ID: 1007036848

View in Genome Browser
Species Human (GRCh38)
Location 6:38682211-38682233
Sequence ACTTGGGAACAGACTTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007036841_1007036848 27 Left 1007036841 6:38682161-38682183 CCAAGTACCACAAGTAGATTCCA 0: 1
1: 0
2: 1
3: 17
4: 101
Right 1007036848 6:38682211-38682233 ACTTGGGAACAGACTTAGGTAGG 0: 1
1: 1
2: 0
3: 20
4: 311
1007036843_1007036848 7 Left 1007036843 6:38682181-38682203 CCAAAACTTGTTTATTTCAAAAC 0: 1
1: 0
2: 4
3: 67
4: 681
Right 1007036848 6:38682211-38682233 ACTTGGGAACAGACTTAGGTAGG 0: 1
1: 1
2: 0
3: 20
4: 311
1007036842_1007036848 20 Left 1007036842 6:38682168-38682190 CCACAAGTAGATTCCAAAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1007036848 6:38682211-38682233 ACTTGGGAACAGACTTAGGTAGG 0: 1
1: 1
2: 0
3: 20
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007036848 Original CRISPR ACTTGGGAACAGACTTAGGT AGG Intronic
901911820 1:12464899-12464921 ACTTGGGAACAGACAAAGTGTGG - Intronic
902544515 1:17181295-17181317 ACATGAAAACTGACTTAGGTGGG + Intergenic
902570491 1:17343959-17343981 ACTGGGTAACAGACAGAGGTTGG + Intronic
908006817 1:59736352-59736374 ACTTGGTAACAGGCAGAGGTTGG + Intronic
908047446 1:60185630-60185652 ACTGGGTAACAGACAGAGGTTGG - Intergenic
908177085 1:61566323-61566345 ACTGGGTAACAGACAGAGGTTGG - Intergenic
909284306 1:73795523-73795545 ACTTCAGAACAGACTTAGATAGG + Intergenic
909373575 1:74914804-74914826 ACTGGGTAACAGACAGAGGTTGG - Intergenic
910536021 1:88298589-88298611 CACTGGGAACAGACTTAGGAAGG - Intergenic
911051766 1:93677462-93677484 ACTTGGGTACAGACTGGGTTCGG - Intronic
911777042 1:101827850-101827872 ATTTGGGATAAGATTTAGGTGGG - Intronic
912740869 1:112196018-112196040 ACTTGGGTACAGACTTAGGTAGG + Intergenic
914711900 1:150221979-150222001 ACTTTGGAAGAGGCTGAGGTGGG + Intronic
914861342 1:151388824-151388846 ACTTGGGAAAAGAGTGAAGTTGG + Intergenic
916650440 1:166830025-166830047 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
916948977 1:169759569-169759591 ACTGGGTAACAGACAGAGGTTGG - Intronic
918886523 1:190201035-190201057 ACTGGGTAACAGGCATAGGTTGG + Intronic
919375979 1:196795527-196795549 ACTGGGTAACAGACAGAGGTTGG + Intergenic
919385685 1:196920415-196920437 ACTGGGAAACAGACAGAGGTTGG + Intronic
920342421 1:205284055-205284077 ACTTGGGGACAGTCTGAGTTTGG - Intergenic
920903756 1:210138538-210138560 ACTTGGGAATAGCTATAGGTTGG + Intronic
922035318 1:221842031-221842053 ACTAGGGAAAAGATTTAAGTTGG + Intergenic
923401256 1:233617297-233617319 ACTTGGAAGAAGGCTTAGGTTGG + Intronic
924173166 1:241362332-241362354 TGTTGAGAACAGACATAGGTGGG - Intergenic
1063941251 10:11132079-11132101 ACTTGAGGACAGACTTACATTGG - Intronic
1064650058 10:17499947-17499969 ACTTGGGAAGAGGCTGAGGTGGG + Intergenic
1066427961 10:35325962-35325984 ACTTGGGAGGAGGCTGAGGTAGG + Intronic
1066636749 10:37510778-37510800 ACTGGGTAACAGGCTGAGGTTGG + Intergenic
1066995158 10:42556285-42556307 TCTTCAGAACAGACTGAGGTTGG - Intergenic
1068493933 10:57760467-57760489 AATTGGGAAAATACTTATGTAGG + Intergenic
1068937312 10:62648583-62648605 AGTTGGGAAAAGAATGAGGTTGG + Intronic
1071028462 10:81143493-81143515 ACTTGGGAGCAGACGAAAGTTGG - Intergenic
