ID: 1007020853

View in Genome Browser
Species Human (GRCh38)
Location 6:38519772-38519794
Sequence GAAATGGCAGGGATGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007020853_1007020857 5 Left 1007020853 6:38519772-38519794 CCTAGCTGCATCCCTGCCATTTC 0: 1
1: 0
2: 7
3: 39
4: 314
Right 1007020857 6:38519800-38519822 TTACATAAGCCAAGAACTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 213
1007020853_1007020859 28 Left 1007020853 6:38519772-38519794 CCTAGCTGCATCCCTGCCATTTC 0: 1
1: 0
2: 7
3: 39
4: 314
Right 1007020859 6:38519823-38519845 TTTGCACCTAAGCTAGATCAAGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007020853 Original CRISPR GAAATGGCAGGGATGCAGCT AGG (reversed) Intronic
900007202 1:68350-68372 GAATTGGAAGGGAGGGAGCTTGG - Intergenic
900776230 1:4587371-4587393 TAAATGGCAGGGTTGGCGCTGGG + Intergenic
902922695 1:19676515-19676537 GAAATGGCAAGGAGGTTGCTGGG - Intronic
902923386 1:19680421-19680443 GGAAAGGCAGGGCAGCAGCTTGG - Intergenic
902985540 1:20152181-20152203 AAAAGGGGATGGATGCAGCTGGG + Intergenic
903065736 1:20698301-20698323 GGAAGGGCAGGGCTGCCGCTGGG - Intronic
903164954 1:21513920-21513942 GTAATGTCAGGGAGGCAGGTGGG - Intronic
903397441 1:23012666-23012688 GAAATGGCAGGTGTGCTACTTGG + Intronic
903473548 1:23604200-23604222 TACATGGCAGGGATGGAGATGGG + Intronic
903626075 1:24731076-24731098 GTTGTGGCAGGGAAGCAGCTGGG + Intergenic
903654316 1:24939807-24939829 GAAGTGGGAGGGTTGCAGCTAGG + Intronic
903849861 1:26299595-26299617 GTAATGGGAGGGCAGCAGCTTGG + Intronic
905368891 1:37472114-37472136 GAACTGGCTAGGAAGCAGCTGGG + Intergenic
905543751 1:38781265-38781287 GAAAAGTCAGGCAAGCAGCTTGG - Intergenic
906659832 1:47574302-47574324 AAAATGGGAGGGAGGCAGCAGGG - Intergenic
907757150 1:57321768-57321790 GAAGTGCCAGGTATGCTGCTAGG - Intronic
907885182 1:58586382-58586404 GCCATGCCAGGGATGTAGCTTGG - Intergenic
908573682 1:65437053-65437075 CAAATGGCAAGGCTGCAGCAGGG - Intronic
909768243 1:79385797-79385819 GAAATGGCAGGGATGAAATATGG + Intergenic
914407703 1:147392708-147392730 TAAAAGGCAGGGATTCAGATTGG - Intergenic
915062398 1:153197054-153197076 GACTTGGCAGGGAGGTAGCTGGG - Intergenic
916289215 1:163145666-163145688 GAAATGGCATGTATTCAGCAGGG + Intronic
917450110 1:175141013-175141035 GAACTGGCATGCATGCAGCCTGG + Intronic
919136902 1:193520650-193520672 GACATGGCAGGGAAGGAGCAAGG + Intergenic
922573050 1:226644974-226644996 GGAAGGGCTGGGCTGCAGCTGGG + Intronic
922920187 1:229295367-229295389 AATAGGGCAGGGATGCAGGTGGG + Intronic
923419188 1:233795897-233795919 GAAAAGGCAGGGAAGCTGGTGGG + Intergenic
923466148 1:234249134-234249156 GGAGTGGCAGGGCTGGAGCTAGG + Intronic
924223086 1:241898269-241898291 GACATGGCTGGGATCCGGCTGGG + Intergenic
1063566323 10:7174625-7174647 GGAATGGCAGGGAAGGAGCAGGG - Intronic
1065100484 10:22325902-22325924 GAAATGCCAGGGATGCAGGGAGG + Intronic
1068644111 10:59446438-59446460 GAAAGAGCAGGCATTCAGCTGGG - Intergenic
1069390344 10:67928555-67928577 TTAATGGCAGGGATGAAGGTTGG - Intronic
1069765940 10:70859921-70859943 GGAATGGTAGGTATGCAGGTGGG - Intronic
1071248767 10:83793438-83793460 GAAAATGCAGGGATTCATCTGGG - Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1072205608 10:93202575-93202597 GAAATGGGAGAGAGGCAGATGGG + Intergenic
