ID: 1007026879

View in Genome Browser
Species Human (GRCh38)
Location 6:38585124-38585146
Sequence CATGCTCTTGTCTCCTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007026879_1007026882 6 Left 1007026879 6:38585124-38585146 CCATCTCAGGAGACAAGAGCATG 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1007026882 6:38585153-38585175 GACACTACACACTCCCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1007026879_1007026880 3 Left 1007026879 6:38585124-38585146 CCATCTCAGGAGACAAGAGCATG 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1007026880 6:38585150-38585172 ACCGACACTACACACTCCCATGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007026879 Original CRISPR CATGCTCTTGTCTCCTGAGA TGG (reversed) Intronic
902237567 1:15067324-15067346 CCAGCTCTTGTCTCCTGGGGTGG - Intronic
902836695 1:19051992-19052014 CATGGCCTTGTCTACTGAGAGGG - Intergenic
904599292 1:31664908-31664930 CAGGCCCTTGTCTGCTGTGATGG - Intronic
904937820 1:34144289-34144311 CCTACTCTTGTCTCCACAGAGGG + Intronic
905634452 1:39540277-39540299 CATGCTCTAGTGTGCTGAGATGG - Intergenic
905834360 1:41104708-41104730 ACCCCTCTTGTCTCCTGAGAAGG - Intronic
906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG + Intronic
907138063 1:52157933-52157955 CATGGTCTTCTCTCCTCACATGG + Intronic
907656057 1:56342826-56342848 CATGCTGTTTCCACCTGAGAAGG + Intergenic
909113105 1:71504389-71504411 CATTCCTTTGTCTCCTGTGAGGG - Intronic
910485622 1:87710405-87710427 AATGATCTTCTCACCTGAGATGG - Intergenic
916954621 1:169819311-169819333 CATGCTCTTGGCCACTTAGAAGG - Intronic
919714722 1:200764039-200764061 CTTGCTCTTGTCACCTGGGCTGG - Intronic
920321238 1:205124421-205124443 CTTGCTCTTGTCGCCTGGGCTGG + Intergenic
920337262 1:205253406-205253428 TAGGCTCTTGTCATCTGAGAAGG - Intronic
922237062 1:223729970-223729992 CTTGCTCTTGTCTCCTAGGCTGG - Intronic
922472974 1:225888027-225888049 CCTGCTCTTGTCCCCAGAGGTGG - Exonic
922480978 1:225939997-225940019 CCTGCTCTTGTCCCCAGAGGTGG - Exonic
1063959835 10:11297950-11297972 CTTGCTCTTGTCACCTGGGCTGG - Intronic
1064183957 10:13144092-13144114 CTTCCTCCTGTCACCTGAGAGGG + Intergenic
1064665604 10:17648002-17648024 CATGTTGTCGTCTACTGAGAAGG - Intronic
1067470994 10:46537634-46537656 CAGGCTCTTGGGTTCTGAGAGGG + Intergenic
1068577410 10:58699804-58699826 CCTGCTCCAGCCTCCTGAGATGG + Intronic
1068756253 10:60657325-60657347 CAAGACCTTGTCTCCTGATATGG - Intronic
1073206490 10:101772129-101772151 CAGGCTCTGCTCTGCTGAGAAGG + Intronic
1073463674 10:103681278-103681300 CATTCAGTTGTCTCCTGAGATGG - Intronic
1074009865 10:109467250-109467272 CAGGCTCTTGTCTCATGACCAGG - Intergenic
1074339581 10:112614308-112614330 CATGCCCTTGTCACCTAAGGTGG + Intronic
1074491919 10:113946125-113946147 AATCCTCTTGTCCCATGAGACGG - Intergenic
1076540105 10:131208272-131208294 CATCCTCATGTCACATGAGAGGG - Intronic
1078070969 11:8110091-8110113 CATCCTCTTTTCTCCAGAGTAGG - Exonic
1080074564 11:28134150-28134172 CATGTTCTTGTCTCATGACCAGG + Intronic
