839535-100839557 GTGAAAGCAGCCGTGGTGGAGGG + Intronic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960487128 3:118267838-118267860 GCCAAAACAGTAGAGCTGGAAGG + Intergenic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963265050 3:143231663-143231685 GGCAAGACAGGGGTGGAGGAAGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
966247207 3:177822762-177822784 AGCAAAACAGCAGTGAATGATGG - Intergenic
966823439 3:183943249-183943271 GTAAAAACTGCTGTGGTGGAGGG - Intronic
967035979 3:185648573-185648595 GGCAAAGTAGCAGTGTTGGGTGG - Intronic
967160838 3:186736534-186736556 GGGACAGCAGCAGTGGTGGTAGG - Intronic
968534348 4:1113820-1113842 GGCGCGACAGCAGTGGGGGAGGG + Intergenic
968623751 4:1616634-1616656 TGCAAACCAGAAGTGGTTGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969873280 4:10117482-10117504 GGCAAAAAAGGCGTGGGGGATGG + Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975322197 4:73021247-73021269 GGCTAAAAAGCAGTGCTGGAAGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975538981 4:75484453-75484475 GGCAAAACAGCAGGGGGTGGGGG + Intronic
976684300 4:87794606-87794628 GGCAAAAGAGCAGTGGAGCTGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979193318 4:117890202-117890224 GGCCAAGCAGCTGTGGTGCATGG + Intergenic
979606112 4:122640691-122640713 GGAAAAAAAGCAGAGGAGGATGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980257696 4:130403219-130403241 GGAAAAACTGCAGTGTAGGAAGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984205839 4:176786876-176786898 GGCAATAAAGCAATGGAGGAAGG + Intronic
984710474 4:182880144-182880166 GGAAAGCCAGCTGTGGTGGAGGG + Intergenic
985557912 5:566856-566878 GGCATCTCAGCAGTGGTGAAAGG + Intergenic
986347785 5:6850627-6850649 GTCAGAACAGATGTGGTGGAAGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988018425 5:25591914-25591936 GGAAAAAGAGCACTGATGGAAGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992664673 5:78995523-78995545 GGAAACACAGCAGTTGTGAAAGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996018042 5:118562804-118562826 GGGAAAACAGGAGTGGGGAAGGG + Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
1000019424 5:157306317-157306339 GGCAAAGCACCAGTGGTGAGAGG - Intronic
1000479107 5:161749220-161749242 GGCACAAAAGCAGTGGTGAGAGG - Intergenic
1001995359 5:176153038-176153060 TGCAAACTAGCATTGGTGGATGG - Intergenic
1003157185 6:3606880-3606902 GACAGAACAGCAGAGGAGGAGGG - Intergenic
1003721440 6:8707523-8707545 GGGAAATGATCAGTGGTGGAAGG + Intergenic
1004145344 6:13060832-13060854 GGCAAAACTCCAGTTCTGGATGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004304292 6:14486681-14486703 CGTAAAACAGCACTGGTAGATGG - Intergenic
1004398661 6:15268687-15268709 TACAAAACAGCAGGGGAGGATGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005891579 6:30144574-30144596 GGCAAAGAAGCAGTGGCAGAAGG + Intronic
1006193224 6:32222092-32222114 GGGAAGACTGCAGTGGTGGGAGG - Intronic
1006913272 6:37578148-37578170 GACAATACAGCAGGGATGGAGGG + Intergenic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007598574 6:43067121-43067143 GCCAAAACAGCAATGGTGGGGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009765687 6:68072057-68072079 TGCAAAACACCAGTAGTGGAGGG + Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013842929 6:114419573-114419595 GATAAAACAGAAGTGGTGCATGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015611487 6:135025477-135025499 GGCAAAACAGAAGCAGTGAAAGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015844042 6:137499010-137499032 GGGAAAATAGCAGAAGTGGAAGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016485610 6:144534899-144534921 AGTAAAACAGCAGAGGTGGGAGG + Intronic
1017383912 6:153861192-153861214 GGCAACCCAGCTGTGGTGGTGGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022891697 7:34707716-34707738 AGCAATGCAGCAGTGGTAGAGGG + Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023054849 7:36283267-36283289 GGCAAGAAACCAGCGGTGGAAGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026185459 7:68079575-68079597 GGCAAGACTGGAGGGGTGGAAGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026946597 7:74320227-74320249 GGAAAAAGAGCAGTGGGGGCCGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029673523 7:102050293-102050315 GGCATAAAAGCAGTGCTGGATGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030353706 7:108520176-108520198 AGCAAACCGGCAGAGGTGGAAGG + Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032400393 7:131620342-131620364 GATAAACCAGCAGAGGTGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034837126 7:154362921-154362943 TGCAAAACTGCAGTGATGGTTGG - Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1038698402 8:29826860-29826882 AGCAGAAATGCAGTGGTGGAAGG + Intergenic
1038804351 8:30776677-30776699 GGCAGATCAGCAGCAGTGGAGGG - Intronic
1039302295 8:36222398-36222420 AGCAAACCATCAGTGGTGAAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1040830485 8:51671295-51671317 AGAAAAACAGCAGTTGTGCATGG + Intronic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042008157 8:64206109-64206131 GGCATAATAACTGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042783141 8:72514157-72514179 GGTAAAAAAGCACTGGTGCATGG - Intergenic
1043675898 8:82953180-82953202 GGCAAAACTACATTGGTGAATGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045879424 8:107020706-107020728 GGCAAAAGCACTGTGGTGGATGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048579502 8:135719441-135719463 GGCAGAGCAGCAGGGATGGAAGG + Intergenic
1048879536 8:138861091-138861113 GGCAAACCAGCAGAAGTGGTTGG - Intronic
1049839398 8:144761392-144761414 GGCAGGGCAGCACTGGTGGACGG + Intergenic
1050440569 9:5658766-5658788 GCCATAACAGCTGTGGAGGAGGG - Intronic
1051250160 9:15151178-15151200 GGCACAATAGCAGGGGTAGAGGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052887033 9:33659572-33659594 GGCAAAGAAGCAGAGTTGGAAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055352095 9:75400020-75400042 CACAAAACAGCACTGGGGGATGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1057116950 9:92533385-92533407 GGCAAGCAAGCAGTGGGGGATGG - Intronic
1059779610 9:117512657-117512679 GGCAAAAGAGGAGTGGTGACTGG + Intergenic
1060778112 9:126391573-126391595 AGCAAAACTGCAGGGGTGGGAGG + Intronic
1062711008 9:137975220-137975242 GGCACAGCAGCAGTGGAGGGGGG - Intronic
1185492194 X:526237-526259 GGTAAGACAGCAGGGGTGGGGGG + Intergenic
1185917167 X:4048198-4048220 GGAAAAACACCAGTGATAGAGGG + Intergenic
1187149534 X:16669082-16669104 GGAAAAGCAGCAGTGGGGGGTGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191729083 X:64314592-64314614 GGCGGTACAGCAGCGGTGGAGGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194727652 X:97416984-97417006 GACAAACCAGCAATGGAGGAGGG + Intronic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195981128 X:110579693-110579715 GGTAAAACAGCAATAGGGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197726593 X:129780886-129780908 GGAAAAACAGCTGTCATGGATGG + Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198074139 X:133178730-133178752 GGCAAAAGAGCAGTAGAGGAGGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1200144631 X:153920371-153920393 GGCAGAACAGCAGAGCTGCAGGG + Intronic