1074186230 10:111101622-111101644 GAAATGGCAAGGATGTCTCTTGG - Intergenic
1074393184 10:113074867-113074889 CACAGGGCAGGGATGCTGCTAGG + Intronic
1075481870 10:122789108-122789130 GACAGGTCAGGGATGCAGCCTGG - Intergenic
1076140703 10:128076915-128076937 TAAATGGGAGGTAGGCAGCTAGG - Intronic
1076490594 10:130858810-130858832 GAAAGGGAAGGGTTGCAGCCTGG + Intergenic
1076677786 10:132156400-132156422 GAGAGGGCTGGGATCCAGCTAGG + Intronic
1077023543 11:430182-430204 GAAGGGGCAGGGATGAGGCTGGG + Intronic
1077245255 11:1533795-1533817 GAAATGGGAGGGGTGTCGCTAGG + Intergenic
1078746017 11:14114934-14114956 GACCTGTCAGGGAGGCAGCTTGG - Intronic
1079308286 11:19343903-19343925 GATCTGGCAGAGATCCAGCTGGG + Intergenic
1080161649 11:29183858-29183880 GAAAAGGAAAGGATGCAGCAAGG - Intergenic
1081409824 11:42744773-42744795 GAAATACCAGGGAGTCAGCTAGG - Intergenic
1081789851 11:45774900-45774922 GAAGAGGCAGGAATGGAGCTGGG - Intergenic
1083558405 11:63651598-63651620 GGAATGGCAGGGAGGCCGGTGGG - Intronic
1083911758 11:65713882-65713904 GAAAAGGAAGGGATGCAGGCAGG + Intronic
1084451951 11:69244316-69244338 GAGGTGGAAGGGATGTAGCTTGG + Intergenic
1084606794 11:70177074-70177096 GAAATGGGAGGGATGAGGCGGGG - Intronic
1084893380 11:72248286-72248308 GAAATGGCAGGGCTTAAGCCAGG - Intergenic
1086123539 11:83326467-83326489 GCCATGGCAGTGATGCAGGTGGG + Intergenic
1087349854 11:97018240-97018262 GAAATTTCAGGGAAGCAGGTTGG + Intergenic
1087513282 11:99125624-99125646 GAAATTACAGGCATCCAGCTAGG + Intronic
1089129271 11:116199419-116199441 GACCTGGCAGGGAAGCAGCTGGG + Intergenic
1089198841 11:116711251-116711273 GAAGGGGCAGGGATAGAGCTGGG - Intergenic
1089754282 11:120674891-120674913 GAAATCTCAGGCATGCAGCCTGG + Intronic
1089840472 11:121413158-121413180 GACAGGGTAGGGATGGAGCTTGG + Intergenic
1089864119 11:121616849-121616871 AAGGTGGCCGGGATGCAGCTTGG + Intronic
1089934511 11:122349945-122349967 AAAATGGGAGGAAGGCAGCTTGG - Intergenic
1090273918 11:125406422-125406444 GCAATGGAAGGGGTTCAGCTGGG - Intronic
1090661867 11:128888259-128888281 GAAAGGGAAGGGTTGCTGCTGGG - Intergenic
1091082187 11:132681408-132681430 GACATGGGAGAGAAGCAGCTTGG + Intronic
1091969776 12:4776775-4776797 CAAATCCCAGGAATGCAGCTTGG + Intronic
1092654867 12:10673887-10673909 GGAATGGCAGCGAGGCAGCTGGG - Intronic
1095406160 12:41869668-41869690 GAAAAGGCAGGAATGCAGGGGGG - Intergenic
1095708099 12:45259512-45259534 CAATTGGCAGGGATGCCCCTGGG + Intronic
1098009533 12:66035899-66035921 GAAATGGCAAGGAGAGAGCTTGG + Intergenic
1098587829 12:72175552-72175574 GGAAAGGCAAGGATGCAGCCGGG - Intronic
1100473746 12:94916790-94916812 AAAATGGCAGGACTGCAGCTGGG - Intronic
1101313140 12:103602264-103602286 GTAATGACATGGATGCATCTCGG - Intronic
1101345605 12:103883252-103883274 GGAATGGAAGGGAAGCAGATAGG + Intergenic
1102742660 12:115222071-115222093 CAAATTGCAGGGTTGCAGTTAGG - Intergenic
1103026187 12:117576187-117576209 TAGATGACAGGGATGTAGCTGGG - Intronic
1103184552 12:118945212-118945234 TAAAGGTCAGGGATGCTGCTTGG - Intergenic
1103849615 12:123923880-123923902 GAGATGGGAGGAATGAAGCTAGG - Intronic
1104090907 12:125516966-125516988 GAAATGGCAGGGGTGCAGGTGGG + Intronic