1071198177 10:83185915-83185937 TCTTGGGAACAGACAGAGCTAGG - Intergenic
1071497971 10:86181461-86181483 ACATGGGAACAGACTTCTCTGGG + Intronic
1071956564 10:90767080-90767102 AATTGGGAAGAGCCTTAGGCTGG + Intronic
1072219613 10:93316358-93316380 ACTTGGGAACAGGTTGAGGAGGG + Intronic
1073075728 10:100825013-100825035 CCTCGGGCACAGACTTGGGTGGG - Intronic
1074511140 10:114113139-114113161 TCTTTGGAACAGACTGAGTTTGG - Intergenic
1074783787 10:116821115-116821137 TGTTGGGAATAGACTTTGGTAGG - Intergenic
1077633150 11:3824518-3824540 GCTTGGGAACAAACTGAGGGTGG + Intronic
1078432442 11:11298376-11298398 ACTTGTGAAGACACTCAGGTAGG + Intronic
1079147711 11:17868543-17868565 ACTGGGTAACAGACAGAGGTTGG - Intronic
1080946836 11:36982860-36982882 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1081077848 11:38697654-38697676 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1081388846 11:42504592-42504614 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1084798880 11:71527974-71527996 ACTTGGGAAGAGAATTTGTTAGG - Exonic
1084880579 11:72168635-72168657 ACTGGGGAACAGGCAGAGGTTGG + Intergenic
1086006672 11:82046561-82046583 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1088644417 11:111905551-111905573 ATTTGGCATGAGACTTAGGTGGG - Intergenic
1088860939 11:113799141-113799163 CCTTGGGAAAAGGATTAGGTGGG - Exonic
1090506424 11:127320378-127320400 ACTGGGTAACAGGCATAGGTTGG - Intergenic
1093192681 12:16092720-16092742 ACTGGGTAACAGACTGAGGTTGG - Intergenic
1093973839 12:25400017-25400039 ACTGGGCAACAGGCATAGGTTGG + Intergenic
1094782956 12:33814164-33814186 GCTTGGGCATACACTTAGGTTGG + Intergenic
1095234712 12:39782661-39782683 ACTGGGTAACAGACAAAGGTTGG + Intronic
1095308088 12:40661879-40661901 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1095580978 12:43797817-43797839 ACTTAGGTACAGACTGACGTGGG - Exonic
1095838928 12:46670498-46670520 ACTTGGTAACAGGCTGAAGTTGG - Intergenic
1096329396 12:50697082-50697104 ACTTTGGAACAGACTCAGGAAGG - Exonic
1096331286 12:50715343-50715365 ACTTGGCTCCAGGCTTAGGTTGG + Intronic
1097443876 12:59645719-59645741 ACTGGGTAACAGGCTGAGGTTGG + Intronic
1097681060 12:62649431-62649453 ACTTGGGAAGTGATTTGGGTGGG + Intronic
1098145057 12:67489437-67489459 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1098686298 12:73425252-73425274 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1099371263 12:81834378-81834400 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1099663573 12:85597350-85597372 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1100434242 12:94557485-94557507 ACTTGGGAATAAACTTAAGGAGG - Intergenic
1101033944 12:100686373-100686395 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1101083663 12:101213981-101214003 ACTTGGCAACAGACAGAGGTTGG + Intergenic
1101371042 12:104130894-104130916 AATTGGAAACAAACTTTGGTTGG + Intronic
1101476477 12:105054174-105054196 ACTTGGATTCAAACTTAGGTTGG + Intronic
1103259634 12:119575407-119575429 ATTTGGGACCAGACCCAGGTTGG + Intergenic
1104172200 12:126292756-126292778 ACTTGGTAACAGGCAAAGGTTGG - Intergenic
1104933500 12:132352667-132352689 ACTTGGGAAGAGGCTGAGGTGGG + Intergenic
