ID: 1007013301

View in Genome Browser
Species Human (GRCh38)
Location 6:38438271-38438293
Sequence TACTACTGGATTGCAGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007013301 Original CRISPR TACTACTGGATTGCAGCTTA TGG Intronic
905696968 1:39981669-39981691 CACTACTGTACTCCAGCTTAGGG - Intergenic
908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG + Intronic
909764545 1:79339094-79339116 GACTACTGGATTCCAGTCTATGG + Intergenic
910814861 1:91280923-91280945 TACCACTACATTGCTGCTTAGGG + Intronic
911443886 1:97966406-97966428 TACTAATGGTTTGCAGGTTGAGG - Intergenic
918797923 1:188929149-188929171 TCCTTCTGGATTGAAGATTATGG + Intergenic
922085652 1:222344509-222344531 TGCTATTAGATTGCAGCATAGGG - Intergenic
923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG + Intronic
924262417 1:242245843-242245865 CACCACTGGTTTGCATCTTAAGG + Intronic
1065783515 10:29192205-29192227 TTCTACTGGAAGGCAGCTTTGGG + Intergenic
1066281823 10:33925142-33925164 CATTACTGGATAGCAGTTTAGGG + Intergenic
1068586750 10:58808755-58808777 TGCCACTGCACTGCAGCTTAGGG - Intronic
1068879190 10:62030654-62030676 TTCTTCTGGATAGCTGCTTAAGG + Intronic
1073521216 10:104131377-104131399 TTCTCGTAGATTGCAGCTTAGGG + Exonic
1074754701 10:116615713-116615735 TGCTACTGGGTGGCAGCCTAGGG + Intergenic
1075499386 10:122958639-122958661 TACTGTTGGGTTGCAGGTTAAGG + Intronic
1080047637 11:27826374-27826396 TACCACTGGATTGCTGCTTTAGG + Intergenic
1080385475 11:31808493-31808515 TACTACTCCTTTGCAGCTTCAGG - Intronic
1083988132 11:66230319-66230341 ATTTACTGGATTGCAGCATATGG + Intronic
1092012365 12:5125182-5125204 TACTTCAGGATTGCAGTTAAGGG + Intergenic
1096516661 12:52159841-52159863 TACCACTGCATTTCAGCCTAGGG - Intergenic
1098383171 12:69890691-69890713 TGCTACTGCACTCCAGCTTAGGG + Intronic
1104548552 12:129734017-129734039 TGATACTGGATTGCAGCTGTGGG - Intronic
1108246653 13:48522155-48522177 AACTACTGGATGGCCTCTTACGG + Intronic
1108538655 13:51414123-51414145 TACAACTGGATTTCAGCCTGTGG - Intronic
1115287852 14:31736726-31736748 GACTGCTGGATTTTAGCTTAGGG + Intronic
1116940798 14:50789024-50789046 GACTTCTGGATCCCAGCTTAGGG - Intronic
1120637267 14:86967648-86967670 TACTACTGTATTTCACATTAGGG - Intergenic
1125149850 15:36519315-36519337 TACCACTGCACTCCAGCTTAGGG + Intergenic
1126962959 15:54018506-54018528 TCCTACTGGAATGCTGTTTAAGG - Intronic
1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG + Intronic
1146020147 17:29271052-29271074 TACTTCTTTACTGCAGCTTAAGG + Intronic
1146275861 17:31515201-31515223 TTCTACTGGGATGCAGCTTCAGG + Intronic
1148432473 17:47653247-47653269 TACTTCTGGAGTACAGCTCAGGG + Intronic
1155650478 18:28134667-28134689 TACCACTGCACTGCAGCTTGGGG + Intronic
1158550049 18:58428245-58428267 CACTACTGCATTCCAGCCTAGGG + Intergenic
1167789455 19:51664089-51664111 TAGTACTGGATTGCAACTAGAGG + Intergenic
925705107 2:6677286-6677308 TGCTTCTGGATTGAATCTTAGGG - Intergenic
926408402 2:12577084-12577106 TCCTGCTGGACTGCAGCTTGAGG - Intergenic
930160159 2:48146605-48146627 TACCACTGCACTCCAGCTTAGGG - Intergenic
933336202 2:80962957-80962979 TACCACTGTATTCCAGCCTAGGG + Intergenic
934178834 2:89601631-89601653 TACTCCTTGATTGCAGCCTTTGG - Intergenic
934289121 2:91675917-91675939 TACTCCTTGATTGCAGCCTTTGG - Intergenic