1104820501 12:131674661-131674683 GACATGGGAGAGATGCTGCTGGG + Intergenic
1105520298 13:21125162-21125184 GGCATGGCAGGGAAGCCGCTGGG - Intergenic
1105576603 13:21658909-21658931 GAGGTGTCAGGGAAGCAGCTGGG + Intergenic
1106125828 13:26899386-26899408 GAAATGGCAGAGATGCTTCTGGG - Intergenic
1106207830 13:27616052-27616074 AAGATGGTAGGGGTGCAGCTTGG + Intronic
1107594913 13:41953019-41953041 GACCTGGCAGGGAGGGAGCTGGG + Intronic
1107962516 13:45571072-45571094 GGATAGGCAGTGATGCAGCTTGG - Intronic
1108742024 13:53348082-53348104 GGAATGGCAGGGAGCCAGCCTGG - Intergenic
1109189111 13:59304514-59304536 GCACTGGTAGGGAAGCAGCTTGG + Intergenic
1111985783 13:95065778-95065800 GAATTTGCAGGGATACAGGTGGG - Intronic
1112417309 13:99214412-99214434 GAAATGGCAGGGCTGACTCTAGG + Intronic
1112862578 13:103850800-103850822 GAAGTAACAGGGATGCAGTTTGG - Intergenic
1112982166 13:105398585-105398607 AAAATGTCAAGGTTGCAGCTAGG + Intergenic
1113373339 13:109741990-109742012 GACATGGCAGGAAGGGAGCTGGG - Intergenic
1114970047 14:28015484-28015506 GAAAGGGTAGGGATGAAGCTAGG + Intergenic
1115430195 14:33308359-33308381 AAAATGGAAGTGATGAAGCTTGG + Intronic
1117401113 14:55358995-55359017 GACATGGCAGGGAAGGAGCCAGG + Intronic
1120800588 14:88683978-88684000 GAAATAGCAGGCATCCAGATTGG + Intronic
1121082241 14:91117764-91117786 GACATGGTTGGGATACAGCTTGG + Intronic
1121867490 14:97376662-97376684 GAAGTGGCTGGGATGAGGCTGGG - Intergenic
1122308937 14:100782696-100782718 GAAATGGCCCAGTTGCAGCTGGG + Intergenic
1122415777 14:101548876-101548898 GGAAGGGCAGGGAGGCATCTGGG - Intergenic
1124430111 15:29599866-29599888 TAAAGGGCAGGGCTGCTGCTCGG - Intergenic
1125433710 15:39624627-39624649 GAAAAGGGAGGGAAGGAGCTAGG - Intronic
1125545186 15:40498179-40498201 GAAATGGCAGAGAGGATGCTGGG - Intergenic
1127869308 15:63057406-63057428 GAAATGTCAGGGATACAAGTTGG + Intronic
1128840023 15:70842517-70842539 GAAATGTCTGGCATGCAGTTAGG - Intronic
1129298417 15:74612220-74612242 GAAATGGCAGGGGAGCATTTGGG + Intronic
1129444445 15:75606959-75606981 GAAATGGCAGGGGTGTAGGCTGG - Intronic
1130461430 15:84160235-84160257 GATAGGGCAGGGATGGAGCTTGG - Intergenic
1131173154 15:90192375-90192397 GACATGGCCTGCATGCAGCTGGG + Intronic
1131247830 15:90811080-90811102 CATATGGCAGGGAAGCAGCTAGG + Intronic
1132446352 15:101923778-101923800 GAATTGGAAGGGAGGGAGCTTGG + Intergenic
1132554599 16:566965-566987 CCACTGGCAGGGACGCAGCTGGG - Intergenic
1132672288 16:1106763-1106785 GGCATGGCAGGGATGCAGTGGGG - Intergenic
1132777718 16:1605000-1605022 GAGATGTCAGGAAGGCAGCTGGG + Intronic
1133162355 16:3920461-3920483 GGAATGGCAGGGAGGCCTCTGGG + Intergenic
1133897235 16:9941541-9941563 GTAATGGGAGAGATTCAGCTTGG - Intronic
1134314128 16:13102578-13102600 GCAAAGTCAGGGTTGCAGCTGGG + Intronic
1134518974 16:14909566-14909588 GGCAGGGCAGGGATGCAACTGGG + Intronic
1134554955 16:15156658-15156680 GACAGGGCAGGGATGCAACTGGG - Intergenic
1134706645 16:16308221-16308243 GGCAGGGCAGGGATGCAACTGGG + Intergenic
1134871850 16:17659095-17659117 AAAAGGGCAGGAATGCAGGTGGG + Intergenic
1134960895 16:18403903-18403925 GGCAGGGCAGGGATGCAACTGGG - Intergenic
1134965197 16:18486506-18486528 GGCAGGGCAGGGATGCAACTGGG - Intronic
1135100287 16:19599244-19599266 TAAATGGTCTGGATGCAGCTGGG - Intronic
