ID: 1007037208

View in Genome Browser
Species Human (GRCh38)
Location 6:38687072-38687094
Sequence CCTACCACCTACAACTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007037206_1007037208 25 Left 1007037206 6:38687024-38687046 CCAACATTAATTGTGCTTTCTGT 0: 1
1: 0
2: 2
3: 20
4: 294
Right 1007037208 6:38687072-38687094 CCTACCACCTACAACTTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007037208 Original CRISPR CCTACCACCTACAACTTGCA AGG Intronic
901969075 1:12893184-12893206 CTCACCACCTTCAACTTTCATGG - Exonic
902016096 1:13308597-13308619 CTCACCACCTTCAACTTTCATGG + Intronic
907111068 1:51926771-51926793 CCTGCCATCTACTACTTACATGG + Intronic
907842304 1:58169835-58169857 CCTTCCCCCTACAGCTTGAAGGG - Intronic
909381739 1:75006329-75006351 CCAACCACCTACAAATTGGGAGG - Intergenic
911548662 1:99252952-99252974 GCTGCCACCCACAACTTGCATGG - Intergenic
916802121 1:168225727-168225749 CCGAGCACCTACCACGTGCAAGG - Intergenic
924898193 1:248365482-248365504 CCTCCCACCTCCAACTTTGAGGG + Intergenic
1065302511 10:24335853-24335875 CCTCCCACCTGGAACTTCCAAGG + Intronic
1067462500 10:46468119-46468141 CCTACCATCTACAAGTTGGCTGG - Intergenic
1067624695 10:47916518-47916540 CCTACCATCTACAAGTTGGCTGG + Intergenic
1069540876 10:69292955-69292977 CTTTCCACCTACCACTAGCAGGG - Intronic
1070175790 10:73968138-73968160 CCCACCACCTTCCACTTGAAGGG + Intergenic
1074630056 10:115243531-115243553 TCTACCGCCTACTACCTGCATGG - Intronic
1075789404 10:125072731-125072753 ACTACCACCTACCACTGGCATGG + Intronic
1075947931 10:126454190-126454212 TCTGCCCCCTACTACTTGCAGGG + Intronic
1075947972 10:126454384-126454406 TATACCCTCTACAACTTGCAGGG + Intronic
1076125816 10:127972797-127972819 CCTCCCACCTGCCACCTGCATGG - Intronic
1079811686 11:25005117-25005139 CCCACCCCCTACAGCTTGAAGGG + Intronic
1082232522 11:49785320-49785342 CCTACCACTTATGACTTCCAGGG - Intergenic
1084210977 11:67622218-67622240 CCCTCCCCCTACAACTTGAAGGG - Intergenic
1086317362 11:85608681-85608703 CCCACCCCCTACAGCTTGAAGGG - Intronic
1091468933 12:709827-709849 CCTCCCACCTCCAACCTCCAGGG - Intergenic
1091907673 12:4201880-4201902 CCCCCCACCGACAACCTGCAAGG + Intergenic
1092028631 12:5264497-5264519 CCCACCACACACAACATGCAAGG + Intergenic
1093916258 12:24805554-24805576 CCTACCTCCTTCAGCTTGCCTGG - Intergenic
1095638900 12:44464463-44464485 CCCTCCACCTGCAAGTTGCAGGG + Intergenic
1098384883 12:69908171-69908193 CTGAGCACCTACAACATGCAAGG + Intronic
1099414764 12:82372273-82372295 CCTTCCCCCTACAGCTTGAAGGG + Intronic
1100687536 12:97003314-97003336 CCTCCCATCTGCAACTTGCCAGG - Intergenic
1101153929 12:101909530-101909552 CTTGCCACCTACGACGTGCAGGG - Intronic
1106765504 13:32909394-32909416 CCTAGCCTCTAGAACTTGCATGG + Intergenic
1108057331 13:46497872-46497894 TCTACAACCTACCACTTCCAAGG + Intergenic
1109564280 13:64091022-64091044 CCTACCATCTACCAGTTGTACGG + Intergenic
1112911961 13:104496523-104496545 TCTACCACCAACAACATGCCAGG - Intergenic
1113399396 13:109977160-109977182 CCCACCTCCAGCAACTTGCAGGG + Intergenic
1117965097 14:61198958-61198980 CCTACCCCCTTAAGCTTGCAAGG + Intronic
1125770727 15:42163987-42164009 ACAACCACCTACAACATGCTAGG + Intronic
1127327237 15:57907453-57907475 CCTCCCACACACAAATTGCATGG + Intergenic
1129634447 15:77300119-77300141 CCTAGCACCTACACCTTCCTGGG + Intronic
1129903085 15:79166589-79166611 ACTACCACCTACAATTTCCTGGG + Intergenic
1130154161 15:81335154-81335176 ACTCCCAGCTCCAACTTGCAGGG - Intronic
1131728415 15:95252388-95252410 CCTAACACCTACTAATTGCAGGG - Intergenic
