ID: 1007023833

View in Genome Browser
Species Human (GRCh38)
Location 6:38549676-38549698
Sequence AGGGTGGTTCCCTACTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007023833 Original CRISPR AGGGTGGTTCCCTACTCTGA AGG (reversed) Intronic
902635914 1:17735136-17735158 AGGATGGCTCCCTGCTCTGTTGG + Intergenic
903330785 1:22596084-22596106 AGGGCGGTGCCCTCCTCTGCAGG + Exonic
905321657 1:37121663-37121685 AGCATGGTTCCCCACTCTCATGG + Intergenic
915071962 1:153277209-153277231 AGGATGGTACCCTGATCTGATGG + Intergenic
916092047 1:161314916-161314938 AGGGTGGATCCCTACTGGGGTGG + Intronic
918392364 1:184079654-184079676 AGGATGGGGCCCTAATCTGATGG - Intergenic
921413442 1:214861951-214861973 AGGAAGAGTCCCTACTCTGATGG - Intergenic
1063196725 10:3750185-3750207 ACGCTGGTTCCCTTCCCTGATGG - Intergenic
1063475042 10:6320886-6320908 AAGGTGATTTCCCACTCTGAAGG - Intergenic
1064320565 10:14300582-14300604 AGGGTTGGTCCCTACTTTCATGG + Intronic
1065625014 10:27621161-27621183 GGGGTGTTTCCATACTCTTAAGG - Intergenic
1068709544 10:60118608-60118630 AGTGTTTTGCCCTACTCTGAAGG - Intronic
1071090939 10:81917536-81917558 AGGGTTTTTACCTACTCTCAAGG - Intronic
1075944341 10:126419307-126419329 AGGGTGGGGCCCTGATCTGATGG - Intergenic
1076823878 10:132957654-132957676 AGGGAGGATCCCCTCTCTGAAGG + Intergenic
1076823889 10:132957701-132957723 AGGGAGGATCCCGTCTCTGAAGG + Intergenic
1076823899 10:132957747-132957769 AGGGAGGATCCCATCTCTGAAGG + Intergenic
1076823918 10:132957839-132957861 AGGGAGGATCCCATCTCTGAAGG + Intergenic
1079032614 11:16996959-16996981 AGAGTGGTTCTCTACCCTGTGGG + Intronic
1080447560 11:32351616-32351638 AGGCTGCTTCCCCAGTCTGAAGG + Intergenic
1083535188 11:63460669-63460691 AGGGTGATTCCTGACTCTGTAGG - Intergenic
1087007360 11:93483103-93483125 GGGGTGGCTCCGTACTGTGAGGG + Intronic
1092501108 12:9049117-9049139 AGAGTAGGTCCCTGCTCTGAAGG - Intergenic
1095977433 12:47949340-47949362 AGGTTGCTTCCCTCCACTGAAGG - Intergenic
1098072273 12:66688804-66688826 AGGGTTGTTTCCTCCTTTGAAGG - Intronic
1098587333 12:72169741-72169763 AGGGTGGGGCCCTTTTCTGAGGG - Intronic
1101449134 12:104760453-104760475 AGGGTGGCTCCCTACTCCTCAGG + Exonic
1102540618 12:113616616-113616638 AAGGTGGTCCCCTAAACTGATGG + Intergenic
1104715927 12:131016140-131016162 AGGGAGGTTCCCTTCTGTGCAGG - Intronic
1108912706 13:55576915-55576937 AGGGTGGTTCCCTGCCCTAATGG - Intergenic
1111463934 13:88582798-88582820 AGGGTGTTTCTCGGCTCTGATGG + Intergenic
1117244663 14:53872187-53872209 AGGATAGTTCCCTCCTCTCAGGG + Intergenic
1121845424 14:97168352-97168374 AGGGGGATCCCCTGCTCTGAAGG - Intergenic
1122622231 14:103065954-103065976 AGGGTGGGTCCCTGCTGTGAGGG - Intergenic
1122827909 14:104380314-104380336 AGGGTGGGGCCCTAATCTGATGG - Intergenic
1123104977 14:105837103-105837125 AGGCTGCTTCCCTTCTCTGCAGG + Intergenic
1129676313 15:77633853-77633875 AGGGTGGTAACCTACTCTGCAGG - Intronic
1133048314 16:3101534-3101556 AGTGTGGTTCCCTACTGGGTTGG + Intergenic
1138298391 16:55906579-55906601 AGGGTGGTTTCTTCCTTTGAGGG + Intronic
1141999666 16:87656981-87657003 TGGGTGGGGCCCTAATCTGATGG - Intronic
1144375035 17:14630851-14630873 AGTGTCTTTCCCTACTCTGGGGG - Intergenic
