ID: 1007041934

View in Genome Browser
Species Human (GRCh38)
Location 6:38730345-38730367
Sequence CAGGCACAAGATGCTGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007041934_1007041937 3 Left 1007041934 6:38730345-38730367 CCTATCTCAGCATCTTGTGCCTG 0: 1
1: 0
2: 2
3: 19
4: 231
Right 1007041937 6:38730371-38730393 CAGCTGTCACTTGGAATAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 181
1007041934_1007041935 -6 Left 1007041934 6:38730345-38730367 CCTATCTCAGCATCTTGTGCCTG 0: 1
1: 0
2: 2
3: 19
4: 231
Right 1007041935 6:38730362-38730384 TGCCTGCTGCAGCTGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007041934 Original CRISPR CAGGCACAAGATGCTGAGAT AGG (reversed) Intronic
900232312 1:1566192-1566214 CAGGCACAAGTTGCAGACATTGG + Intronic
901187779 1:7386248-7386270 CAGGCCCAAGAGGCAGAGCTCGG + Intronic
902807230 1:18868717-18868739 CAGGAACAAGACGCTAAGGTTGG + Intronic
905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG + Intronic
905506791 1:38486248-38486270 CAGGCAGAGGCTGCTGAGGTGGG - Intergenic
905724276 1:40235789-40235811 CAGGCACAAGATGCTGGTCTTGG + Exonic
906697547 1:47833510-47833532 GAGACAGAAGATGCTGGGATGGG + Intronic
909042795 1:70674094-70674116 CAGCCACAAGAAGCTGAGAAGGG - Intergenic
912938596 1:114025049-114025071 CAGACACAAGAAGCTGATTTAGG + Intergenic
913049575 1:115105286-115105308 CAGGCAAAAGATAATGAGGTGGG - Intergenic
914242039 1:145858835-145858857 CAGGCACGAGCTGCTGAGGATGG - Intronic
915281929 1:154828831-154828853 CAGCCATAAAATGCTGATATTGG - Intronic
917978975 1:180257790-180257812 CACGCACAGGAGGCTGACATGGG + Intronic
918302922 1:183220327-183220349 CAGGTACAAGAGTCAGAGATGGG + Intronic
918910526 1:190562811-190562833 CAGGCACAAGATGGGGGGATGGG - Intergenic
919259414 1:195172400-195172422 CAGGCACAAGTTGCAGTAATAGG - Intergenic
919892677 1:201987133-201987155 CAGGCTCCAGATGCAGAGTTGGG - Intronic
919947629 1:202332321-202332343 CAGGGACTAGTTGCAGAGATGGG - Intronic
919957907 1:202437904-202437926 CAGCCACAACATGCTGAGTGAGG + Exonic
920526692 1:206672226-206672248 CAGGCTCAAGAGAATGAGATAGG - Intronic
922002084 1:221489278-221489300 AAGGCACAAGATGATGGGAGAGG + Intergenic
922156914 1:223047759-223047781 CAGGCAGAAGAAGGTGGGATAGG - Intergenic
923840689 1:237668300-237668322 CAGACAAAAGAGGCTGAGATAGG - Intronic
924036088 1:239939706-239939728 CAGGAACAAGTTGCTGACACAGG - Intergenic
924042342 1:239996581-239996603 CAGGAACAAGTTGCTGACACCGG + Intergenic
1063478583 10:6350283-6350305 CAGGAAGAAGAGGCTGAGGTAGG - Intergenic
1064092221 10:12394969-12394991 GAGGCACACCATGCTGAGATGGG - Intronic
1064476895 10:15700317-15700339 GAGGCAGGAGATGCTGAGATTGG - Intronic
1068187567 10:53605770-53605792 CCAGCACAACATGTTGAGATTGG - Intergenic
1070534134 10:77362374-77362396 CACACACACGATGCTGGGATAGG + Intronic
1072566048 10:96617614-96617636 CAGGCAACAGAAGCTGACATGGG + Intronic
1072758503 10:98036878-98036900 CAAGCAAGAGATGCAGAGATAGG - Intergenic
1074697105 10:116059459-116059481 GTGGGACAAGATGCTGATATTGG + Intronic
