ID: 1007017600

View in Genome Browser
Species Human (GRCh38)
Location 6:38484396-38484418
Sequence CTCAAATAGTAGTCAGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007017600_1007017601 8 Left 1007017600 6:38484396-38484418 CCTGGGACTGACTACTATTTGAG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1007017601 6:38484427-38484449 CAGTTCCTGAAGAAGAATACTGG 0: 1
1: 0
2: 0
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007017600 Original CRISPR CTCAAATAGTAGTCAGTCCC AGG (reversed) Intronic
901532656 1:9863375-9863397 CTGAAATTATAGTCAGGCCCAGG - Intronic
906422733 1:45684329-45684351 TTTAAACAGCAGTCAGTCCCTGG + Intronic
909267131 1:73575105-73575127 CTGAAATAGTAGTTAGTTCAAGG - Intergenic
920732806 1:208503758-208503780 CTCAAATATTAATCATGCCCGGG - Intergenic
1063226999 10:4025142-4025164 CTCAAATTCTTGTCATTCCCAGG - Intergenic
1064101211 10:12465973-12465995 CTCAAATATTTGTCAATTCCTGG - Intronic
1079963128 11:26948471-26948493 CTTAACTAATGGTCAGTCCCAGG + Intergenic
1081691687 11:45082625-45082647 CTCAAATGCTGGTCAGTCCAGGG - Intergenic
1081943384 11:46964883-46964905 CCCCAATTTTAGTCAGTCCCGGG - Intronic
1089656071 11:119947852-119947874 TTCAAATAGTAGGCAGTCAGGGG + Intergenic
1091971946 12:4794765-4794787 CTCACATTGTATTCACTCCCTGG + Intronic
1106354499 13:28967244-28967266 TTAATATAGTAGTCAGGCCCAGG - Intronic
1119333169 14:73810579-73810601 TTGAAATAGTAGTCAGGGCCAGG + Intergenic
1128343219 15:66837058-66837080 CTCAAATATCTTTCAGTCCCAGG - Intergenic
1128969865 15:72099137-72099159 CTCAAAAAGTAGCCAGGTCCAGG + Intronic
1133901142 16:9976239-9976261 CTCACATAGTAGTCATGCCATGG - Intronic
1140241350 16:73203810-73203832 CTCAAATGGGAGTCATGCCCAGG - Intergenic
1146940319 17:36839711-36839733 CACAAATAGCAGTCAGGGCCAGG - Intergenic
1149558410 17:57590844-57590866 CTCCCCTAGTTGTCAGTCCCTGG + Intronic
1160310275 18:77783215-77783237 CTCAAATAGTAGGCAGGTGCTGG - Intergenic
1161647684 19:5464178-5464200 TTCAAACAGTGGTGAGTCCCAGG + Intergenic
926632388 2:15148265-15148287 CCCAAAGGGTAGTCAGACCCAGG + Intergenic
932657639 2:73624289-73624311 CTCAGATATGAGTCAGCCCCAGG + Intergenic
933249094 2:80008410-80008432 CTTAATTAGTAGTGAGTGCCTGG - Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
938183552 2:129207105-129207127 CTGAGATAGGATTCAGTCCCAGG - Intergenic
942749681 2:179273848-179273870 CCCAAATAGGAGTCACTGCCAGG + Intergenic
944981761 2:205128771-205128793 CAAAAATAGTGGTTAGTCCCAGG - Intronic
946350761 2:219150384-219150406 CTCAATTGGGAGTCAGTGCCAGG - Intronic
1169984635 20:11430291-11430313 CTCAAATACCAGGCAGGCCCAGG + Intergenic
1171474681 20:25399351-25399373 CTCAGAGAGGAGTCAGCCCCTGG - Intergenic
1172147255 20:32765149-32765171 CTCAATTAGTAGTATGTGCCTGG - Intronic
1173448599 20:43142445-43142467 CTCAAAGAAGAGTGAGTCCCAGG + Intronic
1174375758 20:50125403-50125425 CTCAAATATAAGTAAGTGCCTGG - Intronic
1177048215 21:16198714-16198736 ATCAAAGAGCAGTCTGTCCCAGG + Intergenic
1180559778 22:16606501-16606523 CTCAAATATTAGAAATTCCCTGG - Intergenic
956446801 3:69333768-69333790 CTCAAAAAATAGTCATTCACTGG - Intronic
