ID: 1007041506

View in Genome Browser
Species Human (GRCh38)
Location 6:38726621-38726643
Sequence GTGAGCAAAGCCATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007041502_1007041506 -4 Left 1007041502 6:38726602-38726624 CCTTAAGAGTTGCTTGTGAGTGA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007041506 Original CRISPR GTGAGCAAAGCCATGGTGGA GGG Intronic
901221759 1:7587348-7587370 GTGAGCAAAGCCCTTTAGGAAGG - Intronic
902449634 1:16488697-16488719 ATGAGCAAAGGCATGGAGGTGGG - Intergenic
902504848 1:16932645-16932667 ATGAGCAAAGGCATGGAGGTGGG + Intronic
903300236 1:22373652-22373674 GTGAGCAAAGCTAGGGGTGAAGG + Intergenic
903315051 1:22496817-22496839 GTGGCCAAAGCCATGGTAGGTGG + Intronic
903994880 1:27299530-27299552 GTGAACAAAGGCATGGGGGTGGG + Intronic
904778074 1:32924136-32924158 ATGAGCGGAGCCATGGAGGAGGG + Intergenic
904962791 1:34347842-34347864 GTGGGCAAGGCCATGGGGGGGGG + Intergenic
905533283 1:38699297-38699319 GTGAGCAAAGCCAGGGAAGTAGG - Intergenic
906642526 1:47450006-47450028 GTGAGCGAAGCCAGGGTGGAGGG + Intergenic
906856283 1:49308727-49308749 ATGAGAAAAGGCAGGGTGGAAGG + Intronic
907008888 1:50944226-50944248 ATGATCAGAGCCATGGGGGATGG + Intronic
908077200 1:60533409-60533431 GTGAACAAAGCCATGGTCACTGG + Intergenic
908155913 1:61352945-61352967 ATGAGCAAAGGCTTGGAGGAAGG + Intronic
911083634 1:93957928-93957950 GAGAGCAAAGTCATGGAGGCTGG - Intergenic
912234161 1:107830653-107830675 ATGAGCAAAGATATGTTGGAAGG - Intronic
912896404 1:113595785-113595807 GTAATCACAGCCAAGGTGGATGG + Intronic
915631548 1:157156577-157156599 GTGAGCACAGGCAAGGCGGAAGG - Intergenic
917577361 1:176338044-176338066 GTGAGCACAGCCATAGAGGTTGG + Intergenic
917969478 1:180197644-180197666 GTGAGGCAAGCCATGGTTGCTGG + Exonic
918110854 1:181454215-181454237 GTCAGGAAAGCCATGCTGTATGG + Intronic
920558319 1:206920514-206920536 ATGGGCAAAGACATGGTGGCAGG + Intronic
920686871 1:208116090-208116112 ATGAGCAAAGGCATGGAGGCAGG - Intronic
921216963 1:212946081-212946103 TTGAGCAAGGACATGGTGGCTGG - Intergenic
922743561 1:228030464-228030486 GTCAGCATATGCATGGTGGAAGG - Intronic
924155837 1:241175650-241175672 GTGTGCAGAGCCATGGTGGAGGG + Intronic
924832744 1:247614955-247614977 GTGCCCAAGGCCATGGTGGACGG + Intergenic
1063988867 10:11537743-11537765 GTGAGCACTGCCGGGGTGGAAGG + Intronic
1066681036 10:37937293-37937315 GTGAGCGGAGCCATGGAGGAGGG - Intergenic
1067777588 10:49174692-49174714 GTGTGCAAAGCAGTGGTGGGGGG + Intronic
1068136319 10:52953623-52953645 ATGAGCAGAGCCGTGGAGGAGGG + Intergenic
1068178778 10:53495264-53495286 CTGAGAAAAGCAATGGGGGAAGG - Intergenic
1069114322 10:64485893-64485915 GAGAGCAAACCCACTGTGGAAGG + Intergenic
1069597752 10:69683461-69683483 GTGAGCAAAGGCAAGGAAGAGGG + Intergenic
1071058366 10:81538541-81538563 GTGAGCAAAATGATGGAGGAAGG - Intergenic