937091034 2:119206413-119206435 TCCTTCTTGAGTGCAGCTTATGG + Intergenic
937999491 2:127720604-127720626 TACCACTGCATTCCAGCTTGGGG - Intronic
939323738 2:140659392-140659414 TTCTACTCGATTACAGCTAATGG + Intronic
939501116 2:142986100-142986122 TCCTATTGGATAGCATCTTAAGG - Intronic
947037690 2:225877992-225878014 TTCTATTGGAATGCATCTTAAGG - Intergenic
1172966763 20:38841210-38841232 TACAACTGGATTGTGGCTGATGG - Intronic
1173545218 20:43892542-43892564 AACCACTGAATTGCAGTTTAAGG + Intergenic
1174372504 20:50101964-50101986 TACTACTGGACTTTACCTTAAGG + Intronic
1183127691 22:35800472-35800494 TTCTACTTGATTGAAGCTTTAGG - Intronic
949678315 3:6483433-6483455 TACTACTGCTTTGGAACTTAAGG + Intergenic
951165670 3:19482797-19482819 TACTACTTGCTAGCAGCTGAAGG - Intronic
951819954 3:26797180-26797202 TACTACTGGACTGCAGACTTTGG + Intergenic
956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG + Intergenic
957450769 3:80379035-80379057 TACTAGTGGTTTGCAGCCTAAGG - Intergenic
957915387 3:86682261-86682283 ATCTACTGGATTGCAGCCTAAGG - Intergenic
959803249 3:110521085-110521107 TTCTATTGGATTGCAGTTTCTGG + Intergenic
960280611 3:115777652-115777674 CACTACTGGACAGCTGCTTATGG - Intergenic
963288925 3:143466683-143466705 TCCTACTGGATTGTATCTTGAGG + Intronic
969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG + Intronic
970836939 4:20420723-20420745 TACCACTGCATTGGAGGTTAGGG - Intronic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
981556014 4:145995340-145995362 TACCACTGTATTCCAGCCTAGGG - Intergenic
989963649 5:50444042-50444064 TATTAGTGGATTGCAACTCAGGG + Intergenic
991091647 5:62699249-62699271 TACAACAGGATGGCAGCTTCTGG - Intergenic
993090449 5:83419872-83419894 TAATACTGGATTGAACCTTGTGG - Intergenic
1003819085 6:9876007-9876029 TACGACTGCATTGGAGGTTAGGG - Intronic
1005429858 6:25744136-25744158 TATGACTGGATGGCAGCTTAAGG + Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1016955054 6:149618578-149618600 TACTAGAGCATTGCAGTTTAGGG - Intronic
1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG + Intronic
1022370470 7:29766300-29766322 TACTTCTGGATTGAAGAGTATGG - Intergenic
1026357588 7:69572627-69572649 TACTACTGCACTCCAGCTTTAGG + Intergenic
1033927473 7:146481078-146481100 TACTACTGGCTGGCAGTTTCAGG - Intronic
1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG + Intronic
1039026906 8:33268400-33268422 TGCTACTGCATTCCAGCCTAGGG - Intergenic
1050456686 9:5841184-5841206 TACTTCTGGCTTTCTGCTTATGG - Intergenic
1052180005 9:25514227-25514249 TAATATTGAATTGCAGCTTTTGG - Intergenic
1052524071 9:29590228-29590250 AAGTACAGGATTGCAACTTAGGG + Intergenic
1057740186 9:97704480-97704502 TACTACATGAATGCAGCTTAAGG - Intergenic
1058157125 9:101528410-101528432 TAAAACTGGATTTCAGCTGAGGG - Intronic
1058993267 9:110275082-110275104 TACTACTGCATTCCAGCCTGGGG + Intergenic
1188462779 X:30447946-30447968 TTGTACTGGATTGCTACTTAAGG + Intergenic
1192965754 X:76174824-76174846 TACTACTGAATAGCAAATTAAGG - Intronic
1194752563 X:97701328-97701350 CACTACTGGATTGGAGGTCATGG - Intergenic
1196937559 X:120744791-120744813 TGATACTGGATTTCAGTTTATGG - Intergenic
1198606823 X:138349219-138349241 TACTAGTTGATTGCATGTTAAGG + Intergenic
1199239205 X:145526767-145526789 GACTACTGGATAGCAGCTCTGGG + Intergenic