1080757228 11:35213538-35213560 CATGCCTTAGTCTCCTGAGTAGG - Intronic
1080766822 11:35304927-35304949 CATGGCCTTGTCTCCTTAGTTGG - Intronic
1080883194 11:36341742-36341764 CAAGCTCTTGTCTTGTGAGGAGG - Intronic
1081113477 11:39167561-39167583 CTTTCTCTAGTTTCCTGAGATGG - Intergenic
1083826947 11:65209399-65209421 TTTGCTTTTGTCTCCTGAGTGGG + Intronic
1083894526 11:65613508-65613530 CCAGCCCTCGTCTCCTGAGATGG + Exonic
1087550887 11:99646593-99646615 CATGCACTTATGTCCTTAGAAGG + Intronic
1089080420 11:115772019-115772041 CATTCTTGTGTCTCCTCAGATGG - Intergenic
1089734882 11:120543568-120543590 CATTCTCTTTTCTTTTGAGATGG - Intronic
1089957126 11:122581777-122581799 CATCCTCTTCTCTTCTGATATGG + Intergenic
1090594196 11:128303555-128303577 CCTGGTGTTGGCTCCTGAGATGG - Intergenic
1091743767 12:2977854-2977876 CTTGGTCTTGTTTTCTGAGAAGG + Intronic
1092221542 12:6716989-6717011 CCTGCTCTAGTCTCCTTACACGG + Intergenic
1093956467 12:25225472-25225494 AATGTTTTTGTCTCTTGAGAGGG - Intronic
1094050951 12:26220073-26220095 AATGGTTTTGTCTCCTGAGTTGG - Intronic
1096191784 12:49624077-49624099 CAAGAGCTTGTCTCCTGAGGTGG + Intronic
1096923267 12:55112847-55112869 CATCCTCTTTTCTCATGAGAGGG + Intergenic
1097152214 12:56987410-56987432 CTTTCTGTAGTCTCCTGAGAAGG - Intergenic
1098733903 12:74072262-74072284 CTTGCTCTTCTTACCTGAGAAGG + Intergenic
1101955324 12:109207606-109207628 CATGATTTGCTCTCCTGAGACGG - Intronic
1102088341 12:110163076-110163098 CATACCCTTGTCCCATGAGATGG - Intronic
1102492860 12:113299346-113299368 CAGCCACTTGTGTCCTGAGAAGG + Exonic
1104219006 12:126763824-126763846 CATGCTCTTGTCCTCGCAGAAGG + Intergenic
1104343844 12:127977800-127977822 CATGCTCTTGCTTCCAGACAGGG + Intergenic
1105939748 13:25137118-25137140 CAGGCCCTTATCTCCTGCGAGGG + Intergenic
1106595634 13:31133219-31133241 CTTGCTCTTGTCGCCTGGGCTGG - Intergenic
1107417833 13:40217771-40217793 GATGCTCTTGTCTGGAGAGAAGG + Intergenic
1107435499 13:40377396-40377418 CATGCTCTGCACTCCTCAGATGG + Intergenic
1109645919 13:65255842-65255864 CATGCTCTTGTCTTGTGATCAGG + Intergenic
1110392294 13:74988614-74988636 CCTGCTCTGGTTTTCTGAGATGG - Intergenic
1111257715 13:85694360-85694382 CATCCTCTTGTTTCCTCAGCAGG - Intergenic
1113384632 13:109837282-109837304 CATGTTCTTTCCTCATGAGATGG - Intergenic
1114555693 14:23561151-23561173 CATTCTTTTACCTCCTGAGATGG + Intronic
1115501673 14:34055235-34055257 CAGGCTCTTTTCTCTTGAGTAGG - Intronic
1116962794 14:50983965-50983987 AAGGATCTTGTCTCCTAAGAAGG - Intronic
1117116959 14:52524121-52524143 CATGCTGTTCTCTCCTGAATAGG - Intronic
1117344318 14:54817886-54817908 TCTGCTCTGGGCTCCTGAGATGG - Intergenic
1118505404 14:66405412-66405434 CATGCACATGTCTCCTTCGAAGG + Intergenic
1118781322 14:69009997-69010019 CTTGCTCTTGTCGCCTGGGCTGG - Intergenic
1119604720 14:76005348-76005370 CATGGTCTTTACTCCTCAGATGG + Intronic
1122047610 14:99034962-99034984 CATGCTCTCTTCCCCTGGGAGGG + Intergenic
1122245330 14:100398871-100398893 AAGGCTCTGGTCTCCTGATATGG - Intronic