1073376814 10:103042280-103042302 GTAAGCCAAGCCAGGGAGGATGG - Intronic
1073463406 10:103679521-103679543 GCGAGCCAAGTCATGGAGGAAGG + Intronic
1075398516 10:122144556-122144578 GAAAGCTAAGCCATGGTAGAGGG + Intronic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1077378989 11:2219421-2219443 CTCAGCAAAGCCATGGGGGCAGG - Intergenic
1078542134 11:12221259-12221281 GTGGGCAAAGGCATGGTGGTTGG - Intronic
1078724694 11:13919510-13919532 TTGAGAAAAGACAGGGTGGAGGG + Intergenic
1079130774 11:17745679-17745701 GGGAGGAAAGCCATGGAGGCTGG - Intronic
1080941777 11:36926731-36926753 CTGAGCTAGGCCAGGGTGGACGG + Intergenic
1082675681 11:56099140-56099162 GTGAGCAAAGACTTGAAGGAGGG - Intergenic
1082884437 11:58067970-58067992 GTGAGAAAGGACATGGTGCATGG - Intronic
1083495457 11:63048005-63048027 GTGGGCAAAGGCATGGAGGAGGG + Intergenic
1084113043 11:67025670-67025692 GTGAGCAAAGCCCTTGAGAAGGG + Intronic
1084241773 11:67826192-67826214 GTGAGAGAAGCCTTGCTGGACGG + Intergenic
1084943670 11:72627502-72627524 GTGAGCAAAGGCAGGGAGGCAGG + Intronic
1089468341 11:118700753-118700775 GTGAGCAAATAAATGGTGGTGGG + Intergenic
1089614153 11:119685769-119685791 GTGAGCAGAGCAAAGGTGGCAGG - Intronic
1089892968 11:121899705-121899727 GTAAGCCAAGCCACTGTGGAGGG - Intergenic
1090015914 11:123086484-123086506 GTGATCAAAGGCAGGGTTGAGGG - Intronic
1091173805 11:133541956-133541978 GTGAGCACAGACATGCAGGAGGG - Intergenic
1091384015 12:80817-80839 CTGAGCAAAGTCCTGGAGGAGGG + Intronic
1091778514 12:3199848-3199870 GTGTGCAAAGGCATGGAGGGGGG + Intronic
1096474641 12:51900848-51900870 GATAGCAAAGCCACTGTGGATGG + Intergenic
1097029929 12:56082807-56082829 GTGAGGATTGCCATGGTGAAAGG + Intronic
1098399135 12:70054612-70054634 GAGAGCAAGGGCATGGTGGTGGG - Intergenic
1098407250 12:70139673-70139695 GTAAGCCAAGCTGTGGTGGAGGG + Intergenic
1100381937 12:94070600-94070622 TTGAGCAAAGGCCTGGAGGAGGG + Intergenic
1100493726 12:95105277-95105299 GTGAGCAAAGTCCTGGAGGTGGG - Intronic
1100793589 12:98156867-98156889 GTGTGCAAAGACATGGAGGTAGG + Intergenic
1101071024 12:101076221-101076243 GAGAGCAAAGCCATCATGGTTGG + Intronic
1101336653 12:103802629-103802651 GTGAGCCAAGCCAGAGAGGAAGG + Intronic
1101502321 12:105315677-105315699 ATGAGCAAAGGTATGGTGGTGGG + Intronic
1101580296 12:106036791-106036813 GTCAGCAAAGCAATGTTGGAAGG + Intergenic
1101605561 12:106246052-106246074 TTGAGCAATGACATAGTGGAGGG + Intronic
1102492373 12:113297066-113297088 GTGAGCAGAGCCAGGGAGGGTGG - Exonic
1102783425 12:115584920-115584942 TTCAGCAAAGCCATGGGGGGAGG - Intergenic
1103257954 12:119559060-119559082 GTGAGCAAAGGCATGGAGGCAGG + Intergenic
1107873698 13:44770336-44770358 CTGAGCTAAGCCAAGTTGGATGG + Intergenic
1109527993 13:63601351-63601373 ATGAGTTAAGCCATTGTGGAAGG - Intergenic
1111405252 13:87795947-87795969 GAGCGCAAAGTCATGGTGGAAGG + Intergenic