1135655290 16:24243188-24243210 GAAATGGGAGGGTGGCATCTGGG + Intergenic
1136387881 16:29941358-29941380 GAAATGTCAGGGATGCCGCAAGG - Intronic
1137397088 16:48123864-48123886 GAAATGCCAGCAAGGCAGCTTGG - Intronic
1138513910 16:57525497-57525519 GAGATGGCAGGGAGGCAGCTGGG - Intronic
1139263790 16:65621251-65621273 TAAATGCCAGGGCTGCTGCTGGG - Intergenic
1139507050 16:67403994-67404016 GAAAGAGCAGGAATGCAGATGGG + Intronic
1140789888 16:78381408-78381430 GAAATGGGAGACATGCACCTGGG + Intronic
1141169152 16:81680343-81680365 GAAATGGCTGGGAGGCACCCTGG + Intronic
1141591728 16:85073643-85073665 GAAATGGAGGGGATGCCTCTTGG + Intronic
1141684448 16:85562312-85562334 AAAAGGGCTGGGCTGCAGCTGGG - Intergenic
1142979653 17:3664211-3664233 GAAATCGCTGGGCTGCAGATTGG - Exonic
1143382982 17:6507975-6507997 GGAATGCTGGGGATGCAGCTGGG + Intronic
1143382990 17:6508005-6508027 GGAATGCTGGGGATGCAGCTGGG + Intronic
1144604507 17:16653280-16653302 GAACTGGCAGGGATGGAACTAGG - Intronic
1144731087 17:17526691-17526713 GAAAGGGCAGGGAAGAAGCATGG - Intronic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1146286561 17:31578035-31578057 CAAATGGCAGGGAAGCTGATCGG - Intergenic
1146348737 17:32078326-32078348 GAAAGGGCTGGGATGCAGGAAGG + Intergenic
1148449916 17:47770297-47770319 GAAATGGCAGACAGTCAGCTAGG + Intergenic
1148469195 17:47883067-47883089 GACATGGCGGGGATGCGGGTGGG + Intergenic
1149516116 17:57282239-57282261 GAAAGGACTGGGAAGCAGCTTGG + Intronic
1150705838 17:67486639-67486661 CAAATGGCAGGGAGGCAGAAAGG + Intronic
1151381663 17:73730004-73730026 GAATGGTCAGGGATGGAGCTGGG - Intergenic
1151535729 17:74737832-74737854 GGAATGGGAGGGGAGCAGCTGGG - Intronic
1152147948 17:78580499-78580521 CACATGGCAGGGATGCTGCCGGG - Intergenic
1152443612 17:80326590-80326612 GAAATGGGAGGGGTGGAGCATGG - Intronic
1155082196 18:22421320-22421342 GAAATGCCAGGGGTGCAGTGAGG - Intergenic
1155345029 18:24849296-24849318 AAAGCTGCAGGGATGCAGCTAGG + Intergenic
1156466200 18:37349091-37349113 GAAAAGTCAGGGATGAAGCAGGG + Intronic
1157220773 18:45827287-45827309 CAAGTGGCAGGGGTGGAGCTGGG + Intronic
1157562695 18:48659862-48659884 GGAATGGCAGGGATATCGCTGGG + Intronic
1157562736 18:48660114-48660136 GGAATGGCAGGGATATCGCTAGG + Intronic
1158803716 18:60944830-60944852 GAAATGGCAGGGTGACAGCATGG + Intergenic
1159553036 18:69916956-69916978 GAAATGGGAGGGATGCACAAAGG - Intronic
1159966224 18:74598205-74598227 GAGAGGGCAGGGCGGCAGCTGGG - Intronic
1160328000 18:77968263-77968285 GAGATGGCAGGGATGCAGCCAGG + Intergenic
1160638956 19:109938-109960 GAATTGGAAGGGAGGGAGCTTGG - Intronic
1160916190 19:1497761-1497783 GGAATGGCAGGGGACCAGCTCGG - Exonic
1161476767 19:4490378-4490400 GAAAAGGAAGGGAGGCAGCCAGG - Intronic
1163048280 19:14661396-14661418 GCAAGGACAGGAATGCAGCTGGG - Intronic
1163648681 19:18504691-18504713 GCCTTGGCAGGGATGCAGCTGGG - Intronic
1164719963 19:30424801-30424823 CAAATGGCTAGGAGGCAGCTGGG + Intronic
1164776802 19:30859046-30859068 CAAAAGACAGGGCTGCAGCTAGG + Intergenic
1164793209 19:31005373-31005395 CACATGGCATGGATGCAGCCAGG + Intergenic
1166808576 19:45501378-45501400 GAAATGGGAGGGAGGAAGCTGGG + Intronic
1166881293 19:45931710-45931732 GAGGTGTCAGAGATGCAGCTTGG - Intergenic