1132142822 15:99409190-99409212 CCTAGCACCTAATACTGGCAAGG + Intergenic
1133711849 16:8409190-8409212 CCTACCACCTTCAAATGGCCGGG - Intergenic
1135398183 16:22147129-22147151 CCTCCCACCTCAACCTTGCAAGG + Intronic
1135529545 16:23240799-23240821 CCTTCTACCTCCAACTTGAATGG - Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1140910871 16:79451150-79451172 CCCACCACCTTCAGTTTGCAGGG + Intergenic
1145836673 17:27959490-27959512 TCATCCACCTACAACATGCATGG + Intergenic
1146299726 17:31678569-31678591 CCTAACACCTTCAGCTGGCAGGG + Intergenic
1148318693 17:46729222-46729244 CCTACTACCTCCAACTGCCAAGG + Intronic
1149206319 17:54252802-54252824 CCTGCCACCTGCACCTTCCATGG - Intergenic
1151254298 17:72863703-72863725 CCTACCACCTGCCTCTGGCATGG - Intronic
1152389373 17:79993588-79993610 CCCACTACCTGCAACTTTCAGGG + Intronic
1154249964 18:12736221-12736243 CCTAACACCATCAACTTGGAAGG + Intergenic
1158826871 18:61231332-61231354 CCTACCACCAGCACCTAGCATGG + Intergenic
1161922327 19:7275811-7275833 CTTACCAGCCACAACTTCCAGGG + Intronic
1164732998 19:30520032-30520054 CCCACCACCTGCATCTTGCCTGG - Intronic
1165838577 19:38773594-38773616 CCCACCACCCACACCTGGCACGG + Intergenic
1165840982 19:38789103-38789125 CCCACCACCCACACCTGGCACGG - Intergenic
1167037331 19:47002076-47002098 CCCAGCACCTCAAACTTGCATGG + Exonic
929663396 2:43812907-43812929 CCTTGCTCTTACAACTTGCAGGG - Exonic
933308434 2:80630878-80630900 GCTTCTACCTACAACTTGCTTGG - Intronic
934104559 2:88683602-88683624 CAGACCACCTACAACATGCTTGG - Intergenic
936455777 2:112672966-112672988 TCTACTACTTACAAGTTGCATGG + Intergenic
938390688 2:130902655-130902677 GCTACCAACTACAACATGCTTGG - Intronic
939020059 2:136947882-136947904 CCTGCCAGGTCCAACTTGCAGGG + Intronic
944896332 2:204169516-204169538 CCTGCCACTTACAAATTACATGG - Intergenic
945895412 2:215475828-215475850 CCTGCCACCTGTAACTGGCAAGG - Intergenic
946507332 2:220315690-220315712 CCTACCAGCTCCTACTTTCATGG - Intergenic
1171261472 20:23738102-23738124 CCTTCCCCCTACAGCTTGAAGGG - Intergenic
1172332730 20:34086909-34086931 CGTATCACCTACAACTTTCTAGG + Intronic
1175904243 20:62371881-62371903 CTAACCACCTACAACTTGGCAGG + Intergenic
1178045475 21:28689257-28689279 CTTAACATCTACAATTTGCATGG - Intergenic
954713125 3:52514646-52514668 CCTACCACCCTCACCTGGCAGGG - Intronic
954971828 3:54657677-54657699 CCTACCATTTACAACATGGATGG - Intronic
955150365 3:56361023-56361045 CTTACCACCTTCAACATGCGAGG - Intronic
958435917 3:94095549-94095571 ACAACCAGCTACAACTTGCTAGG - Intronic
960713776 3:120556442-120556464 CCTCCCACCGACAACATGCCAGG - Intergenic
962200391 3:133396551-133396573 CCTGCCATCCACAACTTGGATGG - Exonic
963677648 3:148333206-148333228 CCTACCACCTACTACTGCCTGGG - Intergenic
963936324 3:151057553-151057575 TCTACCACCTTATACTTGCATGG + Intergenic
966551797 3:181213598-181213620 CCTACCACCTGGGACTTGCAGGG + Intergenic
967087455 3:186108387-186108409 TCCACCACCTGAAACTTGCAAGG + Intronic
968468285 4:764193-764215 CCTGCCACCAACACCCTGCATGG - Intronic
968562458 4:1291411-1291433 CCAACCACCTACATCTTGGAGGG - Intronic
970165441 4:13232226-13232248 CCTTCCTCTTACGACTTGCATGG - Intergenic
971092291 4:23360291-23360313 ACTACCAGCTGCAACTTGGAAGG - Intergenic
971578426 4:28305197-28305219 CCTTCCCCCTACAGCTTGAAGGG - Intergenic
972224151 4:36992715-36992737 CTTCACTCCTACAACTTGCAAGG + Intergenic
974008410 4:56584208-56584230 CCTCCCACCTCCACCTTTCAAGG + Intronic
974537088 4:63186814-63186836 CCCTCCCCCTACAACTTGAAGGG - Intergenic