1076691527 10:132226017-132226039 CTGGCACCAGATGCTGGGAGGGG + Intronic
1076832911 10:133005865-133005887 CAGGCCCCAGATGCAGAAATGGG - Intergenic
1077245702 11:1536693-1536715 CACACAAAAGCTGCTGAGATAGG + Intergenic
1077443790 11:2580892-2580914 CAGGCAGACGGTGCTGAGAGGGG + Intronic
1079859789 11:25654517-25654539 CTGGAACAAGATGCTGATAGTGG - Intergenic
1080375615 11:31706739-31706761 CAGGTACTAGATGTTGGGATGGG - Intronic
1081567894 11:44270923-44270945 CAGACACCAGCTGCAGAGATTGG + Intronic
1084233939 11:67774019-67774041 CAGGCACAAGCTACTGAGCCTGG + Intergenic
1085017285 11:73183101-73183123 CAGGCAAAAGCAGCTGGGATAGG - Intergenic
1085533490 11:77204983-77205005 CAGGCCCAAGAAGCTCAGAGTGG + Intronic
1087082503 11:94185446-94185468 CAGGCTCAAAATGCAGAGCTTGG - Intergenic
1087158405 11:94926344-94926366 CAGGCACCACATGCAGAGCTGGG + Intergenic
1088211082 11:107457184-107457206 CAGGCTAAATATACTGAGATTGG + Intronic
1088719371 11:112578353-112578375 CAGGGATAAGATGGGGAGATTGG + Intergenic
1089047546 11:115516212-115516234 CAGGCAAAAAATGCTGCAATAGG - Intergenic
1089605745 11:119640291-119640313 CAGGCAGCAGGTGCTGAGATGGG + Intronic
1089726154 11:120482185-120482207 CATGAACAAGAAGATGAGATAGG + Intronic
1090464517 11:126922455-126922477 CAGGCACACGATGATGAGTTTGG - Intronic
1091024343 11:132128611-132128633 CAGGTACAAGAGGCTGATAAGGG + Intronic
1091136684 11:133197419-133197441 CAGGCACCATGTGCTGAGTTTGG - Intronic
1093088605 12:14894624-14894646 CAGGAACAAGTTGCTCAGTTTGG - Intronic
1097151692 12:56984002-56984024 CAGGCACTAGGAGCAGAGATGGG - Intergenic
1097201691 12:57284329-57284351 CATATACATGATGCTGAGATTGG + Intronic
1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG + Intergenic
1101520716 12:105479590-105479612 CTGGCACAAGCAGCAGAGATCGG + Intergenic
1101793694 12:107953731-107953753 CAGGAACAAGAAGCTGAGGACGG - Intergenic
1102244201 12:111344715-111344737 CAGGCCCAGGATCCTGGGATGGG + Intronic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1102768486 12:115452849-115452871 GTGCCACAGGATGCTGAGATGGG - Intergenic
1104705859 12:130946846-130946868 CAGGGAGAAGAGGCCGAGATGGG + Intergenic
1105355868 13:19658999-19659021 CAGGCAGCAGATTCTGAGTTTGG + Exonic
1107812668 13:44215362-44215384 GAAGCACCAGAAGCTGAGATTGG - Intergenic
1108506013 13:51113015-51113037 CAGGCACAAGCTACTGAGAAAGG - Intergenic
1110684687 13:78358253-78358275 CAGGTAGCAGATGCTGACATAGG + Intergenic
1111264007 13:85782918-85782940 CAGACACCAGATGCTGAAAGAGG - Intergenic
1111511088 13:89263508-89263530 AAGGCAAAAGATTATGAGATTGG - Intergenic
1112083729 13:96005641-96005663 CAGGCCCAACATTCTGAGAGAGG + Intronic
1113025143 13:105932200-105932222 TAGACACAAAAAGCTGAGATTGG - Intergenic
1114466928 14:22929555-22929577 CAGGAACCAGACCCTGAGATTGG - Exonic
1115063556 14:29225175-29225197 CAGACACACTATGCTCAGATTGG - Intergenic
1115805822 14:37050448-37050470 CATGCACAAGAGGCTGAGTGGGG + Intronic
1117966742 14:61214200-61214222 CAGGTACAAGACATTGAGATGGG - Intronic