1167453114 19:49583861-49583883 GAAAAAGCAGGAATTCAGCTGGG - Intronic
926879890 2:17533207-17533229 GAAATTGCAGGGATGGAACTTGG - Intergenic
926964876 2:18398962-18398984 CAAATGTCTGGGATGCAGCCAGG + Intergenic
928094910 2:28398545-28398567 GCCCTGGCAGGGAAGCAGCTGGG + Intronic
929081858 2:38129358-38129380 GAAATGGCTAGGCTGGAGCTGGG - Intergenic
929488846 2:42378711-42378733 TAAAGGGCAGGGATGCGGCCAGG + Intronic
929922671 2:46183717-46183739 GAAATGGGAGGGAGGCACCTTGG - Intronic
930467813 2:51776489-51776511 AAAATGGTTGGGGTGCAGCTTGG + Intergenic
930733379 2:54750278-54750300 GGAATGGCAGAGTTCCAGCTTGG - Intronic
930884932 2:56314663-56314685 GAATTGGAAGGGATATAGCTTGG + Intronic
931522709 2:63117144-63117166 GAAATGGGACTGATGCAGATGGG - Intergenic
932788870 2:74634531-74634553 GAAATAAAAGGCATGCAGCTTGG - Intronic
934561373 2:95315218-95315240 GTGATGGCAGGGATGCAGAGTGG + Intronic
934830268 2:97514016-97514038 GAAGTGGTCGGGGTGCAGCTTGG - Intronic
936830945 2:116646089-116646111 GAAATGGCATGGGTGCAGGCTGG - Intergenic
943843694 2:192613299-192613321 AAAATGGCATGCATGCAGGTTGG - Intergenic
944441196 2:199745057-199745079 AAAATGGCAGGTAGGCAGGTGGG - Intergenic
946084338 2:217156092-217156114 AAAGTGGCAGTGATGCAGCTTGG - Intergenic
946488188 2:220121122-220121144 GGAAGGGCAGGGATGTAGCTAGG + Intergenic
946725736 2:222659524-222659546 GAGTTGGCAGGGCTGCAGCCTGG + Intergenic
947821304 2:233072976-233072998 AACCTGGCAGGGCTGCAGCTAGG + Intronic
947891677 2:233627728-233627750 GAAATGGCAGGCATTCACCACGG + Intronic
1172425069 20:34850453-34850475 GAAAGAGCAGGGAGGCAGTTTGG - Intronic
1173458890 20:43225835-43225857 GAATTGGCAGAGGTGGAGCTTGG + Intergenic
1173471276 20:43325454-43325476 GTAAAGGCAGGGACGCAGATAGG + Intergenic
1174400598 20:50273829-50273851 GACAGGGCAGGGAACCAGCTGGG - Intergenic
1174520465 20:51126176-51126198 GAGATGGCACGCATGCAGCCAGG - Intergenic
1175440272 20:58985715-58985737 GAAATGTCAGGGATTATGCTGGG + Intronic
1175990321 20:62785413-62785435 GACATGGGAGGGATGGAGCATGG + Intergenic
1176294955 21:5066791-5066813 GAAATGGGATGGCTCCAGCTGGG - Intergenic
1178534181 21:33398975-33398997 TAGATGGCAGGGATGCAGACAGG - Intergenic
1179637877 21:42725162-42725184 GGAATGGAAGGGAAGCAGCGTGG - Intronic
1179859848 21:44181593-44181615 GAGATGGGAGAGAAGCAGCTGGG + Intergenic
1179862094 21:44195336-44195358 GAAATGGGATGGCTCCAGCTGGG + Intergenic
1183393701 22:37560309-37560331 GAGCTGGCAGGGACGCGGCTGGG - Intergenic
1183640362 22:39088981-39089003 GACAAGGCAGGCACGCAGCTGGG - Intergenic
1183776369 22:39968814-39968836 GAGTTGGCAGGGAGGCAGCAGGG - Intronic
1184039102 22:41932930-41932952 GAAATAGCAGGGAAGCAGAGAGG + Intergenic
1184206455 22:43007042-43007064 GAGAAGTCAGGGATGCAGATGGG - Intronic
1184250975 22:43260115-43260137 GAGTGGGCAGGGGTGCAGCTGGG + Intronic
949537724 3:5008672-5008694 GAGATGGCAGAGAAGGAGCTGGG - Intergenic
949597018 3:5558738-5558760 GACATGGCAGGGGGGCAGTTGGG - Intergenic
949708025 3:6841285-6841307 GAAGGGGCAGGGGTGCAGGTGGG - Intronic
949973402 3:9431263-9431285 GAAATGGCATGATAGCAGCTGGG + Intronic
950048169 3:9963946-9963968 GAGCTGGCAGGCATGCAGCAAGG - Exonic
950873049 3:16245697-16245719 GGAAGGGCAGGGGTGCAGCTGGG + Intergenic
