ID: 1007017898

View in Genome Browser
Species Human (GRCh38)
Location 6:38487961-38487983
Sequence GGGTGCACAAAGTATGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007017895_1007017898 0 Left 1007017895 6:38487938-38487960 CCTCTGCTCTAGATCTTAAAAAT 0: 1
1: 0
2: 2
3: 34
4: 302
Right 1007017898 6:38487961-38487983 GGGTGCACAAAGTATGAAATAGG No data
1007017893_1007017898 23 Left 1007017893 6:38487915-38487937 CCTTTACCAAAAACATTTGTTGA 0: 1
1: 2
2: 5
3: 72
4: 517
Right 1007017898 6:38487961-38487983 GGGTGCACAAAGTATGAAATAGG No data
1007017894_1007017898 17 Left 1007017894 6:38487921-38487943 CCAAAAACATTTGTTGACCTCTG 0: 1
1: 0
2: 0
3: 12
4: 250
Right 1007017898 6:38487961-38487983 GGGTGCACAAAGTATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007017898 Original CRISPR GGGTGCACAAAGTATGAAAT AGG Intronic
No off target data available for this crispr