1105758481 13:23491755-23491777 AGCTGGGATCAAACTTAGGTTGG - Intergenic
1105902363 13:24766660-24766682 ACTTGGAAACAGAGCTAGATAGG + Intronic
1107532169 13:41292822-41292844 ACTTGGGAGGAGGCTGAGGTGGG + Intergenic
1109297664 13:60553815-60553837 ATTTGGGAAAAGATTTTGGTGGG + Intronic
1111004258 13:82228393-82228415 ACTTTGGAGGAGACTGAGGTGGG - Intergenic
1111077910 13:83263350-83263372 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1111207710 13:85034599-85034621 ACTGGGTAACAGACAAAGGTTGG + Intergenic
1111218910 13:85179460-85179482 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1112632952 13:101181628-101181650 ACTTGGGAGGAGGCTGAGGTGGG + Intronic
1113112781 13:106841888-106841910 ATTTGGGGAATGACTTAGGTTGG - Intergenic
1113320748 13:109229821-109229843 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1113676550 13:112211021-112211043 GCTTTGGAGCAGAATTAGGTAGG - Intergenic
1114161491 14:20173110-20173132 TTTTGGGCACAGAATTAGGTGGG - Intergenic
1114271128 14:21100946-21100968 AAATGGGAACAGAGTGAGGTCGG + Intronic
1114431415 14:22664916-22664938 ACTTCAGAAAGGACTTAGGTGGG - Intergenic
1114942053 14:27624577-27624599 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
1114986194 14:28231521-28231543 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1115007250 14:28500030-28500052 ACTGGGGAACAGGCAGAGGTCGG - Intergenic
1115115789 14:29879629-29879651 ACTGGGTAAGAGACATAGGTTGG + Intronic
1116195263 14:41716730-41716752 ACTGGGTAACAGACAGAGGTTGG - Intronic
1116353558 14:43898008-43898030 ACTTGGAAAATGATTTAGGTAGG - Intergenic
1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG + Intergenic
1118343811 14:64918719-64918741 ACTTGGGAAGAGGCTAAGGCAGG + Intronic
1118836071 14:69478841-69478863 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1119272560 14:73321633-73321655 ACTGGGGAATATATTTAGGTTGG + Intronic
1119872024 14:78026205-78026227 ACTTGGGCTCAGATTTAGATTGG + Intergenic
1120418028 14:84244295-84244317 ACTTGGGAACAGGCAGAGGTTGG - Intergenic
1120921174 14:89756622-89756644 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1125274076 15:37971961-37971983 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1127558677 15:60114213-60114235 ACTTGGCAAAAGACTTGGGCAGG + Intergenic
1127967164 15:63930950-63930972 ACTTGGGAAGAGGCTGAGGTGGG + Intronic
1128019652 15:64379368-64379390 ACTTGGGAAGAGCCTGAAGTGGG + Intronic
1128177190 15:65566237-65566259 ACTGGGTAACAGACAGAGGTTGG - Intronic
1129071202 15:72952974-72952996 CCTTGGGGACAGCCTTAGGCTGG - Intergenic
1130303649 15:82699004-82699026 TCTTGGGAACAGAAGTTGGTGGG - Intronic
1135179741 16:20262310-20262332 CCTTGGGTTCAGACTCAGGTGGG + Intergenic
1135293533 16:21260588-21260610 ACATGGGAACAGGCTGAGCTCGG - Intronic
1135611711 16:23873259-23873281 ACTTGGGAGGAGACTGAGGCAGG + Intronic
1136295211 16:29297739-29297761 ACTTGGGAACAGACAGGGCTGGG + Intergenic
1139726634 16:68905289-68905311 ACTTTGGAAGAGGCTGAGGTGGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140654778 16:77128686-77128708 ACTTAGGAATAAACTTAGGGAGG + Intergenic
1140939948 16:79712206-79712228 ACTTGGACCCAGACTTTGGTGGG + Intergenic