951888597 3:27548899-27548921 GGAGGGGCAGGGATGCAGATGGG + Intergenic
952967148 3:38628412-38628434 GAAAGGTCAGGGAGGCAGGTGGG - Intronic
954297231 3:49681047-49681069 GGAAGGGCAGGGAGGCAGCCAGG + Intronic
954458560 3:50612932-50612954 GAAATGGCAGGGTAAGAGCTTGG + Exonic
955446564 3:59017309-59017331 CAAGGGGCAGTGATGCAGCTGGG - Intronic
955624067 3:60897708-60897730 AAAATGAAAGGGATGCAGCTAGG - Intronic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
957278711 3:78122581-78122603 GAAAGTGCAGGAATGCAGCTGGG - Intergenic
958815302 3:98907768-98907790 GACATTGCTGGGATGCAGTTGGG - Intergenic
960649134 3:119926693-119926715 GAAATAGCAGGGAAGTAGCTTGG - Intronic
962349826 3:134648586-134648608 GAAATGACTGGGAGGCTGCTAGG + Intronic
962390390 3:134966775-134966797 AGAATGGCAGGAATGCAGATGGG - Intronic
963326731 3:143871416-143871438 GTAGAGGCAGGGATGCAGCTGGG - Intergenic
965588728 3:170342684-170342706 TAAAAGGCAAGGATGCAGCCAGG - Intergenic
965632515 3:170747782-170747804 GAACTGGAAGGGTCGCAGCTGGG - Intronic
966099557 3:176250153-176250175 AAAAGGGCAGGGTTGCAGCTGGG - Intergenic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
967658937 3:192081693-192081715 CAACAGGTAGGGATGCAGCTAGG + Intergenic
967784003 3:193470296-193470318 CAAATGGCAGTGCTGGAGCTGGG - Intronic
969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG + Intronic
969942891 4:10752839-10752861 GGAATTTCAGGGATACAGCTGGG - Intergenic
970945687 4:21688820-21688842 GGAAAGGCAAGGAAGCAGCTGGG - Intronic
974478853 4:62419415-62419437 GAAATGGCAAGGATGCAAACAGG - Intergenic
975462117 4:74665677-74665699 GAAAGGGCAGAGAGGCAGTTTGG + Intergenic
975475046 4:74813647-74813669 GAAAGGTCAGGGATCTAGCTAGG + Intergenic
978440682 4:108730253-108730275 GCAATGGCAGGGATGGAACCAGG + Intergenic
981730112 4:147888023-147888045 GCAATGTCAGGGATGCTGCGAGG - Intronic
982325194 4:154122647-154122669 GAAATGGCTGGGGTGGAGGTGGG - Intergenic
985319595 4:188695115-188695137 GCAATTTCAGGGATGCAGCTTGG + Intergenic
986049566 5:4076350-4076372 TAAATGGCTGGGCTGCTGCTTGG + Intergenic
987777108 5:22382476-22382498 GAAATGGCAGGAAGAAAGCTAGG - Intronic
988161358 5:27521623-27521645 GAAATGGTTGGGATGCTGCATGG + Intergenic
988542086 5:32119428-32119450 AAAGTGGCAGGGATGGGGCTGGG - Intergenic
989599473 5:43188164-43188186 GAAAGGCCAGGGATGCAGCTTGG + Intronic
990024829 5:51173531-51173553 GAAAGGGCAGTGATGCAGATTGG - Intergenic
990376337 5:55173988-55174010 GAAATGACAGGGAACCAGATGGG + Intergenic
990744079 5:58940698-58940720 GAGATGGCAGGGTTCCATCTGGG + Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
992676817 5:79112946-79112968 AAAATGGTAGGGAGGCAGATGGG + Intronic
993740101 5:91528325-91528347 GAAATGTCAGGTTTGCAGATGGG - Intergenic
994031989 5:95153441-95153463 GAACTGGCAAGGATTCAGTTTGG - Intronic
994275908 5:97837047-97837069 GAAAAGGCAAGGAAGCAGATTGG - Intergenic
994437091 5:99750243-99750265 GATATGGCAGGGGTGCAGGTGGG - Intergenic
996675298 5:126168140-126168162 CAAGTGGCAGGGAAGCAGCATGG - Intergenic
998137612 5:139682344-139682366 GAAATGGAAGGGCTGGGGCTGGG - Intronic
998349961 5:141494072-141494094 AAAATGGAAGGGATGCAGCGGGG - Intronic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