1122691932 14:103535641-103535663 CATGCCCTTGGCTTCTGTGAGGG - Exonic
1123123699 14:105929797-105929819 CAGGTTCTTTTCTCGTGAGAGGG - Intronic
1123406334 15:20021288-20021310 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1123515664 15:21027936-21027958 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1124912856 15:33939339-33939361 TATGCTCCTGTCTCCTAAAATGG - Intronic
1125480803 15:40078653-40078675 CATACCCTTGTATCCAGAGATGG + Intergenic
1125556480 15:40589881-40589903 GATGCTCTCGTCTACCGAGATGG - Intergenic
1126855289 15:52832896-52832918 CAGGGTCTTTTCACCTGAGAGGG + Intergenic
1128017617 15:64361373-64361395 CATGTTTTTGTCTGTTGAGACGG + Intronic
1128192967 15:65721516-65721538 CATGCTCTTTTCTACTGTTAAGG - Intronic
1128318458 15:66676209-66676231 TCAGCTATTGTCTCCTGAGAGGG - Intronic
1129199057 15:73987975-73987997 CTTCCTCTTGTGTCCTGACAGGG - Intronic
1130706799 15:86240646-86240668 CATGGTCTTCTGTTCTGAGAAGG + Intronic
1133360842 16:5172547-5172569 CTTGCTCTTGTCACCTGGGCTGG - Intergenic
1133903734 16:10001587-10001609 CATGCTCTTGTATCTTTAGAAGG + Intronic
1135010664 16:18874834-18874856 CATGCTGTTGTCGCCTGGGCTGG - Intronic
1136314327 16:29442169-29442191 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1136327766 16:29543934-29543956 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1136442454 16:30283936-30283958 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1137480711 16:48849755-48849777 TATGCTCTTTTCTTCTGAGGTGG - Intergenic
1138191343 16:55016558-55016580 CCTGCCCCTCTCTCCTGAGAGGG - Intergenic
1139889254 16:70237656-70237678 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1139906847 16:70372026-70372048 AATGCACTTGTCTCCTGTGCAGG - Exonic
1143398610 17:6624796-6624818 CTTGCTCCTGTCTCCTGATACGG + Exonic
1143986626 17:10920121-10920143 CATTATCTTGTCCCATGAGATGG - Intergenic
1144812443 17:18009116-18009138 CATACTTTTTCCTCCTGAGAAGG - Intronic
1145897944 17:28471458-28471480 CATTCTCTGGTCTCCTTTGATGG - Intronic
1146122394 17:30207268-30207290 CATGTTTTTGTCTCCTGGTATGG + Intronic
1149484057 17:57028119-57028141 CATGCTCTTGACTACCTAGAAGG - Intergenic
1150479230 17:65496825-65496847 CTTGCTTTTCTCTTCTGAGAAGG - Intergenic
1152050982 17:77976897-77976919 CTTGCTCTTGTCGCCTGAGCTGG - Intergenic
1153387577 18:4515510-4515532 CATGGTGTTCTCTCCTGATAAGG - Intergenic
1153665869 18:7367358-7367380 CAAGCTCTTGTTTCCTGTGGAGG + Intergenic
1154001896 18:10488786-10488808 AATGATCCTGTCTACTGAGAAGG - Exonic
1154206193 18:12339036-12339058 GATGGTCTTGTCTCCTGACCTGG - Intronic
1155124093 18:22854080-22854102 CTTGCTGTTGGCTCCAGAGAGGG - Intronic
1156972336 18:43171204-43171226 CACGCTCTTCTCTTCTGTGATGG - Intergenic
1157500308 18:48185846-48185868 CATGCTCTTTTCCCCTAACAGGG + Intronic
1157867933 18:51202302-51202324 CATGCCCTGGTCTCCATAGAAGG + Intronic
1159078358 18:63707119-63707141 CTTGCTCTTGGGGCCTGAGAAGG + Intronic
1159889921 18:73943628-73943650 CCTGCTCATGCCTCCGGAGAAGG + Intergenic
