ID: 1007040120

View in Genome Browser
Species Human (GRCh38)
Location 6:38714152-38714174
Sequence CTGAGTAATGTCTATTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007040117_1007040120 9 Left 1007040117 6:38714120-38714142 CCTTGCTCCCATAAGCTTATATT 0: 1
1: 0
2: 2
3: 33
4: 201
Right 1007040120 6:38714152-38714174 CTGAGTAATGTCTATTAATATGG 0: 1
1: 0
2: 1
3: 12
4: 163
1007040119_1007040120 1 Left 1007040119 6:38714128-38714150 CCATAAGCTTATATTGTATAATC 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1007040120 6:38714152-38714174 CTGAGTAATGTCTATTAATATGG 0: 1
1: 0
2: 1
3: 12
4: 163
1007040116_1007040120 10 Left 1007040116 6:38714119-38714141 CCCTTGCTCCCATAAGCTTATAT 0: 1
1: 0
2: 0
3: 17
4: 127
Right 1007040120 6:38714152-38714174 CTGAGTAATGTCTATTAATATGG 0: 1
1: 0
2: 1
3: 12
4: 163
1007040118_1007040120 2 Left 1007040118 6:38714127-38714149 CCCATAAGCTTATATTGTATAAT 0: 1
1: 0
2: 2
3: 20
4: 285
Right 1007040120 6:38714152-38714174 CTGAGTAATGTCTATTAATATGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007040120 Original CRISPR CTGAGTAATGTCTATTAATA TGG Intergenic
901807139 1:11745667-11745689 CTCAGTAATGTCTGTTGAAAAGG - Intronic
904223053 1:28989210-28989232 CTGTGTAATGTATATTAGTCTGG + Intronic
906643341 1:47455113-47455135 CTGAGTAACCTCTCTTCATAGGG - Intergenic
906830173 1:49022759-49022781 CTGAGAAATAGGTATTAATAAGG + Intronic
908867516 1:68567696-68567718 TTTAATAATGTCTTTTAATAAGG - Intergenic
908976411 1:69904091-69904113 GTGAATAGTGTCTATAAATATGG - Intronic
909137169 1:71816374-71816396 CTGAGTAATTTATTTTAAAAAGG + Intronic
911422355 1:97659864-97659886 ATGAGTATTGTATATTCATATGG + Intronic
916127505 1:161584363-161584385 CTGAGTAGTGTCTATAAAGGGGG + Intronic
916137423 1:161666167-161666189 CTGAGTAGTGTCTATAAAGGGGG + Intronic
918654024 1:187001902-187001924 CAGAGTAATTTCTATTAGTAAGG - Intergenic
921968882 1:221122905-221122927 CTGTGTTATGTCTATTATTGAGG + Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1063195691 10:3740663-3740685 CAGAGTAATGTCTATTACATAGG + Intergenic
1063227580 10:4030643-4030665 CTGATTAAATTCTAGTAATAGGG + Intergenic
1064748905 10:18505609-18505631 CTGCCTAATGTTTATTATTATGG - Intronic
1064962646 10:20982799-20982821 TTTAGTAATGTCTATTAAAAGGG + Intronic
1067911682 10:50352445-50352467 CTGAAAAATGTCTAGTAATTTGG - Intronic
1067927225 10:50522082-50522104 CTGAGTAATGAATGGTAATATGG - Intronic
1071140759 10:82506843-82506865 CTGAATGATGTCTATTCCTAAGG + Intronic
1073857011 10:107688163-107688185 CTGAATAATCTGTATTTATATGG + Intergenic
1079532843 11:21476220-21476242 CTGATTTATTCCTATTAATATGG + Intronic
1080186684 11:29496046-29496068 CTGAGTAGCTTCCATTAATAAGG - Intergenic