1118179134 14:63473652-63473674 CAGACTCAAGAGGCTGAGACAGG + Intronic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1123107098 14:105846758-105846780 CAGGTGGAAGATTCTGAGATGGG - Intergenic
1124340637 15:28887230-28887252 CAGACGCAAGATGCCGAGTTCGG - Intronic
1124966450 15:34436370-34436392 CAGACACAAGATGCCAAGTTTGG + Intronic
1127365480 15:58285254-58285276 CAGGCAGAGGCTGCTGAGAATGG + Intronic
1127467725 15:59260529-59260551 AAGGAAAAAGATGCAGAGATGGG + Intronic
1127544380 15:59976588-59976610 CAGGCACCAGAAGCAGAGAACGG - Intergenic
1128634422 15:69294033-69294055 CAGGGGGAAGATGCTGAGACAGG - Intergenic
1130509710 15:84579275-84579297 CTGGCTCAAGCTGCTGAGACAGG - Intergenic
1132364843 15:101250035-101250057 CAGGCACTAGATGTTGTGAGGGG - Intronic
1133317854 16:4895161-4895183 CAGGCACAGGCTCCTGAGAACGG + Intronic
1133740000 16:8644211-8644233 CAGGCACCAGATTCTGTGCTGGG + Intronic
1133877384 16:9748137-9748159 CTGGCACCAGGTGCTGAGATGGG - Intergenic
1137231239 16:46569557-46569579 CAGGCACCAGAAGCTGCGCTGGG - Intergenic
1137531858 16:49282911-49282933 TAGACACCAGATCCTGAGATGGG + Intergenic
1138512395 16:57516191-57516213 CAGGCACCAGGGGCTGAGAATGG + Intronic
1138556921 16:57776188-57776210 CAGGCTGAAGCTGCTGAGCTGGG + Intronic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1142382488 16:89741157-89741179 CAGGGAGATGATGCTGAGTTGGG - Intronic
1143972764 17:10807402-10807424 CAGACATAAGATGCTAAGAGTGG + Intergenic
1145028475 17:19486940-19486962 GAGGAAGAAGATGCTAAGATGGG - Intergenic
1146773862 17:35594939-35594961 CAGGCACAATAAGCTGAGATGGG - Intronic
1146784605 17:35707842-35707864 GATGCCCAAAATGCTGAGATAGG - Intronic
1148529583 17:48376956-48376978 CAGGCCCAAGATGCAGAGGGAGG + Intronic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1150592881 17:66578714-66578736 CAGGCCCAGGATGCAGAGGTGGG - Intronic
1151811690 17:76447057-76447079 GAGGCACAGGATGTTGGGATAGG - Intronic
1153307154 18:3642139-3642161 CAGGCACAATCTAATGAGATGGG - Intronic
1153610200 18:6877250-6877272 CAGAAAGCAGATGCTGAGATGGG + Intronic
1154153555 18:11926550-11926572 CAGCCTCTAGATGCTGAGAAAGG - Intergenic
1155965018 18:32027562-32027584 CAGGCACTATAGGCAGAGATCGG + Intronic
1157896673 18:51475527-51475549 CAGGAAGCATATGCTGAGATGGG + Intergenic
1159011899 18:63065867-63065889 CAGGCACAGGATGGGGAGAAAGG - Intergenic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1164636913 19:29798055-29798077 CACTCTCATGATGCTGAGATTGG - Intergenic
1165989001 19:39795290-39795312 CAGGTAGAAGTTGCAGAGATGGG - Intergenic
925685235 2:6464546-6464568 CAGGCACATTCTGCAGAGATAGG - Intergenic
925821710 2:7805279-7805301 CAGCCACAAGAGCCTGGGATTGG + Intergenic
926517358 2:13864571-13864593 CATGTACAAAATGTTGAGATGGG - Intergenic
926759017 2:16261097-16261119 AAGGCCCAAGATGCCTAGATAGG - Intergenic
928353625 2:30586724-30586746 CAGGGACAAGATGTTGAGGATGG - Intronic
928449375 2:31365034-31365056 CAGGCCCAAGATGTTAGGATGGG - Intronic
930149651 2:48045465-48045487 CAGGAGCAAGAGGCTGAGAAGGG + Intergenic
932290213 2:70570831-70570853 CAGACAAAACACGCTGAGATGGG - Intergenic
