ID: 1007034304

View in Genome Browser
Species Human (GRCh38)
Location 6:38658981-38659003
Sequence CTGCTGTCCTAGGGTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007034301_1007034304 11 Left 1007034301 6:38658947-38658969 CCTCTGTAAATTCTTATATGCTG No data
Right 1007034304 6:38658981-38659003 CTGCTGTCCTAGGGTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007034304 Original CRISPR CTGCTGTCCTAGGGTAGAAG TGG Intergenic
No off target data available for this crispr