975174259 4:71269585-71269607 CCTAACACCAACTACTTGCTAGG - Intronic
975805161 4:78104678-78104700 CATACCACCAACACCTGGCATGG - Intronic
976054485 4:81047383-81047405 ACCCCCACCTCCAACTTGCACGG + Intronic
977805108 4:101288372-101288394 CCTACCCCCCAAAAATTGCAAGG + Intronic
978615179 4:110587270-110587292 CCTACCACCAACCACTTCCCTGG + Intergenic
979016058 4:115435233-115435255 GCTACTGCCTACAACTTGAAGGG + Intergenic
979485854 4:121269622-121269644 TCTACCACTTACTACTTGAATGG - Intergenic
979757017 4:124353313-124353335 TCTACCACTTACAATTTACACGG - Intergenic
980076736 4:128301870-128301892 CATACAACCTAAAACTTTCAAGG - Intergenic
985928514 5:3036107-3036129 CCTCCCACCTCCGCCTTGCAGGG - Intergenic
986023208 5:3824469-3824491 CCTATTACTGACAACTTGCATGG + Intergenic
987881204 5:23748927-23748949 CCCACCTCCTACCATTTGCATGG + Intergenic
988357756 5:30199812-30199834 CCTTCTCCCTACAACTTGAAGGG - Intergenic
988592066 5:32557676-32557698 CCCTCCCCCTACAGCTTGCAAGG + Intronic
992545721 5:77812199-77812221 CCCTCCACCTACAGCTTGAAGGG - Intronic
998267356 5:140676177-140676199 CCTACCACTTACAAGTTTCATGG + Intronic
998479019 5:142445695-142445717 CCTACCACCTTCCACTTACTGGG + Intergenic
998714897 5:144872083-144872105 CCTAGCACCTACAACGTGTCTGG - Intergenic
1002922044 6:1579836-1579858 CCTCCCCCCTACTCCTTGCAAGG + Intergenic
1006365641 6:33613553-33613575 CTAACCACCTACCACATGCAAGG - Intergenic
1007037208 6:38687072-38687094 CCTACCACCTACAACTTGCAAGG + Intronic
1012295685 6:97519660-97519682 CCCACCACCAACAGCATGCATGG - Intergenic
1013893624 6:115057392-115057414 CCAAACACCCACAACCTGCAGGG + Intergenic
1017087445 6:150727279-150727301 CCTACAACCTACAACTCCCAAGG - Intronic
1021571162 7:22066650-22066672 CCAACCACCTACAGCATGCGTGG - Intergenic
1021756785 7:23859890-23859912 CCCTCCTCCTACAACTTGAAGGG + Intergenic
1026277704 7:68894652-68894674 CCTAACACCATCACCTTGCAGGG - Intergenic
1028164243 7:87519843-87519865 CCCAACACCTACAAGGTGCAGGG + Intronic
1032802801 7:135330019-135330041 CCTCCAACCAACTACTTGCAGGG - Intergenic
1033274071 7:139957884-139957906 CCCACCACTTACAGCTTCCAGGG + Intronic
1033661882 7:143408347-143408369 CTTCCCACCTTCAACTTCCAAGG + Intronic
1036033131 8:4993687-4993709 CCAACACCTTACAACTTGCAAGG + Intronic
1036702549 8:11022715-11022737 TCTACCACTTACTAATTGCAGGG - Intronic
1037242192 8:16790162-16790184 CCTCCCACCTCCACCTTCCAAGG - Intergenic
1040965123 8:53074904-53074926 CCTTCCCCCTACAGCTTGAAGGG + Intergenic
1044366059 8:91347098-91347120 CCTAACACCTACCACATGCCAGG - Intronic
1046166929 8:110449225-110449247 GGTACCTCCTACAACTTGAAAGG + Intergenic
1046320335 8:112566345-112566367 TCTACCACCTACCAGATGCAAGG - Intronic
1046576162 8:116032244-116032266 TCCACCACCTAAAACATGCAAGG + Intergenic
1047664659 8:127077647-127077669 CATAACACATACAACTTGAAGGG + Intergenic
1047787538 8:128168372-128168394 CCTGCCATCTACATCTTGAAGGG - Intergenic
1047996430 8:130341180-130341202 CCTACCACCCACAGCTTGCCTGG + Intronic
1048298072 8:133229954-133229976 CCTGCCATCTACAAATTACAAGG + Exonic
1055234207 9:74100130-74100152 TCTTCCACCTACACCTTACAAGG - Intergenic
1189972722 X:46434428-46434450 CCTATCCCCTACATCTTACATGG - Intergenic
1195112714 X:101663950-101663972 CCCACCACCTCCACCATGCAGGG - Intergenic
1195552456 X:106184827-106184849 CCTTCCCCCTACAGCTTGAAGGG + Intronic
1197109120 X:122751535-122751557 CCTACAACCTACAATTTATAAGG - Intergenic
1201487510 Y:14508509-14508531 CCTTCCCCCTACAGCTTGAAGGG - Intergenic