935202673 2:100871471-100871493 CAGGCACATGCTGCTGTGCTTGG + Intronic
940462923 2:153990401-153990423 CAGACACAGGATGCTAACATTGG - Intronic
940670184 2:156658086-156658108 CATGCTCAAGATGTTCAGATGGG + Intergenic
941144764 2:161831033-161831055 CAGCTACAAGATTCTGAGGTAGG + Intronic
943850658 2:192717890-192717912 CAGGCAGATGATGCTTAGACTGG + Intergenic
944724902 2:202461119-202461141 CAGGCACAAGACGCTGCACTCGG + Intronic
947107313 2:226680985-226681007 CAAGTAGAAGGTGCTGAGATTGG + Intergenic
948239331 2:236416451-236416473 CTGGCAGTAGATGCTGAGTTGGG - Intronic
1168848996 20:963899-963921 CAGGCACACGAGGCTGCGGTGGG - Intronic
1169842401 20:9954540-9954562 CAGGCAGAAGAGGCTGAGCAAGG + Intergenic
1170628867 20:18051096-18051118 CAGGCACATGCTGCTGAGCCTGG - Intronic
1171385827 20:24768994-24769016 CATGCACCAGATGCTGGGAGAGG - Intergenic
1171937231 20:31286363-31286385 CAGGCAGGGGCTGCTGAGATGGG - Intergenic
1172481984 20:35276791-35276813 CAGGCAGGAGAATCTGAGATTGG - Exonic
1172807603 20:37623566-37623588 CAGGCACAACATGATAAGACTGG - Intergenic
1172870022 20:38130045-38130067 CAGGCTCAGGAGGCTGAGATGGG + Exonic
1174469632 20:50747352-50747374 CAAACGCAAGATGGTGAGATTGG + Intronic
1175995190 20:62809152-62809174 CAGGCACAGTCTCCTGAGATGGG - Intronic
1178806115 21:35841021-35841043 CAGGAAGAAGATGCTGAATTAGG - Intronic
1180761426 22:18211421-18211443 CCGGCTCCAGATGCTGAGCTTGG - Intergenic
1180774241 22:18413189-18413211 CCGGCTCCAGATGCTGAGCTTGG + Intergenic
1180977408 22:19855818-19855840 CAGGCATCAGATCCTGAGCTGGG - Intergenic
1181070352 22:20332196-20332218 CCGGCTCCAGATGCTGAGCTTGG + Intergenic
1181183830 22:21087333-21087355 CGGGCTCAAGAGGCTGAGACAGG + Intergenic
1181193342 22:21160141-21160163 CCGGCTCCAGATGCTGAGCTTGG + Intergenic
1181216101 22:21332459-21332481 CCGGCTCCAGATGCTGAGCTTGG - Intergenic
1183170782 22:36186342-36186364 CACACAGAAAATGCTGAGATAGG + Intergenic
1184886962 22:47352350-47352372 CAGACCCCAGAGGCTGAGATGGG - Intergenic
1185377780 22:50489991-50490013 CAGGCACAAGTTGCCGTGAGGGG - Exonic
950364156 3:12471403-12471425 CAGGCACAGGAAGATGAAATGGG - Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG + Intergenic
951508829 3:23479515-23479537 CACCCACAAGATGGTGAGTTGGG + Intronic
951580109 3:24153653-24153675 CAGACACAAGATGCTGATTCAGG + Intronic
951943282 3:28105673-28105695 CTGGCATATGATGCTGTGATTGG + Intergenic
952272205 3:31844090-31844112 TAGGTACAAGATGCTGAACTAGG + Intronic
952283141 3:31942421-31942443 CAGCTACAAGAGGCTGAGAGAGG + Intronic
953664514 3:44916397-44916419 CAGCCTCAGGATGCTGAGAAAGG - Intronic
954422333 3:50425244-50425266 CAGGCTGAATCTGCTGAGATGGG - Intronic
955107134 3:55909059-55909081 CAGGCACAGGATGGTTAAATAGG + Intronic
961786977 3:129353200-129353222 CATTCAGAAAATGCTGAGATGGG + Intergenic
961804342 3:129478196-129478218 CTGGCACAGGATGATGTGATTGG - Exonic
963218799 3:142782689-142782711 CAGGAACAGGGTGCTCAGATGGG + Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966339965 3:178914776-178914798 CAGACACAAGATTCTGACACAGG + Intergenic