1113550077 13:111185885-111185907 GTGGGCAAAGCCAGGCTGGTGGG + Intronic
1114424494 14:22610872-22610894 GTCAGCATAGACATGGTGGGAGG - Exonic
1118509177 14:66451421-66451443 GAGAGCAGAGCCAGGGAGGAAGG - Intergenic
1118910523 14:70058553-70058575 GTCAGCAATGCCCTCGTGGAGGG - Intronic
1119660788 14:76450306-76450328 GTGAGCAAAGGCAAAGTGGAAGG + Intronic
1119783259 14:77293195-77293217 TTGAGCAAATCCAGGCTGGATGG - Intronic
1120821443 14:88915230-88915252 GTGAGGAAAGCCTCCGTGGATGG - Intergenic
1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG + Intergenic
1121737854 14:96231129-96231151 GTGAGCAAAGCCAGGCCGGCAGG + Intronic
1121831166 14:97053539-97053561 GTGGGCAAAGCCATGGGGATAGG - Intergenic
1122407487 14:101509015-101509037 GTGACCCAGGCCAAGGTGGAGGG - Intergenic
1123006403 14:105325882-105325904 GTAAACAAAGGCATGGAGGAGGG - Intronic
1124461954 15:29900212-29900234 GTGAACACAGCCAGGGTGGCTGG + Intronic
1125609124 15:40958942-40958964 GTGAGGAGAGCCAGGGTGGAAGG + Intergenic
1127311302 15:57754323-57754345 GTGGACTAAGACATGGTGGAAGG + Intronic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1128733290 15:70035062-70035084 ATGAGGAAGGCCATGGAGGAGGG - Intergenic
1129925241 15:79358178-79358200 GTGAGCAGAGCCAGGCTGGGAGG + Intronic
1131321001 15:91391093-91391115 GGGAGGAAATCAATGGTGGATGG + Intergenic
1131605838 15:93901283-93901305 CTCAGCAAAGCCAGGGTGGGTGG - Intergenic
1131611543 15:93969815-93969837 TTGAGCAAAGACCTGGTGGAGGG + Intergenic
1132639973 16:973488-973510 GTGGGCAAAGCCACGGGGAAAGG + Intronic
1132695224 16:1199028-1199050 GTGGGCGGAGCCATGGTGGGGGG - Intronic
1132695238 16:1199077-1199099 GTGGGCAGAGCCATGGTGGGGGG - Intronic
1132695289 16:1199270-1199292 GTGGGCGGAGCCATGGTGGGGGG - Intronic
1132914175 16:2333380-2333402 GCGAGCAGAGCCATGGTTGGCGG - Intronic
1133314945 16:4877088-4877110 GTGGCCAAGGCCATGGTGGAAGG - Exonic
1133353266 16:5117101-5117123 GTGAGAGAAGCCCTGCTGGACGG + Intergenic
1133481207 16:6172413-6172435 GTGAGCAAACCCTTGGTGTCTGG + Intronic
1134405541 16:13955544-13955566 GTGACTAAAGCCACAGTGGAAGG + Intergenic
1136096990 16:27963750-27963772 ATGTGCAAAGCCATGGTGGGAGG - Intronic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1139320681 16:66111364-66111386 CTCAGCAAAGCCATGGAGGTTGG + Intergenic
1139526273 16:67518664-67518686 GGGAGCAAGGCCATGCTTGAGGG - Intronic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1141629892 16:85281678-85281700 GTGGGCAAAACCAAGGTGCATGG + Intergenic
1142759268 17:2033910-2033932 GTGGGTAAAGCCCTGGTGGCGGG + Intronic
1143055605 17:4159663-4159685 ATGAGCACAGCCATGGAGCAGGG - Intronic
1143807577 17:9441959-9441981 GTAATCAAAGCCATGGTGCCAGG - Intronic
1144125917 17:12202770-12202792 GAGAGCAGAGCCATCATGGATGG + Intergenic
1146519415 17:33514799-33514821 GTGAGCAAAGCCATGAATCAGGG - Intronic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146920290 17:36705507-36705529 GGGAGCAAAGCCGGGATGGAGGG + Intergenic
