ID: 1007040054

View in Genome Browser
Species Human (GRCh38)
Location 6:38713729-38713751
Sequence CTTTTGGCACTGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007040054_1007040058 -3 Left 1007040054 6:38713729-38713751 CCCAGCTCCATCAGTGCCAAAAG No data
Right 1007040058 6:38713749-38713771 AAGTAAACAATGAGATTCGATGG No data
1007040054_1007040059 5 Left 1007040054 6:38713729-38713751 CCCAGCTCCATCAGTGCCAAAAG No data
Right 1007040059 6:38713757-38713779 AATGAGATTCGATGGACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007040054 Original CRISPR CTTTTGGCACTGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr