ID: 1007029413

View in Genome Browser
Species Human (GRCh38)
Location 6:38614658-38614680
Sequence ATGGATTAGGTTGAGGTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007029413 Original CRISPR ATGGATTAGGTTGAGGTCGA AGG (reversed) Intronic
910010910 1:82461085-82461107 ATGCATTATGTTGAAGTCAAAGG + Intergenic
916438216 1:164796573-164796595 ATGGATTGGATTGAGATCCAAGG - Intronic
920040177 1:203090382-203090404 ATTGATGAGGATGAGGTCGGGGG + Intergenic
1066057252 10:31693717-31693739 GAGGATTAGGTTGAGGCAGATGG + Intergenic
1069308726 10:67005971-67005993 ATGGAGTAGGTTGGGTGCGATGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1080612411 11:33915913-33915935 ATGGAAAAGGTTGAGATCCAGGG - Intergenic
1081560244 11:44207455-44207477 ATGGATTAGGCTGGGTTCAAGGG + Intronic
1085015976 11:73174283-73174305 ATGGAGCAGGTTGAGCTGGAGGG - Intergenic
1085821711 11:79800949-79800971 AGAGCTTAGGTTGAGGTGGAAGG - Intergenic
1086149824 11:83596665-83596687 ATAGATTAGGTTCAGGTGAATGG - Intronic
1089867409 11:121643531-121643553 ATGGCTTAGCTTGAGCTCGGAGG + Intergenic
1090679976 11:129045008-129045030 ATGAATTAGGTTTAGGTATATGG + Intronic
1091833561 12:3568249-3568271 ATGGAATAGGCTGAGGAGGAGGG + Intronic
1091990584 12:4952481-4952503 ATGGTTTAAGTTGAGGAGGAAGG + Intergenic
1097673474 12:62569772-62569794 ATGGATTATATGGAGGTGGAAGG + Intronic
1102970484 12:117162231-117162253 ATGGATCATGATGAGGACGAAGG + Intronic
1117975812 14:61295659-61295681 ATGGATAAGGTTGAGAACCATGG - Intronic
1132209418 15:100008946-100008968 ATGCAGTAGGCTGAGGTAGAAGG - Intronic
1133500573 16:6362590-6362612 TTAGATTAGGTTAAGGTAGAGGG + Intronic
1134791703 16:16994859-16994881 ATGGATGAAGTTGAGGGCGTTGG + Intergenic
1140194290 16:72844131-72844153 CTGGATCAGGGTGAGGTCCAAGG + Intronic
1146145941 17:30416562-30416584 ATGGCACAAGTTGAGGTCGAGGG - Intronic
1149441415 17:56677787-56677809 ATTGATCAGGTTGAGGAGGAGGG - Intergenic
1151021003 17:70617488-70617510 AAGGATTAAGGTGAGGTGGATGG - Intergenic
1161005804 19:1935819-1935841 ATAGATAAGGTTGAGGCCCAGGG + Intergenic
1163173221 19:15547420-15547442 ATGAATTATGTGGAGGTCCAGGG - Intronic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939672798 2:145034263-145034285 ATGGATGAGATTGAGGTCAAGGG + Intergenic
1180395502 22:12330071-12330093 ATGGATCATTTTGAGGTCTACGG - Intergenic
1180404244 22:12534680-12534702 ATGGATCATTTTGAGGTCTACGG + Intergenic
954443481 3:50534325-50534347 ATGGATGAGGCTGAGGACGCCGG - Intergenic
960823493 3:121758586-121758608 ATGGATTAGCTAGAGGTCCCTGG + Intergenic
961032172 3:123615755-123615777 ATGCAGTAGGCTGAGGTGGAAGG - Intronic
964909433 3:161760559-161760581 ATGAATTAGGTTTAGGTTTAAGG - Intergenic
967183447 3:186926634-186926656 TTGGCTAAGGTTGAGGTCAAGGG + Intergenic
971832173 4:31708995-31709017 ATGGAGTAGGATGAAGTTGAAGG - Intergenic
983638234 4:169919761-169919783 ATGGCTTAGGTTGGGCTCAACGG - Intergenic
983650606 4:170032717-170032739 AGGGATGAGGCTGAGGTGGATGG + Intronic
983827567 4:172282726-172282748 AAGGATTAGGGTGATGGCGATGG + Intronic
986862495 5:11943656-11943678 TAGGTTTAGGTTGTGGTCGACGG + Intergenic
987849861 5:23337667-23337689 ATGGATTACTTTGAGGTCAAAGG + Intergenic
990470512 5:56111124-56111146 ATGGATTATGTAGATGGCGAAGG + Exonic
1001940212 5:175734878-175734900 ACGGAGGAGGTTGAGGTGGAAGG + Intergenic
1002134239 5:177098158-177098180 ATGGAGTGGGGTGAGGTGGAGGG + Intergenic
1004606182 6:17196908-17196930 GTGGAATAGGTGGAGGTCAAAGG - Intergenic
1007029413 6:38614658-38614680 ATGGATTAGGTTGAGGTCGAAGG - Intronic
1007280336 6:40707721-40707743 TTAGATTAGGTTTAGGTCCAGGG + Intergenic
1010939673 6:81901524-81901546 AAGGATTAAGTTGAGCTCAAGGG - Intergenic
1016828921 6:148414346-148414368 ATGGTTCAGGATGAGGGCGAGGG + Intronic
1017722358 6:157252811-157252833 CTGGATTGGGTTTAGGTAGAGGG + Intergenic
1018503777 6:164442301-164442323 ATGGATTAGGTGGAGGTGATGGG - Intergenic
1027198467 7:76047707-76047729 ATGGGTTTGGCTGAGGTCGGGGG + Exonic
1028234329 7:88342278-88342300 ATGGATGAGGTTGAGATTTATGG + Intergenic
1029551790 7:101240532-101240554 AGGGAGTGGGTGGAGGTCGAGGG - Intronic
1032814627 7:135460114-135460136 CTGGATTAGGTTGTGGTTTAAGG + Intronic
1034408744 7:150924867-150924889 ATTGATTGGGTTGGGGTCAATGG + Intergenic
1035867455 8:3100295-3100317 ATGGTGGAGGTTGAGGTGGAAGG - Intronic
1042801152 8:72719215-72719237 ATGGGTTATGTGCAGGTCGAGGG - Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1049860692 8:144896510-144896532 AAGGTTTAGGTTGAGGTCCATGG - Intronic
1051011639 9:12422297-12422319 ATTGATTAAGTTGAGGTTTAGGG - Intergenic
1056421254 9:86428762-86428784 ATGTAGTAGGGTGAGGTGGAAGG - Intergenic
1057901620 9:98953494-98953516 TTGGATTGGGTTGAGTTTGATGG - Intronic
1187209325 X:17213612-17213634 ATGCAGGAGGTTGAGGTGGAAGG - Intergenic
1188472052 X:30552068-30552090 ATGTCTCAGGTTGAGTTCGAAGG + Intergenic
1188681138 X:33007015-33007037 TAGGATTAGGTTGATGTCCATGG - Intronic
1196112257 X:111959570-111959592 AAGGATTTGGGTGAGGGCGATGG + Intronic