1147977565 17:44256539-44256561 GGGAGCCAAGCCAAGGTGGCTGG + Intronic
1148431268 17:47645721-47645743 GTGAGTTAAGACATGGTGAATGG - Intergenic
1148775276 17:50091754-50091776 GTGAGCTGAGCGCTGGTGGAGGG - Intergenic
1149864871 17:60145765-60145787 GTGAGGAAAGCCAGGGCAGATGG + Intergenic
1151262296 17:72925784-72925806 ATGTGCAATGTCATGGTGGAGGG - Intronic
1151327467 17:73388070-73388092 GTGGGCCAGGCCATGGTGGAGGG + Intronic
1151764550 17:76125442-76125464 GTGAGCAAAGGCATGGAGGTGGG - Intergenic
1152315918 17:79580155-79580177 TTAAGCAAAGCCATGGTGGGAGG - Intergenic
1152406960 17:80103338-80103360 AGGAGCAAGGCCATGGGGGAGGG - Intergenic
1152704455 17:81835498-81835520 GTGAGGCAAGCCACGCTGGAAGG - Intergenic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1156283274 18:35663151-35663173 GTGAGCAAAGGCATGGAAGCAGG + Intronic
1156612257 18:38738694-38738716 GTGTGTCAATCCATGGTGGAAGG + Intergenic
1157567592 18:48690237-48690259 GTTAGGGAAGCCATAGTGGATGG - Intronic
1158119606 18:54033922-54033944 TTTATCAAAGCCATGGTAGATGG - Intergenic
1158347900 18:56534339-56534361 GTAAGTAAAGCCATGTAGGATGG - Intergenic
1159494797 18:69188993-69189015 GTGAGCAGAGCCCTCGTGGGTGG - Intergenic
1160017506 18:75155722-75155744 GTGAGCTCAGCACTGGTGGAAGG + Intergenic
1160128544 18:76203744-76203766 GTCAGCATAGCCACAGTGGAAGG + Intergenic
1161285891 19:3468210-3468232 GTGAGCAAAGCCTTGGGGAGGGG - Intronic
1164063594 19:21695433-21695455 ATGAGCAGAGCCATGGAGGAGGG + Intergenic
1165085190 19:33340674-33340696 CTGAGCAGCGCCATGGTGGTTGG + Intergenic
1166511243 19:43410358-43410380 GTGAGCAAAGCCAAAGAGGCTGG + Intronic
1167690223 19:50980538-50980560 GTGTGCAAAGACCTGGGGGACGG + Intronic
1168191634 19:54742555-54742577 GTGAGCAAAGTCAGCATGGAGGG - Intronic
925485403 2:4323288-4323310 GTGAGGGAAGCCCTGGTGTATGG + Intergenic
926021580 2:9500950-9500972 TTCAGAAAAGCCATGGCGGATGG - Intronic
926039949 2:9665039-9665061 GTGAGCAAAGACTTGGAAGAAGG - Intergenic
926044980 2:9703722-9703744 GTGAGCAGAGCCAAGTGGGAGGG - Intergenic
926172420 2:10560684-10560706 GTGAGCAAAGCCTGGAAGGAGGG - Intergenic
929917866 2:46151242-46151264 GAGAGCACAGCCATGGGTGAGGG - Intronic
929952836 2:46429280-46429302 GTGAGCAAAGTCCTGGAGGAGGG + Intronic
931384590 2:61786630-61786652 CTGAGCAAAGGCATGGAGGTGGG + Intergenic
931977416 2:67657986-67658008 GTGAGCAAAGACCTGGAGGTGGG - Intergenic
933504745 2:83162500-83162522 GTGAGAGAAGGCAGGGTGGAAGG + Intergenic
935076841 2:99753675-99753697 GTGTTCAAAGCCATGTGGGAAGG + Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
937006806 2:118524093-118524115 GAAGGCAAAGCCATCGTGGATGG + Intergenic
937439522 2:121904326-121904348 ATGAGCTAAGCCATGCTGGATGG + Intergenic
939179113 2:138783369-138783391 ATGAGCAAAGGCAGAGTGGAGGG + Intergenic