1143364575 17:6397805-6397827 ACATGGTAACATACTTTGGTGGG - Intronic
1144805123 17:17960443-17960465 ACTTGGGAGGAGGCTGAGGTGGG - Intronic
1145378264 17:22371746-22371768 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1145753560 17:27373326-27373348 ACTTGGTAGCAGACAGAGGTTGG + Intergenic
1145816785 17:27800746-27800768 ACTTGGGACCAGAAAGAGGTGGG - Intronic
1146938735 17:36828709-36828731 CTTGGGGCACAGACTTAGGTGGG - Intergenic
1147758517 17:42783156-42783178 ACTTGGGGACAGACTGATGAGGG - Intronic
1148189005 17:45665862-45665884 ACTGGGGAACAGAGTTTGGGAGG + Intergenic
1149371075 17:55993874-55993896 ACTGGGTAACAGACAAAGGTTGG - Intergenic
1149673249 17:58434438-58434460 ACTTGGGAAGAGGCTGAGGCAGG + Intronic
1153455818 18:5280975-5280997 ACTTGGGAAAATATTTATGTAGG + Intergenic
1155748477 18:29390607-29390629 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1156065559 18:33139341-33139363 ACTGGGTAACAGGCTGAGGTTGG + Intronic
1156081313 18:33339988-33340010 ACTTGGTAACAGGCAGAGGTTGG + Intronic
1159157430 18:64602189-64602211 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1162504655 19:11076064-11076086 TCTGGGGAACAGAGTTAGGTCGG + Intergenic
1165324939 19:35109036-35109058 AGGTGGGAACAGACTGCGGTGGG + Intergenic
1165888494 19:39096570-39096592 ACTGGGTAACAGACAGAGGTCGG - Intronic
1165929546 19:39347680-39347702 ACTTTGGAAGAGAGTTAAGTAGG + Intronic
1165974870 19:39666876-39666898 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1166521493 19:43483385-43483407 ACTCGGGAAAAGGCTAAGGTGGG - Intronic
925474108 2:4193390-4193412 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
926791218 2:16573963-16573985 ACTTGATAACAGACAGAGGTTGG + Intronic
929913924 2:46117731-46117753 ACTTGGGAAAACACATAGGAAGG + Intronic
930442906 2:51431601-51431623 ACTGGGTAACAGACAGAGGTTGG + Intergenic
931096024 2:58942213-58942235 ACTGGGTAACAGACATAGGTTGG + Intergenic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
932686770 2:73877151-73877173 ACCAGGGAGCAGACTGAGGTTGG + Intergenic
933562225 2:83901964-83901986 ACTGGGAAATAGACTCAGGTTGG + Intergenic
936577766 2:113669833-113669855 AGATGGGAGCAGACTGAGGTAGG + Intergenic
936872262 2:117147003-117147025 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
937779561 2:125821731-125821753 ACATGGAAACAGACTGAAGTGGG - Intergenic
937963125 2:127478601-127478623 ACTTGGGAGGAGACTGAGGCAGG + Intronic
939032609 2:137094460-137094482 ACTTGGGAAGAGGCTGAGGCAGG + Intronic
939507002 2:143057736-143057758 ACTGGGTAACAGGCTGAGGTTGG - Intergenic
939559921 2:143720285-143720307 ACTACAGAGCAGACTTAGGTAGG + Intronic
940785741 2:157979616-157979638 ACTGGGTAACAGACAGAGGTTGG + Intronic
941289874 2:163662021-163662043 ACTTGGTAACAGGCAGAGGTTGG + Intronic
941414211 2:165198808-165198830 ACTTGGGAACATGTTTAGTTAGG + Intronic
941469013 2:165861605-165861627 ACTGGGTAACAGACAGAGGTTGG - Intronic
942904847 2:181167796-181167818 ACTAGGTAACAGACAGAGGTTGG - Intergenic
943208593 2:184932178-184932200 ACTGGGTAACAGACAGAGGTTGG - Intronic
944943190 2:204652595-204652617 ACTTGGTAACAGGCAGAGGTTGG - Intronic
947227475 2:227853992-227854014 ACTTGGGAACATCCCTGGGTGGG + Intergenic