1081167938 11:39829236-39829258 CTGTTTAGTGTCTATTAATTTGG + Intergenic
1082089058 11:48074434-48074456 CTAAATACTGTCTATTAATTTGG - Intronic
1086855320 11:91859035-91859057 TGGAGTAATGAATATTAATAAGG + Intergenic
1087363035 11:97184774-97184796 CTGATTAAGGACTATTAATCAGG + Intergenic
1088715832 11:112548684-112548706 CTGAGAATTGACTTTTAATAGGG - Intergenic
1088780579 11:113130440-113130462 CAAAGTGATGTATATTAATAGGG + Intronic
1091588762 12:1830730-1830752 CTGTGTGATGTCCATTAATATGG + Intronic
1093596304 12:20964321-20964343 GTGATTTATGTCTATAAATAGGG + Intergenic
1096834888 12:54343564-54343586 CTGAGTAGTGTTTTTTAAGATGG + Intronic
1099855576 12:88161330-88161352 CTGAGTAAAGACTATTACTAGGG - Intronic
1110118554 13:71851197-71851219 TTGATTAATCTCTATTAAGAAGG - Intronic
1110519883 13:76463217-76463239 TTAATTAATGTCTATTAATAAGG + Intergenic
1111304536 13:86389817-86389839 CTGATTTATGTGTATTACTATGG - Intergenic
1112988039 13:105476657-105476679 CTGATGAATGGCTATAAATAGGG + Intronic
1113657366 13:112075724-112075746 CAGAGAAATCACTATTAATATGG - Intergenic
1116453483 14:45090773-45090795 CTCACTAATGTCTATTAACCAGG - Intronic
1117090100 14:52241038-52241060 ATCAGTAATGTGTATTACTATGG + Intergenic
1118499007 14:66339077-66339099 GTGAGTAATGTATTCTAATATGG - Intergenic
1119054959 14:71409700-71409722 GTGAGTAATTTCTATAAACAAGG - Intronic
1126122724 15:45268049-45268071 CAGAGTAATTTCCACTAATAGGG + Intronic
1133583532 16:7169488-7169510 CTGAGAAATGTCTATAGACATGG + Intronic
1135701492 16:24636829-24636851 TTCAGAAATATCTATTAATAGGG - Intergenic
1150339133 17:64351909-64351931 CTAAGAAATATCTATTCATAAGG - Intronic
1157966770 18:52217337-52217359 GTGTGTTAAGTCTATTAATATGG - Intergenic
1158801764 18:60919613-60919635 ATTACTAATCTCTATTAATATGG - Intergenic
1159223371 18:65495921-65495943 CTGAGTAAACTCTATTAATTTGG + Intergenic
1163308047 19:16494753-16494775 TTGACTAGTGTCTATTAAGAGGG + Intronic
926039056 2:9658166-9658188 ATGAGAAATGTCTATAAACAAGG - Intergenic
929495525 2:42439006-42439028 CTGAGAAATGTCAAGTAACATGG - Intergenic
930520794 2:52464565-52464587 CATAGTAATGACTATTAATGAGG + Intergenic
931589406 2:63865428-63865450 CTGAGTAATAGCTATGAATGTGG + Intronic
931658829 2:64537098-64537120 CTGAAAACAGTCTATTAATAAGG - Intronic
933679312 2:85085107-85085129 CTGAGAAATGTCTAGTACTGAGG + Intergenic
937530364 2:122820236-122820258 CTGAGTAATGTGACTTAATGAGG + Intergenic
938283894 2:130091245-130091267 ATGAGGAATGGCTATTGATAGGG - Intronic
938334539 2:130479809-130479831 ATGAGGAATGGCTATTGATAGGG - Intronic
938355287 2:130640861-130640883 ATGAGGAATGGCTATTGATAGGG + Intronic
938431713 2:131247648-131247670 ATGAGGAATGGCTATTGATAGGG + Intronic