1160597271 18:79984986-79985008 CATGAAATTGTCTCCTGTGACGG + Intronic
1160597278 18:79985043-79985065 CATGAAATTGTCTCCTGTGACGG + Intronic
1160597283 18:79985100-79985122 CATGAAATTGTCTCCTGTGATGG + Intronic
1162675837 19:12297502-12297524 CAGACTCTTGACTCCTGAAATGG + Intergenic
1163027415 19:14520325-14520347 CATCCTCCTGCCTCCTGAGGCGG + Intronic
1164403373 19:27919081-27919103 AATACCCTTGTCTCCTGAGGAGG - Intergenic
1167506895 19:49875751-49875773 TTTGCTCATGTCTCCTGAGTTGG - Intronic
1168417080 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG + Intergenic
925993905 2:9276277-9276299 CACACTCCTCTCTCCTGAGAAGG - Intronic
929260452 2:39861372-39861394 CATGCTGTTTTCTCATGATAGGG + Intergenic
931014276 2:57958037-57958059 GATCCTCCTGTGTCCTGAGAAGG - Intronic
931223681 2:60310705-60310727 CCTGCTCTTTTCTCCTTAGGCGG - Intergenic
932490733 2:72118524-72118546 AATGATCCTGTCTCCTGGGACGG + Intergenic
934563925 2:95328049-95328071 CCTGCTCTCTTCCCCTGAGAGGG - Intronic
935272573 2:101447912-101447934 CTTGCTCTTGGCTTCTAAGATGG + Intronic
935828086 2:106971636-106971658 GAAGCTCTTGTCTCCTGTGACGG + Intergenic
935995249 2:108764232-108764254 CTTGCTCTCGTCTCATTAGAAGG - Exonic
936271668 2:111053920-111053942 CTAGCTCTTGTCTCCTGACCTGG - Intronic
936513591 2:113167805-113167827 CATGCTCCTTTCTCCAGAAAAGG - Intronic
937029729 2:118728424-118728446 CTTGCTGTTGGCTCCTCAGATGG - Intergenic
937218749 2:120329397-120329419 CCTGCTCCTGTTTCCTCAGAGGG + Intergenic
938746916 2:134288133-134288155 CATGATTTTGTCTCCTGACATGG + Intronic
939844124 2:147222434-147222456 CATGCTCTTTTCTTTTGGGAGGG + Intergenic
942168128 2:173262568-173262590 TTTGCTCTTGTCTCCTGGGCTGG - Intronic
944709560 2:202323620-202323642 CATGCTCATGTCTAATGGGAAGG + Intergenic
946535122 2:220619445-220619467 GATGGTCTTGACTCCTGAAAAGG - Intergenic
946676875 2:222169700-222169722 CCTGCCCTTGTCTCATGATATGG - Intergenic
947957997 2:234211914-234211936 CTTGCTCTTATCTTCTGAAATGG + Intergenic
949010502 2:241675662-241675684 AAGGCTCTTCTCTCCTGGGATGG + Intergenic
1170967704 20:21090530-21090552 TATGCTCTTGACTCTGGAGAAGG - Intergenic
1171442122 20:25173536-25173558 CATGCTCTTGGCTACCTAGAAGG - Intergenic
1171773560 20:29345891-29345913 CATGCTCTTGTCTCCTATTTGGG + Intergenic
1171902788 20:30872595-30872617 CATGCTCTTGTCTCCTATTTGGG - Intergenic
1171961276 20:31496810-31496832 CATGCTCTTGCCTCCTCTGCTGG - Intergenic
1174011496 20:47453382-47453404 CATGTTCCTGTCTTCTGGGATGG - Intergenic
1175262041 20:57680939-57680961 CATTCTCCTGCCTCCAGAGAAGG - Intronic
1180096321 21:45556872-45556894 CCTGCACGTGTCTCCTGGGACGG + Intergenic
1180319036 22:11304007-11304029 CATGCTCTTGTCTCCTATTTGGG + Intergenic
1181666054 22:24398207-24398229 CCTGCTCTTTGCCCCTGAGATGG - Intronic
1183023227 22:35044021-35044043 CAAGCTCTTGACAGCTGAGAGGG + Intergenic
1184161077 22:42697712-42697734 CATGCTCCTGGCCCCCGAGACGG + Intronic
1184944776 22:47795476-47795498 CTGGCTCTTGTCACCTGTGAAGG - Intergenic