948312004 2:236994235-236994257 AGTTGGGGACTGGCTTAGGTTGG - Intergenic
1170474914 20:16705339-16705361 ACTGGGTAACAGGCTGAGGTTGG + Intergenic
1171525014 20:25802261-25802283 ACTTGGTAACAGGCAGAGGTTGG + Intronic
1171551813 20:26053623-26053645 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1175854167 20:62111143-62111165 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1177197704 21:17920135-17920157 ACTGGGTAACAGACAGAGGTTGG - Intronic
1177533099 21:22388647-22388669 ACTAGGTAACAGACAGAGGTTGG + Intergenic
1178046281 21:28697536-28697558 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1178178688 21:30133808-30133830 ACTTTGGAACAGGCAGAGGTTGG - Intergenic
1179111731 21:38452710-38452732 CCTTCAGAACAGACTTAGCTGGG + Intronic
1182793963 22:32976947-32976969 ACTTGGGAAAAGTCTCAGGACGG - Intronic
1183283904 22:36950922-36950944 GGTTGTGAACAGACTGAGGTGGG + Intergenic
1185219716 22:49623292-49623314 ACTTGGGAACTGACTGGGGGAGG - Intronic
1185422467 22:50742829-50742851 AGATGGGAGCAGACTGAGGTAGG - Intronic
949198658 3:1344369-1344391 ACTTGGGAACAGTCTGTGGAAGG + Intronic
950700802 3:14744478-14744500 ACTGGGTAACAGACAAAGGTTGG - Intronic
950972360 3:17201979-17202001 ACTTGGTAACAGGCAGAGGTTGG + Intronic
952448592 3:33408967-33408989 AGTTGGCAAGAGACTTAAGTTGG - Intronic
952753983 3:36849852-36849874 ACTTTGGAAAATACTTTGGTTGG - Intronic
953033294 3:39191647-39191669 AACTGGGACCAGACTTACGTGGG + Intronic
953068637 3:39498301-39498323 ACCTGGGAAAAGAGTTAGGAGGG + Intronic
953149593 3:40312733-40312755 ACTTAGGGATAGACTTATGTTGG - Intergenic
953290091 3:41651601-41651623 ACTTCAGAACAGAATCAGGTTGG - Intronic
953744955 3:45567130-45567152 CCTTGGGAACTGACTTTGCTGGG - Intronic
955746979 3:62149704-62149726 ACCTGGGAGGAGTCTTAGGTGGG - Intronic
956306307 3:67830863-67830885 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
956733154 3:72215181-72215203 TCTTGGGGACAGATTCAGGTAGG - Intergenic
957506744 3:81131171-81131193 ACTGGGTAACAGACAGAGGTTGG + Intergenic
957909411 3:86602931-86602953 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
957949426 3:87106415-87106437 ACTGGGTAACAGACCGAGGTTGG + Intergenic
958474819 3:94568005-94568027 ACTGGGTAACAGACAGAGGTTGG + Intergenic
958590131 3:96146682-96146704 ACTTAGGAATAAACTTAAGTAGG - Intergenic
959983104 3:112540212-112540234 ATTTAGGAACAGACATAGCTAGG + Intronic
960362797 3:116734688-116734710 ACTGGGTAACAGACAGAGGTTGG + Intronic
961847155 3:129775353-129775375 ACTTGGGAGGAGCCTGAGGTGGG + Intronic
963747811 3:149142934-149142956 ACTTGGGAATAGGGTTGGGTTGG + Intronic
963878428 3:150501969-150501991 ACTTTGCAACAGACAGAGGTTGG - Intergenic
964324597 3:155532896-155532918 ACTAGGTAACAGACAGAGGTTGG + Intronic
965013522 3:163126872-163126894 ACTGGGTAACAGACAGAGGTTGG - Intergenic
965045390 3:163571630-163571652 ACTGGGTAACAGACAGAGGTTGG + Intergenic
965305643 3:167060059-167060081 ACTTGGAAACAGGCAGAGGTTGG - Intergenic
965801775 3:172501671-172501693 ACCTAGGAACACACATAGGTTGG - Intergenic
965865284 3:173198246-173198268 ACTGGGTAACAGACAGAGGTTGG - Intergenic
966266995 3:178058291-178058313 ATTTAGGAACAGACCTAGGAAGG + Intergenic