938475384 2:131606252-131606274 ATGAGGAATGGCTATTGATAGGG + Intergenic
939171880 2:138705493-138705515 CTGAGTAAAATCTACTAAGAGGG - Intronic
939385447 2:141490732-141490754 CTGAGTTCCTTCTATTAATATGG - Intronic
939397233 2:141646655-141646677 CTGTGTAATTACTATTTATACGG - Intronic
940707307 2:157121538-157121560 CTGAGTAATATTTTATAATATGG - Intergenic
940841421 2:158586221-158586243 CTGAGTATTGTATTTTAAGAGGG + Intronic
941338363 2:164273257-164273279 CTGATTTATGGCAATTAATATGG + Intergenic
941739020 2:169013116-169013138 CAGAGTAATTTCTAGAAATATGG + Intronic
942023600 2:171891571-171891593 CTGAGTACTGCCTAGGAATACGG - Intronic
943164165 2:184296237-184296259 CTGAGTAATCTCTCCAAATAAGG - Intergenic
943931579 2:193860732-193860754 GTGATTTATGTCTATTTATAAGG - Intergenic
946556569 2:220865083-220865105 CTGAGTGCTGGCTACTAATATGG + Intergenic
947279612 2:228435885-228435907 ATTAGTAATGTCTATTCATGTGG - Intergenic
1169703008 20:8469911-8469933 ATGAGGAATGACTATTAATGGGG - Intronic
1174615561 20:51832730-51832752 CTGAGGAATGTTTAATAAAAGGG - Intergenic
1177412458 21:20747890-20747912 CTTAGCAATGGTTATTAATATGG + Intergenic
1179102529 21:38366800-38366822 CTAAGTAATGTATATTTATTGGG + Intergenic
1179153094 21:38826028-38826050 CTTAGGAAAGTTTATTAATATGG - Intergenic
1182292247 22:29289351-29289373 CAGAGTAATGTATATAATTATGG + Intronic
1183193800 22:36339180-36339202 CTGAGTAATGTGTACTGATGAGG - Intronic
1184506244 22:44905423-44905445 AGGAGTAATGTCTAGAAATAAGG - Intronic
949753445 3:7380917-7380939 CTGAAAAATTTCTATTAAAATGG + Intronic
951603537 3:24404077-24404099 CTGAGTAAAGTCTTTAACTATGG - Intronic
954770529 3:52963756-52963778 CAGAGTATTGTATTTTAATATGG - Intronic
955590700 3:60531860-60531882 CTGACAAATATCTTTTAATACGG - Intronic
955739390 3:62074087-62074109 GTGAGTAATTTCTAAGAATAAGG - Intronic
956188045 3:66581077-66581099 CTGAGTAGTGTCATGTAATAAGG + Intergenic
957990872 3:87626030-87626052 GGAAGTAATGTCCATTAATATGG - Intergenic
958716147 3:97783932-97783954 CTGAGTCATGTAAATTGATATGG + Intronic
958928502 3:100184758-100184780 CTGACTAATGTAAATTAAAAGGG + Intergenic
960854333 3:122087232-122087254 CAGAATAAGGTCTATGAATAAGG - Intronic
967412004 3:189175991-189176013 CTCAGTAATGTTTATTATGAAGG - Intronic
971393622 4:26208749-26208771 CAGAGCAATGTCTATTTACATGG - Intronic
971933574 4:33117883-33117905 CTGAGTAATGTATAAAAACAAGG - Intergenic
972966306 4:44514658-44514680 ATGACTAATGTCTTTTAAGAAGG - Intergenic
973176969 4:47218635-47218657 TTGAGAAATGTCTATTCAGATGG + Intronic
974500711 4:62697995-62698017 CTGTGTACTGTAAATTAATATGG + Intergenic
974680052 4:65148705-65148727 CTAAGTAAGGTATATTATTAAGG - Intergenic
976421610 4:84851290-84851312 CTGTGTAATGACTGTTAAAAGGG - Intronic