963187156 3:142431143-142431165 CTCCAATAGTAGTCTGCCCTGGG - Intronic
965834721 3:172838675-172838697 GTCCAATAATAGTAAGTCCCTGG + Intergenic
970005854 4:11410159-11410181 CTAAAATTGTACTGAGTCCCTGG + Intronic
973861199 4:55066669-55066691 CTCAATTAAAAGTTAGTCCCAGG - Intergenic
975737614 4:77397015-77397037 GACATATAGGAGTCAGTCCCTGG - Intronic
994426532 5:99595344-99595366 CTAAAACTGTAGACAGTCCCTGG + Intergenic
995061142 5:107812923-107812945 CTCCCATGGAAGTCAGTCCCTGG - Intergenic
997001854 5:129771149-129771171 CTAAATTAGATGTCAGTCCCAGG + Intergenic
1007017600 6:38484396-38484418 CTCAAATAGTAGTCAGTCCCAGG - Intronic
1012038885 6:94178141-94178163 CTTAAATGGTATTCAGTCACAGG - Intergenic
1017099406 6:150834461-150834483 CTGAAAAAGTAGTAATTCCCTGG + Intronic
1022925371 7:35051321-35051343 CTCAAATAGAGATCAGTGCCAGG - Intergenic
1023462757 7:40418539-40418561 CTCAAATTTTAGTCAGGCACAGG + Intronic
1024522677 7:50319821-50319843 CTCAAATATAAGTCAGCCTCTGG - Intronic
1026804886 7:73423637-73423659 CCCAGGTAGCAGTCAGTCCCTGG - Intergenic
1029366567 7:100120134-100120156 CTCTAAAAGTTGGCAGTCCCGGG - Intronic
1029434990 7:100558837-100558859 CTCAAAAAGCAGTCAGTCACTGG + Intronic
1029823388 7:103166019-103166041 CTCAAATAGAGATCAGTGCCAGG - Intergenic
1030957482 7:115872937-115872959 CTCCTATCCTAGTCAGTCCCTGG + Intergenic
1034617461 7:152431295-152431317 CTCAAATATTAGAAATTCCCTGG + Intronic
1036504190 8:9340478-9340500 CACTAATAGTAGTCAGCCACTGG + Intergenic
1037514407 8:19616475-19616497 ATCAAATATTAGCCAGTCCTTGG - Intronic
1038183263 8:25248627-25248649 CAAAAATAGTATTCTGTCCCGGG - Intronic
1038201253 8:25414880-25414902 GTCAATTTGTAGTCAGTCCCTGG + Exonic
1038823458 8:30975064-30975086 CCCCATTAGTTGTCAGTCCCTGG - Intergenic
1043864039 8:85355122-85355144 CTCAACTAGTGGTCAGTATCAGG - Intronic
1046982823 8:120355100-120355122 GACAAATAGTAGTCAATCACTGG - Intronic
1048221787 8:132548990-132549012 CTGAATTAGTAGTCTGGCCCTGG + Intergenic
1048235502 8:132685918-132685940 AGCAAATAGTATTGAGTCCCTGG + Intronic
1048653809 8:136512521-136512543 CTCCAACAGTAGTCATTCCCAGG + Intergenic
1052409053 9:28099223-28099245 CTCCACTGATAGTCAGTCCCAGG - Intronic
1053398680 9:37799272-37799294 CTCAAATAGTTGTCCTACCCCGG + Intronic
1060211372 9:121712516-121712538 CTCAAATAGGAATCACTCCCAGG - Intronic
1060841471 9:126796534-126796556 GGCACATAGTAGTCAGTCACTGG - Intergenic
1188432658 X:30122596-30122618 CTTAAATAATAATGAGTCCCGGG - Intergenic
1190385058 X:49877559-49877581 CTTCAATGGTAGACAGTCCCAGG + Intergenic
1192171799 X:68860392-68860414 GTCATACAGCAGTCAGTCCCTGG + Intergenic
1192189002 X:68979281-68979303 CCCAAATAGAGGTCAGTCCCTGG + Intergenic
1193187981 X:78536174-78536196 CTCAAATGTTAGCCAGTCCCAGG + Intergenic
1195504236 X:105638523-105638545 CTCTAAAAGGAGTCCGTCCCTGG - Intronic
1196614321 X:117750371-117750393 CTCAAATAGTATTTAGTACCTGG - Intergenic
1198363597 X:135919116-135919138 CTGAAATAGTATTCTTTCCCAGG + Intergenic
1200338094 X:155373698-155373720 TTCAAATTGTAGTCTTTCCCCGG - Intergenic
1200348375 X:155466994-155467016 TTCAAATTGTAGTCTTTCCCCGG + Intergenic