1185026158 22:48414470-48414492 CATGCTCTTGGCTCCTGCCCTGG + Intergenic
1203280774 22_KI270734v1_random:129775-129797 CCTGCCCTTGTCTCCTGTGCTGG + Intergenic
950217137 3:11167797-11167819 CGTGCTCAGCTCTCCTGAGAGGG + Intronic
952233883 3:31458903-31458925 CTTGCTCTTGTCTCCCAAGCTGG - Intergenic
953045662 3:39292096-39292118 CTTGCTCTTGTTGCCTTAGAGGG - Intergenic
955519966 3:59766076-59766098 CATCCCCTTGTCTCCTCACATGG - Intronic
956534483 3:70260536-70260558 CATCCTCTGGTCTCATGATAGGG - Intergenic
957207714 3:77218996-77219018 CTTGCTCTTGTCTCCCGGGCTGG + Intronic
957236720 3:77602498-77602520 CAGGTTCTTGTGTCCTGAGGAGG + Intronic
957544594 3:81621493-81621515 CATGCTTTGGTCTCCTTATAAGG + Intronic
961476576 3:127150447-127150469 AAGGCTCTGGGCTCCTGAGAGGG - Intergenic
962829119 3:139124091-139124113 CAAGGCCTTGTTTCCTGAGAAGG - Intronic
964172106 3:153783147-153783169 CATGTTCTAGTCTCCTTAGGTGG - Intergenic
965789565 3:172373061-172373083 CCTGCTCTAGGCTGCTGAGAAGG - Intronic
968674587 4:1870924-1870946 CAAGCTCCTGTCCCGTGAGAGGG - Intergenic
969489721 4:7492104-7492126 CGTGCACCTGTCTCTTGAGAGGG - Intronic
970207123 4:13666182-13666204 CAGGCTCATGACTCATGAGAGGG - Intergenic
972018213 4:34273018-34273040 CATGTTCTTGTGTCCTCACATGG + Intergenic
972478034 4:39471361-39471383 TTTGCTCTTGTCGCCTGAGCTGG + Intronic
973285013 4:48405191-48405213 CAAGTTCTAGTCTCCTGATATGG - Intronic
976677521 4:87719679-87719701 CATCCTCCAGTCTCCTGTGAGGG - Intergenic
977247140 4:94646130-94646152 CATGCTCTTTTTTCTTAAGAAGG + Intronic
978155975 4:105489633-105489655 TATGCTCTTGTCTCCAGGGCTGG + Intergenic
979624437 4:122828894-122828916 CTTGCCCTTGTCAGCTGAGATGG - Intronic
979986908 4:127326283-127326305 CATGCACTTTTCACCAGAGATGG - Intergenic
982697482 4:158619690-158619712 GATGCTTTTGTTCCCTGAGACGG - Intronic
983412609 4:167419128-167419150 AATGCTCTGGTCCCCTTAGATGG - Intergenic
985227445 4:187777918-187777940 CAGGCTCTTGTCCCATGACAAGG + Intergenic
986556781 5:9017856-9017878 CTTGCTCTTGTCTCCTAGGCTGG + Intergenic
987702929 5:21425164-21425186 TATTCTCTTGTCTGCTCAGAAGG - Intergenic
988492043 5:31713153-31713175 CATGCTCTGGTCTCACCAGAAGG + Intronic
989153033 5:38319026-38319048 CATGCTCCAGGCTCATGAGATGG + Intronic
989189264 5:38654378-38654400 AATGATCTTGCCTCCTGAAAAGG - Intergenic
993531242 5:89027736-89027758 CATCTTCTTGTCTTCTGAGCAGG + Intergenic
993553260 5:89302433-89302455 CAGACACTTGTTTCCTGAGATGG + Intergenic
995015166 5:107301772-107301794 CATGCTCTTGTTTGCTGATAAGG - Intergenic
995181422 5:109234278-109234300 CCTGCTCTTGTCTCCTTGGTGGG + Intergenic
998639761 5:143996204-143996226 CATTCTCCTTTATCCTGAGAGGG + Intergenic
1001210748 5:169808118-169808140 TATGCTCTTGTCAGCAGAGAAGG - Intronic
1004331645 6:14727427-14727449 AATGCTCTTGGCTCCAGAGAAGG - Intergenic
1007026879 6:38585124-38585146 CATGCTCTTGTCTCCTGAGATGG - Intronic
1008925109 6:56884017-56884039 CCTGCCTCTGTCTCCTGAGAAGG - Intronic
1010835687 6:80585457-80585479 AATTCTCATGTGTCCTGAGAGGG + Intergenic