976901836 4:90187109-90187131 CAGAGTCATGTCTTTAAATAAGG - Intronic
976953204 4:90860191-90860213 GTGAGAAATGTCTATTCAAATGG - Intronic
979088608 4:116449105-116449127 CTGAGGAATCTATATTAATAAGG - Intergenic
980323892 4:131315395-131315417 CTGACTATTGTGGATTAATATGG + Intergenic
983472896 4:168178137-168178159 CTTAGTAATGTCATTAAATAAGG - Intronic
985308375 4:188570032-188570054 CTGACTGATGCCTATTAAAATGG - Intergenic
985711147 5:1430653-1430675 CTCAGTGATGTCTGTTGATACGG + Intronic
988620639 5:32819824-32819846 CTGAGCAATGTCTATTATTAGGG + Intergenic
989715455 5:44457464-44457486 GTGTGTAATGTCTATTAAAAAGG - Intergenic
990087650 5:51998597-51998619 TTGACAAATCTCTATTAATAGGG + Intergenic
990886956 5:60605619-60605641 CTGAGTAAGGTGTATTAGTTTGG - Intronic
991056530 5:62326647-62326669 CTGAGTCATTTCCATCAATATGG + Intronic
993752075 5:91682686-91682708 GTGAGTAAATTCTCTTAATAGGG - Intergenic
993853842 5:93046191-93046213 CTGAGTATTATCTATCCATAAGG + Intergenic
994489279 5:100420644-100420666 GTGTGTAATATCTATTAAAAAGG + Intergenic
994536789 5:101040989-101041011 CTTAATAATGATTATTAATAAGG - Intergenic
995056992 5:107770552-107770574 CTCAGTTATTTCTATGAATATGG + Intergenic
995097606 5:108257544-108257566 CTGAATAATTTCTATTTATCAGG + Intronic
996848959 5:127931734-127931756 CTGGGAAATCTCTGTTAATATGG - Intergenic
997414546 5:133715020-133715042 CTGAGTAATGTCTATGCCGAAGG - Intergenic
998562582 5:143185119-143185141 CTGATAACTGTTTATTAATATGG + Intronic
998673132 5:144376329-144376351 CTGAATAATGTGTAATAATATGG + Intronic
1003734520 6:8863635-8863657 CTGACTAATGTCTATTACATAGG - Intergenic
1007040120 6:38714152-38714174 CTGAGTAATGTCTATTAATATGG + Intergenic
1007194176 6:40046067-40046089 CTGAGGGATGTCTATTCAAATGG + Intergenic
1008500591 6:52177513-52177535 CTGAGAAATGCCTATCAAAAGGG + Intergenic
1008886470 6:56436427-56436449 CTTATAAGTGTCTATTAATATGG + Intergenic
1009354507 6:62725280-62725302 CTGAGTAATATATTTGAATAAGG - Intergenic
1011904597 6:92348645-92348667 CAAAGAAATGTCTATTAAGAGGG + Intergenic
1014627170 6:123740800-123740822 CTGAATAATGTCTTATTATATGG + Intergenic
1014666544 6:124244578-124244600 TTGAGTAATGTCTATTATTTAGG - Intronic
1016239183 6:141908514-141908536 TTGAGGACTGTCTATTAATGGGG - Intergenic
1016695872 6:146994810-146994832 CGGTTTAATGTCTTTTAATAAGG + Intergenic
1017398831 6:154035575-154035597 ATGATTAATGGCTATTAATGAGG - Intronic
1018789851 6:167139773-167139795 GTCAGAATTGTCTATTAATAGGG + Intergenic
1018958042 6:168425802-168425824 CTGAATAATGTCTATCTCTAAGG - Intergenic
1020192900 7:6014057-6014079 CTGAGTAATTTATACAAATAGGG - Intronic
1020894686 7:13925269-13925291 AGGAGTAATGTACATTAATAAGG - Intronic
1021220234 7:17967186-17967208 CTGAGTAATGTCAATAAAAGTGG - Intergenic