939771593 2:146326719-146326741 GAGAGGAAAGACATGGAGGAGGG + Intergenic
940986372 2:160056011-160056033 GGTATCAAAGCCATGGTGAATGG - Intronic
941459757 2:165755364-165755386 GTGGGCAAAGGAATGGTGGTAGG + Intronic
942402745 2:175620942-175620964 GTGAGCACCGCTATGTTGGAAGG + Intergenic
942517224 2:176766924-176766946 CTGAGGAAAACCATGGTGGTGGG - Intergenic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945905423 2:215587607-215587629 GTGAGGAAAGCAATGTTGTAAGG + Intergenic
946158506 2:217822114-217822136 CTGAGCAAGGCCCTGGTGAAAGG - Intronic
946181335 2:217950875-217950897 ATGAGCAGAGCCCTGGAGGATGG - Intronic
946608252 2:221430129-221430151 GTGATTAAAGCCATTGAGGAAGG - Exonic
947440874 2:230120514-230120536 GGGAGAAAAGGCATGGTGGCAGG - Intergenic
947870795 2:233436823-233436845 GTGAGCACAGCCATGTGGAAGGG + Intronic
1169791262 20:9413148-9413170 GTGAGCACAGCCATGCCCGACGG - Intronic
1170918118 20:20648708-20648730 GAGAACAAAGCCATGGGGGATGG + Intronic
1171118298 20:22546293-22546315 GTGAGCACAGACATGGTGTGGGG + Intergenic
1171139678 20:22729919-22729941 GTGTGGAAAGTCATGGAGGAGGG + Intergenic
1172293434 20:33791747-33791769 CTGGGCAGAGCCATGGTGGCAGG + Exonic
1172597257 20:36157868-36157890 GGGAGCTGAGCCTTGGTGGATGG + Intronic
1173073719 20:39795620-39795642 GTGAGCAAAAGCATGGTGGTAGG - Intergenic
1173198704 20:40938126-40938148 GTGAGCCAAGACATGGAGGATGG + Intergenic
1173601456 20:44298545-44298567 GTGAGCAAAGCTAAGGACGAAGG - Intergenic
1173755605 20:45512944-45512966 CAGAGCACAGCCATTGTGGATGG - Intronic
1173859046 20:46270103-46270125 CTGAGCAAAGTCTTGGAGGAAGG + Intronic
1174104567 20:48153179-48153201 GTGAGCAAAGGCCCAGTGGAGGG - Intergenic
1174230329 20:49040980-49041002 GTGAGCACTCCCATGCTGGAAGG - Intergenic
1174888703 20:54365573-54365595 CTGAGCAAAACCGTGGTGGTTGG - Intergenic
1175175294 20:57108211-57108233 GTGAGAAATGCCATGGTGGCTGG - Intergenic
1175340302 20:58224913-58224935 GTGAGCAAATCCATGGGCCAGGG - Intronic
1175777610 20:61663051-61663073 GTCATCAATACCATGGTGGAGGG - Intronic
1175817856 20:61892990-61893012 GTGAGTAGAGGGATGGTGGATGG + Intronic
1175817916 20:61893227-61893249 GTGACCACAGGGATGGTGGATGG + Intronic
1175918952 20:62441083-62441105 GGGAGGGAAGCCATGGAGGATGG + Intergenic
1176426661 21:6552696-6552718 CTGAGCAAGGCCATGGGGCAGGG - Intergenic
1179702152 21:43161018-43161040 CTGAGCAAGGCCATGGGGCAGGG - Intronic
1180109916 21:45643008-45643030 GTGAGCGAGACCTTGGTGGACGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1183346841 22:37312744-37312766 GTGAGGAAAGCCAAAGTGTAGGG + Intronic
1184416613 22:44355543-44355565 GTCAGCAGAGGCATGGAGGAAGG - Intergenic
1184690481 22:46115131-46115153 GTGAGCACAGGCATGAGGGAGGG - Intergenic
949170011 3:986344-986366 GGGAGAAAAGCCAGGGTGGCTGG + Intergenic
950078935 3:10207493-10207515 GTGAGGTGAGCCATGGTGGCTGG - Intronic