1014873656 6:126628482-126628504 CATGCTCCTCTCTACTGGGATGG - Intergenic
1016283349 6:142445184-142445206 AATGCTCTTGTCTCCCAGGATGG - Exonic
1016489683 6:144583813-144583835 CACAATCTTGTCTTCTGAGATGG + Intronic
1017298030 6:152821902-152821924 CATGCTCCTCTCTCCTCAAAGGG + Intergenic
1017726107 6:157276956-157276978 CAGGGTCGTGTCTCCTTAGAAGG - Intergenic
1018201739 6:161401581-161401603 CTTGCTCTTGTCGCCCAAGATGG - Intronic
1018846364 6:167559639-167559661 AATATTCTTGTCTCCTGGGAGGG - Intergenic
1019089834 6:169519417-169519439 CATTTTCTTGGCTCCTGAGGAGG + Intronic
1021978673 7:26033224-26033246 AATCCTCTTTTCACCTGAGATGG + Intergenic
1023708306 7:42965389-42965411 CATCCTGTAGTCTCCTGGGAGGG + Intergenic
1025125083 7:56337996-56338018 CTTGCTCTTGTCTCCTAGGCTGG + Intergenic
1027264485 7:76486657-76486679 CATGCTCTTGTCTCCCTTAATGG + Intronic
1027315855 7:76984771-76984793 CATGCTCTTGTCTCCCTTAATGG + Intergenic
1027331903 7:77105893-77105915 CATGCTCTTGTTTCCTTTCATGG + Intergenic
1029783873 7:102765431-102765453 CATGCTCTTGTTTCCTTTCATGG - Intronic
1031953580 7:127918168-127918190 GATTCTCATGTCTCCCGAGAAGG + Intronic
1032169819 7:129575513-129575535 CTTGCTGTTGTCACCTGAGCTGG + Intergenic
1035234169 7:157485507-157485529 GATGCTGTGGTGTCCTGAGATGG + Intergenic
1036209350 8:6829625-6829647 CATGCTTCAGTCTCCTGAGTAGG + Intronic
1037662447 8:20939513-20939535 CCTGCCCTGGTCTCCTGAGCAGG + Intergenic
1038869634 8:31480097-31480119 AATGCTGTGGTCTCCTGAGTTGG + Intergenic
1041873222 8:62659187-62659209 CTTGCTCTTCTCTACTGAGCTGG + Intronic
1042896767 8:73679296-73679318 CATGCTGTTTTGTCCTGAGTGGG - Intronic
1043074047 8:75673557-75673579 CATGCTCATGTTTCCTGACAAGG + Intergenic
1049231148 8:141482700-141482722 CCTTCTCTAGTTTCCTGAGACGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1051330685 9:16022343-16022365 CATGCTAATGTCTGCAGAGAAGG + Intronic
1052391047 9:27878961-27878983 CGTGCTCATGTTGCCTGAGAGGG - Intergenic
1053339406 9:37310222-37310244 CAGGTTCTTGTCTTCTGAAAGGG - Intronic
1056841671 9:90002965-90002987 CATGCTCTGGTCTCTTCAGAGGG - Intergenic
1058015926 9:100032031-100032053 CATGCTCTTGGCCCCCTAGAAGG + Intronic
1059516719 9:114902740-114902762 CAGGGTCTGGTCTTCTGAGATGG + Intronic
1062069286 9:134546905-134546927 CCTGCCCCTGTCTGCTGAGATGG + Intergenic
1203367262 Un_KI270442v1:269756-269778 CATGCTCTTGTCTCCTATTTGGG + Intergenic
1187501517 X:19843046-19843068 CTTGCTCTTGTCCCCTGGGCTGG + Intronic
1188496344 X:30787156-30787178 CATGCTCTCCTCTCCTGCAAGGG - Intergenic
1189448133 X:41100674-41100696 TTTGCTCTTGTCACCTGAGCTGG + Intronic
1189516203 X:41715590-41715612 TTTGCTCTTGTCTCCTGGGCTGG - Intronic
1192734530 X:73836627-73836649 CTTGCTCTTGTCAACTGAAAAGG + Intergenic
1193921587 X:87434250-87434272 TATGATTTTGTCTCCTGAGATGG + Intergenic
1196970815 X:121106716-121106738 CCTGAACTTGTCACCTGAGATGG - Intergenic
1201071432 Y:10150475-10150497 CATGCTCTTGTCTCCTATTTGGG - Intergenic
1201510589 Y:14756713-14756735 CTTGCTGTTGTCACCTGGGATGG - Intronic