1024693480 7:51828983-51829005 CTTAGTAATATCTGTTAATTAGG + Intergenic
1026072069 7:67130730-67130752 CTGAATAATATTTTTTAATATGG + Intronic
1027703189 7:81494748-81494770 GTGCATAATGTATATTAATATGG + Intergenic
1028002589 7:85518786-85518808 CTGAGTAATTTATATTACAAGGG + Intergenic
1028719189 7:94010248-94010270 CTAAAAAATCTCTATTAATAGGG + Intergenic
1030203790 7:106932180-106932202 CGAAGTAATGTCTTTTAATTGGG + Intergenic
1030567760 7:111181394-111181416 GTAAGTAATGTCCATGAATAGGG + Intronic
1031049900 7:116934537-116934559 CAGATTAATTTCTATTCATATGG - Intergenic
1031603759 7:123745681-123745703 CTGAGTAATATCTAGGAATTGGG + Intronic
1031616854 7:123891710-123891732 CTGATTTATGTCTATCAATTTGG - Intergenic
1031954547 7:127929062-127929084 TTCAGAAATGTCTATAAATAGGG + Intronic
1035734840 8:1880726-1880748 CTGAGCGATGTCTTTTAAAAGGG + Intronic
1037069349 8:14624424-14624446 CTGAATAAAGATTATTAATAGGG + Intronic
1037771823 8:21805736-21805758 GAGAGAAATGGCTATTAATAAGG - Intronic
1042983004 8:74551615-74551637 TTGAGTACTGTCTATGATTAAGG + Intergenic
1043313329 8:78889377-78889399 CAGTATAATGTCCATTAATAAGG - Intergenic
1044204454 8:89476148-89476170 CTGAGTAATTTGTTTAAATATGG - Intergenic
1046489988 8:114939213-114939235 CTGAGGAATATTTTTTAATATGG + Intergenic
1046530155 8:115435287-115435309 CAGAGTAATGTTGATGAATAAGG + Intronic
1046605142 8:116363345-116363367 CTGAGTAATGTCTACCAATGGGG - Intergenic
1049600783 8:143506498-143506520 CTTAGCAATGTGAATTAATATGG + Intronic
1050241771 9:3643839-3643861 CTTAATAATGTCTATAAATTGGG - Intergenic
1051503111 9:17799731-17799753 CTGAGTAATTTCCATACATAAGG - Intergenic
1051898359 9:22011888-22011910 CAGAGCCATGTCTTTTAATAAGG + Intronic
1053554740 9:39123920-39123942 CTGAGGAACTTCTATTAACATGG - Intronic
1053818858 9:41944178-41944200 CTGAGGAACTTCTATTAACATGG - Intronic
1054109126 9:61087830-61087852 CTGAGGAACTTCTATTAACATGG - Intergenic
1054611731 9:67243295-67243317 CTGAGGAACTTCTATTAACATGG + Intergenic
1058637630 9:107051716-107051738 CTGATAAATGTCTATTAATTTGG - Intergenic
1185873117 X:3680910-3680932 CTGGCTAATTTCTTTTAATAGGG - Intronic
1189143201 X:38628104-38628126 CTGAGCAATGTCCAGAAATAGGG + Intronic
1194717517 X:97304192-97304214 CTGAGTATTGTTAATTAGTAAGG + Intronic
1195527913 X:105914347-105914369 TTGAGTAAAGTCATTTAATAAGG - Intronic
1195612144 X:106879890-106879912 CTGAGAAATGTCTATTCAGGTGG - Intronic
1196098148 X:111821606-111821628 CTGAGTTATTAATATTAATAAGG - Intronic
1197321424 X:125036082-125036104 TTGTGAAATGTCAATTAATAAGG - Intergenic
1198948813 X:142045674-142045696 CTGAGTAATAGATATTATTAGGG + Intergenic
1199395936 X:147337844-147337866 CTGGATAATGAATATTAATAGGG + Intergenic