950333496 3:12175780-12175802 AAGAGCAAAGACATGGTGGTGGG + Intronic
951330155 3:21357337-21357359 GTGAGCATGGCCAGGCTGGAGGG - Intergenic
953606707 3:44417314-44417336 TTGAGCAAAGCTATGGAGGCTGG - Intergenic
953878733 3:46680798-46680820 GTGTGCAAAGCCATGGAGGTAGG + Intronic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
954183198 3:48897884-48897906 GAGTGCTAAGCCATGGGGGATGG + Intronic
954425958 3:50443259-50443281 GAGAGCAGAGCCAGGGTGGGTGG - Intronic
955334866 3:58077045-58077067 GATAGCAAAGCCATTGTGGATGG + Exonic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
957057233 3:75453108-75453130 GTGAGAGAAGCCCTGCTGGATGG + Intergenic
957806083 3:85151055-85151077 GTGAGCAGAGCAATGGTAGATGG + Intronic
959063299 3:101634778-101634800 ATGAGCAGAGCCAAGGGGGAGGG - Intergenic
959099908 3:101998602-101998624 GTGAGCAAATTCATGGAGGATGG - Intergenic
959952063 3:112190468-112190490 GTCAGCACAGCCATTCTGGAGGG - Intronic
961296220 3:125886627-125886649 GTGAGAGAAGCCCTGCTGGACGG - Intergenic
962986116 3:140537599-140537621 GTGAGCTCAGCCATGGGAGAGGG - Intronic
963290307 3:143480595-143480617 GTGAGCAAAGCTATGGGAGTAGG - Intronic
964278763 3:155038369-155038391 GTGAGCAGAGCCAGGGTTGGTGG - Intronic
964858756 3:161176629-161176651 GTGAGAACAGTGATGGTGGATGG + Intronic
968687737 4:1972786-1972808 GTGAGAAAAGACATTGTGCACGG + Intronic
969046322 4:4339246-4339268 TTGAGCAGAGGCATGGTGGTAGG - Intergenic
969290105 4:6233396-6233418 GTGAGCAAAGACCTGGTTGAAGG - Intergenic
970665749 4:18334173-18334195 GAGAGCAAAGCAAGGGTTGAGGG - Intergenic
972226751 4:37022079-37022101 GAGAGCAAAGCCATAGTGAAAGG + Intergenic
972289044 4:37673951-37673973 GTGTGCAAAGGCATGGAGGTGGG - Intronic
973822183 4:54671393-54671415 GTGACCATAGCCTTGGTTGAAGG + Intronic
974077220 4:57178180-57178202 GTTAGAAAAGCCTTGTTGGAAGG + Intergenic
975458596 4:74623572-74623594 GTGAGGGAAGCCATGGTGGCTGG + Intergenic
975547314 4:75573247-75573269 GTGAGTAAAGGCAGAGTGGAAGG - Intergenic
975712089 4:77170980-77171002 GTGAGCAAAAGCATGGTGAGTGG - Intronic
977109182 4:92930021-92930043 GTGGGCAAGGCCAAGATGGAGGG - Intronic
978120583 4:105074472-105074494 GTAAGAAAAGCCATGGAGAAAGG - Intergenic
978856162 4:113397286-113397308 GTGAGCAAAACCAGGGAGGAGGG + Intergenic
981725215 4:147840267-147840289 GGGAGCAAAGCCAGGTTTGATGG - Intronic
983603280 4:169554547-169554569 GTGAGAAAAGCCAGTGTGAAAGG + Intronic
984892583 4:184506901-184506923 ATGAGCAATTCCATGGTGAAGGG + Intergenic
986640745 5:9869345-9869367 AAGAGCAAAGGCATGGTGGCAGG + Intergenic
986726412 5:10601423-10601445 GTTAGCCAAGCAATGGTGGGAGG - Intronic
987432337 5:17850604-17850626 GTGAAAACAGCCATGGTGGGGGG + Intergenic
990499737 5:56384108-56384130 CTGAGCCAATCCAGGGTGGAAGG - Intergenic
992546102 5:77815496-77815518 AGGAGCAAAGCCATGGAGGCAGG + Intronic
993068147 5:83126767-83126789 GCCAGCAAAGCCATGGGGGCAGG + Intronic