1145119615 17:20246011-20246033 ACGGTGGTTGCCGACTCTGGGGG - Exonic
1146918229 17:36691634-36691656 AGGCTGGTCCCCTATTCTGCAGG + Intergenic
1147532609 17:41293811-41293833 ATGTAGGTTTCCTACTCTGACGG - Intergenic
1148993713 17:51689095-51689117 AGGGTGCTCCCTTTCTCTGAGGG - Intronic
1151033923 17:70775969-70775991 AGCATGGTTGCCTATTCTGAGGG - Intergenic
1154264030 18:12863732-12863754 ACGGTGGTTCTCTACTGTGTTGG - Intronic
1154314858 18:13296539-13296561 AGGGTGGGTCCCTAATCTGACGG - Intronic
1157877481 18:51287395-51287417 AGGGTGGTTCACTATGCTGTGGG - Intergenic
1159901112 18:74046619-74046641 AGGGTGGAGCCCTGATCTGATGG + Intergenic
1167451865 19:49575323-49575345 AGAGTGGGGCCCTAATCTGATGG - Intronic
925132075 2:1501364-1501386 AGGCTGGTTTCCTCCTCTGTCGG + Intronic
925704196 2:6668608-6668630 AGGGTGGTTTCCTTCTGTGATGG - Intergenic
926423728 2:12722632-12722654 AGGCTGCTTCCCTATTCAGAAGG + Intronic
930566268 2:53024478-53024500 AGTGTGTTTCCCTACTTAGATGG + Intergenic
941491265 2:166144971-166144993 ATGGTGGTGCGCTACTCAGAAGG - Intergenic
942083015 2:172419139-172419161 AGGCATGGTCCCTACTCTGAAGG + Intergenic
947908693 2:233786456-233786478 AGGGTGGGACCCTAATCTCATGG - Intronic
948260606 2:236601927-236601949 CTGGTGGTTCCCTGCTCTCATGG - Intergenic
1172899651 20:38325120-38325142 AGGGAGGTGCCCTATTCTGCTGG - Intronic
1173008107 20:39156645-39156667 AGGGTGGCTCCGTACACTGATGG + Intergenic
1174540676 20:51286835-51286857 AGAGTGGTTGCCTACCCTCAGGG + Intergenic
1176304597 21:5116661-5116683 AGGTTGGTTCTTGACTCTGAAGG - Exonic
1178692051 21:34758518-34758540 AGGGTGGTCCCCTAAACTGCTGG - Intergenic
1178877131 21:36422151-36422173 TCGGGGGTTCCCTACGCTGAGGG - Intergenic
1179852457 21:44145369-44145391 AGGTTGGTTCTTGACTCTGAAGG + Exonic
1180196832 21:46201594-46201616 TGGGTGGCACCCTACCCTGAGGG - Intronic
1180994929 22:19960880-19960902 AGAGTGGTTCCCTCCTCTTGTGG + Intronic
951059861 3:18192780-18192802 AGGGTTGTTGCCTATTGTGATGG - Intronic
951170263 3:19533653-19533675 AGTGTGGATCCCTCCTCTGTGGG + Exonic
954337888 3:49930310-49930332 ACGGTAGTTCTCAACTCTGACGG + Intergenic
954373504 3:50182600-50182622 TGGGTGAGCCCCTACTCTGATGG - Intronic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
955400051 3:58585209-58585231 AGGGGGTCTCCCTAATCTGAAGG - Intronic
955479998 3:59380166-59380188 AGGGTGGGTCCCTACAAGGATGG + Intergenic
960939102 3:122922107-122922129 AGGATGGTGCCCGACTCTGGAGG + Exonic
961092347 3:124125052-124125074 AGGGTTGTACCCCACTCTGTAGG - Intronic
964133280 3:153315004-153315026 AGGGTGGTTCCCCTACCTGAAGG + Intergenic
967983271 3:195078061-195078083 AGCCTGGATCCCTACTCAGACGG + Intronic
971745718 4:30577422-30577444 AAAGTGGTTCTCAACTCTGAAGG + Intergenic
980934608 4:139214341-139214363 AAGGTGGGGCCCTAATCTGATGG - Intergenic
982061708 4:151610904-151610926 TGTATGGTTCCCTACTCTCATGG - Intronic
982170406 4:152656077-152656099 AGGGTGGATGCCAACTATGATGG - Intronic
983388945 4:167103359-167103381 AGGGTGGCCCACTACCCTGAGGG + Intronic
984443515 4:179804386-179804408 AAGGTGGACTCCTACTCTGAGGG - Intergenic
986421127 5:7584116-7584138 AGGGTTTTTCTTTACTCTGATGG + Intronic