998878426 5:146623054-146623076 GAAATGTCAGGGATGGCCCTTGG + Intronic
999652372 5:153779948-153779970 GAGGTGGCAGGGATGTATCTGGG + Intronic
1000042041 5:157491942-157491964 GCAATGGGAGGGATGCTGGTTGG + Intronic
1002297063 5:178237664-178237686 GAAATGGAAGGCAAGCAGCCAGG + Exonic
1003250601 6:4426473-4426495 GATAAGGCAGAGGTGCAGCTTGG - Intergenic
1003946874 6:11084139-11084161 GAGATTGGAGTGATGCAGCTTGG + Intergenic
1004275631 6:14233047-14233069 GCCATGGCAGGGAGGGAGCTGGG - Intergenic
1005348985 6:24915895-24915917 AGAGTGGCGGGGATGCAGCTGGG - Intronic
1006121057 6:31806236-31806258 GAACTGTCAGGGATGCAGTGGGG - Intronic
1006331473 6:33394099-33394121 TAGAGGGCAGGGATGCTGCTAGG + Intronic
1006463485 6:34177408-34177430 GAATTGGCAGGGACCCAGCCGGG - Intergenic
1006716224 6:36122466-36122488 CGAATGGCAGGGATGTAGCAGGG - Intergenic
1007020853 6:38519772-38519794 GAAATGGCAGGGATGCAGCTAGG - Intronic
1007419543 6:41711527-41711549 GAAATGCCAGGGCTGGACCTTGG - Intronic
1007455407 6:41973332-41973354 GAAATGGCAGGAATGTTGTTTGG - Intronic
1007558118 6:42783194-42783216 GAAAAGGCAGCGAGGCGGCTGGG - Intronic
1007800221 6:44385965-44385987 GCAAGGACAGGAATGCAGCTGGG + Intergenic
1008496842 6:52142905-52142927 CTGATGGCAGGGAGGCAGCTTGG - Intergenic
1012703772 6:102495958-102495980 CAAATGGCAGAGATAGAGCTTGG - Intergenic
1013318071 6:108960336-108960358 GAAGAGGCAGGGCTGCAGCTGGG - Intronic
1013492890 6:110666649-110666671 GATATGGTAGGGATACATCTAGG - Intronic
1014292091 6:119570691-119570713 GACATGGCAGTGATATAGCTGGG + Intergenic
1014710146 6:124796774-124796796 GAAAAGGCAGTGATACATCTTGG + Intronic
1014766790 6:125416395-125416417 TAAATGGCAGGCATGCTACTAGG + Intergenic
1016217822 6:141624601-141624623 GAACTTGCAGTGATGCAGCAAGG - Intergenic
1020035995 7:4963400-4963422 GAGAAGGCAGGGATGGGGCTTGG + Intergenic
1020097037 7:5374954-5374976 GAAATGGGAGGGAGTCAGCTCGG + Intronic
1020281208 7:6650997-6651019 GAGAGGGCAGGGGTGCAGCTTGG + Intronic
1021716783 7:23469048-23469070 GAACTGGCAGAGGCGCAGCTCGG + Intronic
1022312932 7:29214282-29214304 AAAATGTGAGGGATGCTGCTGGG - Intronic
1023604883 7:41920872-41920894 GGATTGGCAGGAGTGCAGCTGGG + Intergenic
1024063437 7:45715283-45715305 GAAATGGGAGGGAAGCTTCTGGG + Exonic
1024198242 7:47081175-47081197 AAAATGGCTAGGATGCTGCTTGG - Intergenic
1024974208 7:55098289-55098311 GGACTGGCAGGGATGGGGCTAGG + Intronic
1027152549 7:75742763-75742785 GGCGTGGCAGGGAGGCAGCTGGG + Intergenic
1027820886 7:83043101-83043123 GAAAGGGAAGGGATGCTACTAGG - Intronic
1029668297 7:102010097-102010119 GAAACAGCAAGGGTGCAGCTGGG + Intronic
1030825148 7:114146896-114146918 GAAATGGTTAGGATGAAGCTAGG - Intronic
1030969702 7:116040749-116040771 CAAATGGCAGAGATGGGGCTGGG - Intronic
1031074875 7:117202373-117202395 GAAATGGCCTGAAGGCAGCTGGG - Intronic
1032881977 7:136099980-136100002 GAAATGATAGGGATGGAGATAGG + Intergenic
1034404987 7:150897125-150897147 GAAATGGCATTGATGGTGCTTGG + Intergenic
1034692431 7:153024466-153024488 GAAGTGTCTGGGAGGCAGCTGGG - Intergenic
1039860970 8:41457112-41457134 GAACTGGCAGGGATGCAAAATGG - Intergenic
1040508790 8:48075370-48075392 GAAAGGGCATGCATGGAGCTGGG - Intergenic
1042571140 8:70166287-70166309 GAAATGTCAGTAGTGCAGCTAGG - Intronic