966314928 3:178634197-178634219 ACTGGGTAACAGACAGAGGTGGG - Intronic
966346986 3:178990912-178990934 ACTGGGTAACAGACAGAGGTTGG - Intergenic
967559811 3:190904866-190904888 ACTGGGTAACAGACAGAGGTTGG + Intergenic
967566478 3:190979265-190979287 ACTTTGGAACAGGCAGAGGTTGG + Intergenic
970100282 4:12513969-12513991 ACTGGGTAACAGACAGAGGTTGG + Intergenic
970217721 4:13777238-13777260 ACTGGGTAACAGACAGAGGTTGG - Intergenic
970359045 4:15289193-15289215 ACTTTGGAAGAGAGTTTGGTAGG + Intergenic
971710417 4:30104706-30104728 ACCTGAGAACAGACTAATGTAGG - Intergenic
971814957 4:31475884-31475906 ACTGGGTAACAGACAGAGGTTGG - Intergenic
971900411 4:32650895-32650917 ACTGGGTAACAGACAGAGGTTGG - Intergenic
972301737 4:37791362-37791384 ACTGGGTAACAGACAGAGGTTGG + Intergenic
972880792 4:43419174-43419196 ACTTGGTAACAGGCGGAGGTTGG - Intergenic
973091880 4:46147386-46147408 ACTTGGGAGCAGAATCAGGAGGG + Intergenic
974608584 4:64185094-64185116 ACTGGGTAACAGACAGAGGTTGG - Intergenic
974763295 4:66307302-66307324 ACTGGGTAACAGACAGAGGTTGG + Intergenic
974779053 4:66528041-66528063 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
976283457 4:83347756-83347778 ACTGGGTAACAGACAGAGGTTGG - Intergenic
979438444 4:120722370-120722392 ACTAGGGAAGAGGCTCAGGTAGG - Intronic
980868130 4:138577809-138577831 ACTGGGTAACAGACAGAGGTTGG - Intergenic
982033819 4:151325967-151325989 ACTTTGGAACAAACTTGGCTTGG + Intergenic
982521094 4:156417515-156417537 ACTGGAGAACAGACAGAGGTTGG - Intergenic
983889387 4:173015314-173015336 ACTGGGTAACAGACAGAGGTTGG + Intronic
986681484 5:10237266-10237288 ACTTGGGAACTATCTTAGGTGGG - Intronic
986756852 5:10844730-10844752 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
987531910 5:19131529-19131551 ACTGGGTAACAGACAGAGGTTGG - Intergenic
987894442 5:23926353-23926375 ACTTGGTAACAGGCAAAGGTTGG - Intergenic
988714879 5:33815621-33815643 TATGGGGAACAGACTTAGCTAGG + Intronic
989203161 5:38785965-38785987 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
990595463 5:57308648-57308670 ACTGGGCAACAGACAGAGGTTGG + Intergenic
991505644 5:67321332-67321354 ACTTGAGATGAGATTTAGGTGGG - Intergenic
992694139 5:79267999-79268021 ACTTTGGGAGAGACTGAGGTGGG + Intronic
993024064 5:82626003-82626025 ACTGGGTAACAGACAGAGGTTGG + Intergenic
993638340 5:90372039-90372061 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
994489573 5:100424092-100424114 ACTTGGGCACAGAAAGAGGTGGG + Intergenic
994580364 5:101633562-101633584 ACTGGGTAACAGACAGAGGTTGG - Intergenic
996236980 5:121142331-121142353 ACTGGGTAACAGACAGAGGTTGG - Intergenic
996356543 5:122601625-122601647 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
996575129 5:124970814-124970836 CCTTGGGAACAGACTGGGGAGGG + Intergenic
998861456 5:146447737-146447759 GCCTGGGGACAGACTCAGGTCGG - Intronic
998897560 5:146815988-146816010 AATCTGGAGCAGACTTAGGTTGG - Intronic
999012205 5:148055430-148055452 ACTTGGTAACAGACAGAGGTTGG + Intronic
1000252075 5:159505161-159505183 CCTGGGGAACAGACCTAGGAGGG - Intergenic
1000554577 5:162709984-162710006 TCTTGGGAATAGAATTAGTTGGG - Intergenic
1001197379 5:169685908-169685930 CCTTGGTGACAGACTTACGTGGG - Intronic