966546452 3:181154736-181154758 CAGCCACAAGAAGCTGAAAGAGG + Intergenic
967078864 3:186030339-186030361 AAGGTACAAGATCTTGAGATGGG - Intergenic
968881482 4:3302526-3302548 CAGTCACAAGAGGCTGGGAGGGG - Intronic
969313502 4:6367926-6367948 CATGAACAAGATTCTGAGCTGGG - Intronic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
971602844 4:28617710-28617732 TAGGTACAAGATGCTGAATTTGG + Intergenic
971972831 4:33642291-33642313 CAGGAAGCAGAAGCTGAGATGGG - Intergenic
973222394 4:47743594-47743616 CAGGCACAAGAGGCTGGGAACGG + Intronic
973680725 4:53316120-53316142 CTAGCATAAGATGCTGTGATAGG - Intronic
977649395 4:99452804-99452826 CAGGGACAATGTCCTGAGATAGG + Intergenic
979217455 4:118182512-118182534 CAGGCAAATGATACTGGGATGGG + Intronic
985234241 4:187855520-187855542 CAGGCACTAGAAGCTGAAAAAGG + Intergenic
985706459 5:1404153-1404175 CATGAAGAAGATGCTGAGACTGG - Intronic
986305135 5:6508951-6508973 CAAGGACCAGATGCTGTGATGGG - Intergenic
986399884 5:7370453-7370475 CAGCCCCAAGCTGCTGAGTTTGG + Intergenic
986416067 5:7529521-7529543 CATTCACGAGATGCTGAGAGGGG - Intronic
987879947 5:23730452-23730474 AAGGCAAAAGATGCTAAAATTGG - Intergenic
989617304 5:43349826-43349848 TAGGCACTAAATGATGAGATTGG + Intergenic
990168183 5:53018111-53018133 CAGACAGGAGATGCTCAGATAGG + Intronic
991276722 5:64857298-64857320 CAGGCAGAAGATGCTCAGTCAGG + Intronic
994209454 5:97072227-97072249 CAGGCACGATTTGCTGAGCTAGG + Intergenic
995871773 5:116750633-116750655 CACACACAAAATGGTGAGATAGG + Intergenic
995919826 5:117298422-117298444 CAGGCACAAGTTACTCATATGGG - Intergenic
997419687 5:133756225-133756247 CAGGCACAATGTCCTGGGATGGG + Intergenic
997771479 5:136558422-136558444 GAGGCACAACATGCACAGATAGG + Intergenic
999623712 5:153498180-153498202 CAGCCTCAATTTGCTGAGATGGG + Intronic
999658562 5:153834659-153834681 CTGGCACATGATGCTGTGATGGG + Intergenic
999893227 5:156001129-156001151 CAGAAACAAGATGATGAGATGGG - Intronic
1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG + Intergenic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1009312831 6:62177044-62177066 CAAGCACATGATACTGACATAGG - Intronic
1009350287 6:62667153-62667175 CACACACAAGAAGCAGAGATGGG + Intergenic
1013423235 6:109985817-109985839 CAGGCAAGAGATGATGAGAGTGG - Intergenic
1013481924 6:110560399-110560421 CATGCAGAAGGTGCTGTGATAGG - Intergenic
1013961554 6:115907201-115907223 TAGGCCCAAGATCCTGGGATAGG + Intergenic
1015274606 6:131371288-131371310 AAGGCACCAGAAGCTGAGAAAGG + Intergenic
1015893311 6:137990806-137990828 CAGGCAGAGGAGACTGAGATCGG + Intergenic
1017438084 6:154436597-154436619 CAGCTACTAGAGGCTGAGATGGG - Intronic
1019341563 7:511121-511143 CAGGCAGCAGAGGCTGAGCTGGG + Intronic
1021191943 7:17630984-17631006 AAGGAACAAGATGGAGAGATTGG - Intergenic
1021249954 7:18312204-18312226 CAGGCACAAAATGCAAAGATAGG + Intronic
1021263756 7:18493402-18493424 AAGGGACAAGATGGTGAGACTGG + Intronic
1022518507 7:30990389-30990411 AAGGCAAAAGAAGCTGAGGTTGG - Intronic
1022656240 7:32321969-32321991 CATGCACCAGATGCTATGATGGG + Intergenic