1043218670 8:77629720-77629742 GGAATGGCAAGTATGTAGCTGGG - Intergenic
1043660022 8:82727620-82727642 GAAACAACATGGATGCAGCTAGG + Intergenic
1044261386 8:90127235-90127257 GAAAGGCCAGGTATTCAGCTTGG - Intergenic
1045056794 8:98375330-98375352 GAAATGGAAGGCATACAGGTTGG + Intergenic
1045728985 8:105212114-105212136 GAAATTGCGGGGATGCAGTGGGG + Intronic
1047057942 8:121188479-121188501 GAAATACCAGGGATGCATTTTGG + Intergenic
1048322651 8:133412398-133412420 GAAAGGGCATGGATGGAGCTGGG - Intergenic
1048407912 8:134141769-134141791 GGAATGACAGGGATGCAGCTGGG + Intergenic
1048859786 8:138715776-138715798 GAAGAGGCAGGAATTCAGCTCGG - Intronic
1048879353 8:138859919-138859941 GAAATGGAAGGGATGCTGCTTGG - Intronic
1050242424 9:3651231-3651253 TAAAGGGCAGGGGTGCAGCAGGG + Intergenic
1051614651 9:18995591-18995613 GAAGTGACTGGGATGCAGCCAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055703530 9:78972624-78972646 GAAATGACAAGGGTGCAGGTGGG - Intergenic
1055973327 9:81932462-81932484 GAATTATCAGGGATGCAGCCAGG + Intergenic
1055975080 9:81947554-81947576 GAATTATCAGGGATGCAGCCAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058957680 9:109964201-109964223 GAACTGGTAGGGCTGCAGCCAGG - Intronic
1059400867 9:114070281-114070303 GAAGTGGCAGTGGTGGAGCTGGG + Intronic
1059687911 9:116655577-116655599 GAAAAGGCAGGGCTGGAGATGGG - Intronic
1060214419 9:121730103-121730125 GACATGGCTGGGAGGCAGCGAGG - Intronic
1060805161 9:126570803-126570825 TGAATGGCAGGGATGCTGTTTGG - Intergenic
1061184075 9:129041957-129041979 GAAATGACAGGGACTCAGATGGG + Intronic
1061184180 9:129042439-129042461 GAGATGGGAGGGGAGCAGCTGGG + Exonic
1061995581 9:134181195-134181217 GGAATTGCAGGGCTGCAGCAGGG + Intergenic
1062044539 9:134418951-134418973 GAAAGGGCAGGGAAGCAGGGTGG - Intronic
1062380827 9:136285758-136285780 GGAAGGGCAGGGAGGCAGCAGGG + Intronic
1062395361 9:136350555-136350577 GTCATGGAGGGGATGCAGCTGGG + Intronic
1186198717 X:7135023-7135045 GGAATGGCAGGGATACAACTGGG + Intronic
1189274832 X:39778127-39778149 GAAAGGGCAGGCATGGATCTGGG + Intergenic
1190480274 X:50870413-50870435 GAAGAGGCAGGGCTGGAGCTGGG - Intergenic
1191965883 X:66757610-66757632 AAAATGGCAGGGATGAGGGTGGG + Intergenic
1193414216 X:81202121-81202143 GCAATGGCTGGAATCCAGCTAGG - Exonic
1195883309 X:109615104-109615126 TGAAGGGCAGGGATGCGGCTGGG + Intergenic
1196693910 X:118590743-118590765 GGAAAGACAGGGATACAGCTGGG + Intronic
1196929974 X:120672123-120672145 GAAATGGAAAGGATGAAGCATGG + Intergenic
1197156573 X:123276378-123276400 TAATTGACAGAGATGCAGCTGGG + Intronic
1197656162 X:129118133-129118155 CAAATGGGAGGGCTGCAGTTGGG - Intergenic
1197928572 X:131672509-131672531 GAAAGGAGAGGGATGCATCTAGG - Intergenic
1198400416 X:136263196-136263218 GAATTGGCAGAGATGGAGGTGGG - Intergenic
1200014187 X:153146746-153146768 GGAATGCCTGGGATGCAGCTGGG + Intergenic
1200025413 X:153253206-153253228 GGAATGCCTGGGATGCAGCTGGG - Intergenic
1201573989 Y:15442549-15442571 CTAATGGCAGGGATACAACTGGG + Intergenic
1201701439 Y:16886682-16886704 AAGGTGGCAGGGTTGCAGCTTGG - Intergenic
1202377829 Y:24254899-24254921 GATAGGGCAGGGATGGAGCTTGG + Intergenic
1202492953 Y:25415222-25415244 GATAGGGCAGGGATGGAGCTTGG - Intergenic