1002835849 6:864622-864644 ACTTGTGAAGATATTTAGGTGGG + Intergenic
1003731545 6:8830058-8830080 ACTTGGAAACAGACTGAGTTGGG + Intergenic
1004245481 6:13971548-13971570 ACTGGGTAACAGACAGAGGTTGG + Intronic
1006010530 6:31039300-31039322 ACTTAGGAAGAGAGTTATGTTGG - Intergenic
1006240300 6:32672155-32672177 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1007036848 6:38682211-38682233 ACTTGGGAACAGACTTAGGTAGG + Intronic
1009288051 6:61847380-61847402 ACTTGGGAGCTAACTTTGGTGGG + Intronic
1009772380 6:68160358-68160380 ACTGGGTAACAGGCTGAGGTTGG + Intergenic
1010000211 6:70941136-70941158 ACTTGGGTACAGACTAATTTGGG + Intronic
1010525448 6:76895145-76895167 ACTGGGTAACAGGCTGAGGTTGG - Intergenic
1010713795 6:79205707-79205729 ACTGGGTAACAGACAGAGGTTGG + Intronic
1011265892 6:85518809-85518831 ACTTGGGAACATTCTAAGGAGGG - Intronic
1011439273 6:87370108-87370130 ACTGGGGAACAGGCAGAGGTTGG - Intronic
1011792616 6:90914905-90914927 ACTAGGTAACAGACAGAGGTTGG + Intergenic
1012197309 6:96359632-96359654 ACATGGGAACAGATGTAGGTTGG - Intergenic
1012239828 6:96859426-96859448 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1012649711 6:101737213-101737235 ACTTGGTAACAGACAGAGGGTGG - Intronic
1014449266 6:121564753-121564775 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1016128223 6:140433293-140433315 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1016185388 6:141192418-141192440 ACTGGGGAACAGACAGAGGTTGG - Intergenic
1016281865 6:142427545-142427567 ACTGGGTAACAGACAGAGGTTGG - Intronic
1016564983 6:145442228-145442250 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1017053564 6:150417639-150417661 AGCTGGGAACAACCTTAGGTGGG + Intergenic
1017074950 6:150609425-150609447 ACTGGGGAAGAGAGTTAAGTAGG + Intronic
1022431363 7:30325113-30325135 ACTTTGGAATAGACTTGGGGGGG + Intronic
1025300466 7:57815918-57815940 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1026292408 7:69019558-69019580 ACTAGGTAACAGGCATAGGTTGG - Intergenic
1028185832 7:87784786-87784808 ACCTAGGAACAGACTTAGTGAGG - Intronic
1028952037 7:96647108-96647130 ACATGGAAACAGAGTTAGGGAGG - Intronic
1030786515 7:113670176-113670198 ACTTGGTAACAGACAGAGGCTGG + Intergenic
1032366890 7:131307951-131307973 ACTTGAGAAAAGATTTGGGTGGG - Intronic
1033256085 7:139803093-139803115 ACTGGGTAACAGACAGAGGTTGG + Intronic
1033481527 7:141746451-141746473 ACTTGGGAGAAGGCTGAGGTGGG - Intronic
1033777459 7:144628646-144628668 ACTGGGTAACAGACAGAGGTTGG + Intronic
1033843416 7:145402969-145402991 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1034689395 7:153001833-153001855 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1037969973 8:23164798-23164820 ACTTGGGGACAGACTTTGGAAGG - Intergenic
1039186839 8:34926926-34926948 ACTTGGGAATATATTTAGTTTGG + Intergenic
1041141714 8:54827436-54827458 ACTTGGGAGAAGGCTGAGGTGGG - Intergenic
1042622159 8:70718210-70718232 ACTGGGTAACAGGCTGAGGTTGG - Intronic
1042827076 8:72990424-72990446 ACTGGGTAACAGACAAAGGTTGG + Intergenic
1043370243 8:79583140-79583162 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1044066668 8:87707094-87707116 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
