ID: 1007041689

View in Genome Browser
Species Human (GRCh38)
Location 6:38727849-38727871
Sequence TTTTCCAGTGACTGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007041683_1007041689 28 Left 1007041683 6:38727798-38727820 CCTTCATTCAGCACTGCTCAAGA 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG No data
1007041681_1007041689 30 Left 1007041681 6:38727796-38727818 CCCCTTCATTCAGCACTGCTCAA 0: 1
1: 0
2: 1
3: 22
4: 307
Right 1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG No data
1007041682_1007041689 29 Left 1007041682 6:38727797-38727819 CCCTTCATTCAGCACTGCTCAAG 0: 1
1: 0
2: 2
3: 24
4: 185
Right 1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007041689 Original CRISPR TTTTCCAGTGACTGGGTGGC AGG Intronic
No off target data available for this crispr