994282258 5:97919687-97919709 GTGAGCCAAGACATAGAGGAGGG + Intergenic
996117571 5:119634735-119634757 GTGAGCAAAGCCTGGGTTGTGGG + Intronic
997381247 5:133440027-133440049 GTGAGCAGAGCCCTGGGGGTGGG + Intronic
998623763 5:143822991-143823013 ATGAGCAAAGGCCTGGAGGAGGG + Intergenic
1001207778 5:169780081-169780103 AAGGCCAAAGCCATGGTGGAAGG - Intronic
1001240692 5:170067723-170067745 GTGAGCAGAGCAGTGGTGGGAGG + Intronic
1001442082 5:171750813-171750835 GTGAGCAAAGGCCTGGAGGCAGG - Intergenic
1001883733 5:175269775-175269797 GAGAGAAAGGCTATGGTGGAAGG + Intergenic
1002434787 5:179224576-179224598 GTGAGAAAAGCCATGTGGGCAGG + Intronic
1002445819 5:179289113-179289135 GTGAGCAGAGCCCTGCAGGAGGG - Intronic
1004510983 6:16284576-16284598 GTCACGAAAGCCATGGTGCAAGG - Intronic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1007083707 6:39127727-39127749 GTGAGGGATTCCATGGTGGAGGG + Intergenic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1007267647 6:40609454-40609476 GTGGGCAAAGGCATGGAGCATGG + Intergenic
1008496030 6:52135416-52135438 TTGAGCAAAGACATAGTGGCAGG - Intergenic
1012094006 6:94934660-94934682 CTGAGGGAAGTCATGGTGGAGGG - Intergenic
1013295435 6:108754393-108754415 TTGATCAAAGGCATGGTGGTTGG - Intergenic
1014758707 6:125330469-125330491 GTGAGAAAAACCAAGATGGATGG - Intergenic
1015849136 6:137553422-137553444 GTGATGGAAGCCATTGTGGATGG + Intergenic
1016953954 6:149608540-149608562 GGCAGCAAAGGCAGGGTGGAAGG + Intronic
1017870877 6:158485654-158485676 GTGGGCAGAGCCATGGGGGCAGG + Intronic
1018751410 6:166809743-166809765 GGTGGCACAGCCATGGTGGAAGG + Intronic
1019318250 7:401434-401456 ATGAGCAAAGCAATGTTGGGGGG + Intergenic
1020129577 7:5552184-5552206 GTGGGCAACGCCCTGATGGAAGG - Intronic
1021229602 7:18070119-18070141 GGAAACAAAGCTATGGTGGATGG - Intergenic
1022359355 7:29643672-29643694 ATGAGCGGAGCCATGGAGGAGGG + Intergenic
1022834279 7:34098761-34098783 GTGATCAAAGCCAGGGAGGAAGG + Intronic
1023366566 7:39470358-39470380 TTGAGGAAAGCCATGGTCAAGGG + Intronic
1023375447 7:39551007-39551029 GTGAGCACAGGCATGGGTGATGG - Intergenic
1023744389 7:43309279-43309301 GTGTGCAAAGACAGGGTGGTGGG + Intronic
1026659601 7:72288367-72288389 GTGATCAAAGACATGGGGGTAGG + Intronic
1027379314 7:77589019-77589041 ATGAGCTGAGCCATGGTGGTAGG - Intronic
1027470393 7:78566173-78566195 GTGAGCAAAGGCATGGAGTTGGG + Intronic
1027845426 7:83367780-83367802 GGGAGCAAAACCATGGTACAAGG - Exonic
1030297110 7:107940195-107940217 GAGAGCAAAGCACTGGTGGCAGG + Exonic
1030857917 7:114584684-114584706 GTGGGCAAAGCCATGGTGGTGGG - Intronic
1032075751 7:128835325-128835347 GACAGCAAGGCCATCGTGGATGG + Exonic
1032238432 7:130143057-130143079 GTGAGCAAAGGCACAGTGGTAGG - Intergenic
1036412608 8:8516584-8516606 GGGATCAAAGCAATGGAGGAAGG - Intergenic
1036513589 8:9422710-9422732 GTTAGCCAAGGCATGGTGGCGGG + Intergenic