1048111506 8:131473210-131473232 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1048658482 8:136570677-136570699 ACTTGGTAACAGACAGAGGGTGG + Intergenic
1049076202 8:140398316-140398338 ACTGGGTAACAGACAGAGGTTGG + Intronic
1050708619 9:8433416-8433438 ACTTTAAAACAGCCTTAGGTAGG + Intronic
1050856632 9:10365350-10365372 ACTTGGGAAGAGAAATAGTTGGG - Intronic
1051984342 9:23064422-23064444 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1051990479 9:23146297-23146319 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1052065058 9:24008240-24008262 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1053793361 9:41702769-41702791 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1054181768 9:61914784-61914806 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1054471588 9:65543200-65543222 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1055222573 9:73954623-73954645 ACCTAGGAAAAGACTTAGATAGG + Intergenic
1055714966 9:79107882-79107904 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1055843389 9:80532283-80532305 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1056092113 9:83215731-83215753 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1057255540 9:93544182-93544204 CCTTGGGAGCTGTCTTAGGTTGG + Intronic
1057365140 9:94413150-94413172 TCTTGGGAACTGACTTAGATTGG + Intronic
1057658184 9:96974940-96974962 TCTTGGGAACTGACTTAGATTGG - Intronic
1058007936 9:99939629-99939651 GATTGGGAAAAGACTGAGGTAGG - Intronic
1058868030 9:109179631-109179653 ACTTGGAAAAAGACTTGGTTGGG - Intronic
1059029371 9:110674718-110674740 ACTTGGGAAGAAGCTGAGGTGGG - Intronic
1062397191 9:136357246-136357268 ACTTGGGAACAGGCTGGGGGTGG + Intronic
1203774634 EBV:65898-65920 ACCTGGGCACAGCCTGAGGTGGG - Intergenic
1187851070 X:23592253-23592275 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1188961982 X:36503140-36503162 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1189088153 X:38048381-38048403 ACTGGGGAACAGGCAGAGGTCGG - Intronic
1189553193 X:42114369-42114391 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1190791306 X:53703028-53703050 ACTTGGGGAGAGGCTGAGGTGGG + Intergenic
1194264437 X:91737795-91737817 ACTGGGTAACAGTCATAGGTTGG + Intergenic
1194905856 X:99575699-99575721 ACTGGGTAACAGACATAGGTTGG + Intergenic
1195815371 X:108879103-108879125 ACTGGGTAACAGGCTGAGGTTGG - Intergenic
1196576234 X:117322384-117322406 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1197004438 X:121479850-121479872 ACTTGGTAACAGGCAGAGGTTGG + Intergenic
1197160677 X:123318755-123318777 ACTGGGTAACAGACAGAGGTTGG - Intronic
1197560626 X:128015809-128015831 ACTGGGTAACAGACAGAGGTTGG - Intergenic
1198991120 X:142515747-142515769 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
1199070503 X:143469861-143469883 ACTTGGTAACAGGCAGAGGTTGG - Intergenic
1199072851 X:143498747-143498769 ACTTTGGAACAGGCAGAGGTTGG - Intergenic
1199289406 X:146089529-146089551 ACTGGGTAACAGACAGAGGTTGG + Intergenic
1201256034 Y:12109093-12109115 ACTTGAGATCAGACTGAGGCTGG + Intergenic
1201932576 Y:19368808-19368830 ACCTGGGAACATACTTAGCCAGG - Intergenic