986601874 5:9480664-9480686 AGCCTGTTTCCCTCCTCTGAAGG - Intronic
989108236 5:37883516-37883538 AGGTTGTGTCCCTACACTGATGG + Intergenic
991250085 5:64550410-64550432 AGGGTGGGGCCCTAGTCTGAGGG - Intronic
991337897 5:65570801-65570823 AGGGTGGGGTCCTAATCTGATGG - Intronic
992027599 5:72685952-72685974 AGGGTGAGTCCCTAATCCGATGG + Intergenic
997519612 5:134514410-134514432 AGGGCAGTTCCCTCCTCAGAAGG + Intergenic
999714547 5:154349596-154349618 AGGCTGGTTCCCTCCTCTTTAGG - Intronic
1001697077 5:173678880-173678902 GAGGTGGGTCCCTAATCTGATGG - Intergenic
1005347933 6:24908778-24908800 TGGGTGGGTCCCTTCTCTGCTGG + Intronic
1005420292 6:25641583-25641605 AGGATGGGGCCCTAATCTGATGG - Intergenic
1005972469 6:30772130-30772152 AGGGTGAGGCCCTAATCTGATGG - Intergenic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1007023833 6:38549676-38549698 AGGGTGGTTCCCTACTCTGAAGG - Intronic
1007286706 6:40753075-40753097 ATGGGGGTTCCCTAGGCTGAAGG + Intergenic
1007326464 6:41064687-41064709 AGGGCCTTTCCCTTCTCTGAAGG + Intronic
1007726254 6:43917622-43917644 AGGCTGGCTCCCTGCCCTGAGGG + Intergenic
1010641962 6:78339999-78340021 ATGTTGGTTTCTTACTCTGAAGG + Intergenic
1011349358 6:86405511-86405533 AGGGTGTGTCCCTGATCTGATGG + Intergenic
1012975533 6:105777652-105777674 AGGGCTGTGCCCTACCCTGAAGG - Intergenic
1015085369 6:129284119-129284141 AGGGTGTTTCCCTGCTCACATGG - Intronic
1015684685 6:135846747-135846769 AGGGTGAGTTCCTAATCTGATGG - Intergenic
1016680223 6:146820616-146820638 GGGGTGGTTCCCCTATCTGAGGG + Intergenic
1018462676 6:164013866-164013888 ACACTGGTTCCCTACTCTGATGG + Intergenic
1019314322 7:377467-377489 AGGCTGGTTACCTGCTCTGGGGG - Intergenic
1023044572 7:36199751-36199773 ATGGTGGTTCCCAACAGTGAGGG + Intronic
1024027426 7:45424556-45424578 AAGGTGGGACCCTAATCTGATGG - Intergenic
1028584174 7:92436845-92436867 AGTGTGTTTCCCAACTCTGCTGG - Intergenic
1028665030 7:93332341-93332363 AGGGTGGGTCCCTGGTATGATGG - Intronic
1039389093 8:37162772-37162794 AGGGTGGGGCCCCATTCTGATGG - Intergenic
1041541273 8:58987854-58987876 TGGGTGGTTCCCCACTCCCAAGG + Intronic
1044100991 8:88138527-88138549 TTGGTGCTTCCCTACTCTCACGG + Intronic
1044252416 8:90019405-90019427 ATGGTGTTGCCCTGCTCTGAAGG - Intronic
1044547600 8:93476970-93476992 AGGGTGGTGCCCTAATCTGATGG + Intergenic
1046370998 8:113306295-113306317 AGGGTTGGTTCCAACTCTGAAGG + Intronic
1048094203 8:131273770-131273792 AGGCAGCTTCCCTACGCTGATGG - Intergenic
1048423009 8:134295567-134295589 AGGGTGTTTCCCTTCTGTGTGGG - Intergenic
1051771610 9:20585337-20585359 AGGGTGGGACCCTGATCTGATGG - Intronic
1052280050 9:26722478-26722500 TGGGTGTTTACCTAATCTGAGGG - Intergenic
1052858271 9:33420599-33420621 GGGGTGGTGCCCCTCTCTGATGG + Intergenic
1055456778 9:76479800-76479822 AGGTTGGTTCTTCACTCTGATGG + Intronic
1061218289 9:129234721-129234743 AGGCTGCTTCCCTTCTCTGCTGG + Intergenic
1186352417 X:8753701-8753723 AGGTTGGTTCTCATCTCTGAAGG - Intergenic
1192598303 X:72435198-72435220 AGTGTGGTTCCCTTCTTTCAGGG - Intronic
1192705984 X:73528877-73528899 AGGGTGGTTGCCTATAATGAAGG - Intergenic
1197770487 X:130086318-130086340 AGGGTTTCTCCCAACTCTGATGG + Intronic