1025201731 7:56966456-56966478 CAAGCCCAAGAAACTGAGATGGG - Intergenic
1029651053 7:101892018-101892040 TGGGGACAAGATGCTGAAATAGG - Intronic
1030109031 7:106010710-106010732 CAAGAACCAGATGCTAAGATGGG + Intronic
1032094977 7:128933466-128933488 CAGACTCAGGATGCTGAGCTGGG + Intergenic
1032562941 7:132911460-132911482 CAGACACAAGACGCTGACAATGG + Intronic
1036178272 8:6560545-6560567 CAGGTGCACGTTGCTGAGATAGG + Intronic
1037405712 8:18540628-18540650 CAGGCGCAAGGTGATGAGCTCGG - Intronic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1038946889 8:32371339-32371361 CAGTCACAGAATGCTGAGCTGGG - Intronic
1039349035 8:36741008-36741030 CAGGCTAAAGATGGTGAAATAGG - Intergenic
1042092687 8:65176271-65176293 TAAGCAAAAGATACTGAGATGGG - Intergenic
1043389053 8:79773638-79773660 CAGGCACAAGAGGCTCAGGAAGG - Intergenic
1044421306 8:91998822-91998844 CAGGAACCAAATGCTGTGATTGG - Intronic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1047742464 8:127817778-127817800 CAGCTACTAGAGGCTGAGATGGG + Intergenic
1048339569 8:133528265-133528287 CAGGCACAAAATGCTGGCAAGGG - Intronic
1048876826 8:138843192-138843214 CAGGCACAAGATGCAGATGCTGG + Intronic
1049021741 8:139961709-139961731 CAGGCACCAGGAGCTGAGAGAGG - Intronic
1049537876 8:143190351-143190373 CAGCCACCAGATGCTGGGAGAGG - Intergenic
1052762397 9:32605986-32606008 CAGATACTAGGTGCTGAGATTGG - Intergenic
1055639374 9:78307697-78307719 CAGTCAGAAGGTGCTGAGAAAGG - Intronic
1056363429 9:85881147-85881169 GAGTCACAAGATGCTCAGTTGGG - Intergenic
1056507075 9:87267794-87267816 CGGGCACCAGATGCTGGGCTGGG - Intergenic
1057839349 9:98473005-98473027 CAGGTACAAGAGGCTCAGAGAGG + Intronic
1059382849 9:113941592-113941614 CAGCTACAAGATCCTGAGAAAGG - Intronic
1059905495 9:118980361-118980383 AAGGCACAAGATGCAGATAGTGG - Intergenic
1060124806 9:121033334-121033356 AATAAACAAGATGCTGAGATAGG + Intronic
1060934054 9:127505734-127505756 CAGGAACAAGAAGCTGAGGAGGG + Exonic
1061181464 9:129027474-129027496 CAGGCCCACGATGCTGAGATTGG - Intronic
1061357686 9:130118876-130118898 CAGGCACACCCAGCTGAGATGGG + Intronic
1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG + Intronic
1062266227 9:135687691-135687713 CTGGGACAAGATGCTGAGGTTGG - Intergenic
1062672472 9:137719677-137719699 CAGACCCAGGATGCTGACATTGG + Intronic
1185798041 X:2983740-2983762 CAAGCACCAGAAGCTGAAATAGG - Intergenic
1186378051 X:9028982-9029004 CAGGGAATAGATGCAGAGATGGG - Intronic
1188635861 X:32430440-32430462 CATACACAAGTTGCTGAGTTTGG + Intronic
1191755528 X:64588403-64588425 CAGCCACTAGAAGCTGAAATAGG - Intergenic
1194017075 X:88636212-88636234 CAGGAACAAGAGGGTGAGAGGGG - Intergenic
1194885011 X:99303743-99303765 GAGGGACAAGATGCTCAGAAAGG - Intergenic
1197462993 X:126766250-126766272 CAGGCACTAGATGCTAAGCTGGG - Intergenic
1198754298 X:139967097-139967119 CAGGCTCAAGATACAGAGCTGGG - Intergenic
1198796203 X:140398118-140398140 CTGGCAAAAGATGCTTACATTGG + Intergenic
1200231519 X:154446136-154446158 CAGGCACCGGATGCTGGGAAAGG - Intronic
1200834367 Y:7718351-7718373 CTGGCACATTATGCTGAGGTGGG - Intergenic