1039083846 8:33760306-33760328 CTCAGAAAAGCCATGGTGGTAGG - Intergenic
1039228577 8:35418241-35418263 GTGAGCAAACCCAGGGAGGCAGG - Intronic
1039799260 8:40940093-40940115 GTGAGCAAAGACATGGAGGTTGG + Intergenic
1040061017 8:43102798-43102820 CCGTGCAAGGCCATGGTGGAGGG - Intronic
1041504249 8:58576935-58576957 GTGAGCAAGGCCATCATCGATGG - Intronic
1043513668 8:80976223-80976245 GTGAGGAAAGCCAAGCTGTATGG - Exonic
1044143061 8:88678259-88678281 GAGAGCAAAACCAGGGAGGAAGG - Intergenic
1044712882 8:95073753-95073775 GTCAGCAAAGCCACGGTGTGGGG + Intronic
1045311488 8:101007261-101007283 GTGAGCAGAACCATGCTTGATGG - Intergenic
1045838310 8:106549777-106549799 GAGAGCAGAGCCATGATGAATGG - Intronic
1047447254 8:124930455-124930477 GTGAGCTGAGCCAGGCTGGAGGG + Intergenic
1047591565 8:126332369-126332391 GCTAGAAAAGCCCTGGTGGATGG - Intergenic
1049164028 8:141115803-141115825 GAGTGCAAAGCCAAGGTGGGCGG + Intergenic
1049629289 8:143643682-143643704 GAGAGCCAATCCCTGGTGGAAGG - Intronic
1050971863 9:11888102-11888124 ATGAGCATAGCCAAGGTTGAAGG + Intergenic
1053286330 9:36851721-36851743 ATGAGCAAAGGCAGGGAGGAGGG + Intronic
1053351318 9:37415121-37415143 GTGAGCAAAGGCCTGGAGGCTGG - Intergenic
1053434127 9:38064267-38064289 GTACTCAGAGCCATGGTGGAGGG - Intronic
1056121815 9:83495703-83495725 GTGACAAAAGTCATGGTGAATGG + Intronic
1058765986 9:108183203-108183225 GTGAGCCAAGGCCTGGTGGCTGG - Intergenic
1059051923 9:110935646-110935668 GAGAGCAGAGCCTTGGAGGAGGG + Intronic
1059204902 9:112455399-112455421 GTGACTAAAGCCATGGATGATGG - Intronic
1059399827 9:114061951-114061973 GGGAGCAAAGGCAGGGTGGGTGG - Intronic
1059454367 9:114390232-114390254 ATGAGCAAAGGCAGGGAGGAGGG - Intronic
1060508223 9:124214354-124214376 GGGAGGAGAGCCATGGGGGAGGG + Intergenic
1061979943 9:134096500-134096522 GTGAGCAAGGCTGTGGTGAAAGG + Intergenic
1185995302 X:4940763-4940785 GTGAGCCCAGGCAGGGTGGAGGG + Intergenic
1186522692 X:10220323-10220345 GTAAGGAAAGCCAGAGTGGAGGG + Intronic
1186994694 X:15107549-15107571 CTGAGGCAAGCCATGGTGTAAGG - Intergenic
1187006272 X:15235712-15235734 GTGGGCAAAGCAATGTAGGATGG + Intronic
1188646637 X:32576706-32576728 GAGAGCAAAACCATGGATGAGGG + Intronic
1189300676 X:39949998-39950020 TAGAGCCAAGCCATGGAGGAAGG - Intergenic
1192565306 X:72158508-72158530 TTCAGCAAAGCCATGGGGCAAGG - Intergenic
1193978203 X:88149817-88149839 CTGAGCAAAGCCATGGGTGTGGG - Intergenic
1194788423 X:98116011-98116033 ATCAGCAAAGCCATGGGGGCAGG - Intergenic
1195113092 X:101666875-101666897 GTGAGCCAAGCAAAGATGGAAGG + Intergenic
1197744849 X:129925196-129925218 GTGAGCAGAGCCAGGGTGGTGGG + Intronic
1198995445 X:142568608-142568630 GTGAGCAGAAGCATGGTGGGTGG + Intergenic
1199505272 X:148554386-148554408 ATGAGAAAGGCCATGGTGCATGG + Intronic
1200215876 X:154368069-154368091 GACAGCAAGGCCATCGTGGACGG - Exonic