ID: 1007044157

View in Genome Browser
Species Human (GRCh38)
Location 6:38755117-38755139
Sequence CTGGTGGCCTAGTATTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007044148_1007044157 21 Left 1007044148 6:38755073-38755095 CCATGGTTGGTTTATTTCATGTT 0: 1
1: 0
2: 1
3: 35
4: 423
Right 1007044157 6:38755117-38755139 CTGGTGGCCTAGTATTATGTAGG 0: 1
1: 0
2: 0
3: 5
4: 61
1007044152_1007044157 -4 Left 1007044152 6:38755098-38755120 CCTTAACAGGGAGGACCCACTGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1007044157 6:38755117-38755139 CTGGTGGCCTAGTATTATGTAGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007044157 Original CRISPR CTGGTGGCCTAGTATTATGT AGG Intronic
902357941 1:15920787-15920809 CTTGTGGCTTAGGATTTTGTTGG + Intronic
906769771 1:48473275-48473297 CCGGTGGCATAATATTAAGTGGG - Intergenic
908681810 1:66670163-66670185 CTGGTGGTCTAGTTTTCTGGTGG + Intronic
922738078 1:228000329-228000351 CAGGTGGCCTGGTGATATGTGGG - Intergenic
924086060 1:240453271-240453293 CTGGTAGAATAGAATTATGTGGG - Intronic
1066363447 10:34753412-34753434 GTGGTGGTCTAGTCTTTTGTAGG - Intronic
1070126296 10:73625295-73625317 CTGGTGAACTAGTATTAGTTGGG - Intronic
1077630693 11:3809124-3809146 CAGGGGGCCTAGTATTCCGTAGG + Intronic
1077743026 11:4868756-4868778 CTTTTGGCTTAGTATTATCTTGG - Intronic
1083528443 11:63395274-63395296 CTGGTGAGCTAGTGTAATGTTGG + Intronic
1085416008 11:76319333-76319355 CTTGTGGCTTTGTATTAGGTTGG + Intergenic
1093742123 12:22700779-22700801 CCTTTGGCCTATTATTATGTAGG + Intergenic
1095127242 12:38494587-38494609 CTGGTTGCCTAGTAATATTGAGG + Intergenic
1098982579 12:76973592-76973614 CTGGTGAACTAGTATGATTTTGG + Intergenic
1105283876 13:18988385-18988407 CTGTTGGCCTAGGATTGTCTTGG - Intergenic
1105663926 13:22530960-22530982 CTGGAGCCCTAGTAAAATGTGGG + Intergenic
1108365381 13:49706331-49706353 CTGGTTGCCTGCTGTTATGTTGG + Exonic
1109676430 13:65681129-65681151 CAGGTGGCTTAGAATTGTGTTGG - Intergenic
1112913919 13:104522896-104522918 CTGGTGGCCTGCGCTTATGTGGG + Intergenic
1115299362 14:31866258-31866280 CTGGTGGACTAGTGTGATTTTGG - Intergenic
1120969858 14:90198245-90198267 CTGGAGGCCTCCTATTATGTGGG - Intergenic
1121222643 14:92298340-92298362 CTGCTGGCCCAGGGTTATGTTGG - Intergenic
1127894085 15:63279429-63279451 CTCTTGGCTTAGTACTATGTAGG - Intronic
1151220582 17:72609403-72609425 GTGATGGCCTAGTCTTATGCTGG + Intergenic
931794266 2:65694304-65694326 CATGGGGCCTAGTATTTTGTAGG - Intergenic
933018923 2:77166494-77166516 CTTGTGGCTTAGTATTGTCTTGG - Intronic
933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG + Intergenic
935273508 2:101455668-101455690 CTTTTGGCCTAGGATTATCTTGG + Intronic
938201240 2:129374642-129374664 CAGGTGGCCTAGCAGGATGTGGG - Intergenic
1169638544 20:7722029-7722051 CTGGGGGTCTAGTTTTATTTTGG - Intergenic
1177995240 21:28089337-28089359 CTGGTGAACTAGTATGATTTTGG + Intergenic
958038964 3:88203554-88203576 ATGGTGGCTTAATATAATGTTGG - Intergenic
967006246 3:185385668-185385690 TTGGTTTCCTAGTGTTATGTTGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978902725 4:113972149-113972171 CTGGTGGCCTAGTTTGGTCTAGG - Intronic
986617589 5:9635339-9635361 TTGGTTGGCTAGTATTTTGTTGG + Intronic
993037308 5:82771832-82771854 CTGGTGGCCTATTAGGAAGTGGG - Intergenic
995472903 5:112522651-112522673 CTGGTGGACTAGTGTGATTTTGG + Intergenic
996326875 5:122285669-122285691 CTGGTGAGCTAGTATAATTTTGG + Intergenic
1001364269 5:171121521-171121543 CTGCTGGCCCAGTAGCATGTTGG + Intronic
1004092971 6:12524257-12524279 TTGGTGTGCTAGTATTTTGTTGG + Intergenic
1007044157 6:38755117-38755139 CTGGTGGCCTAGTATTATGTAGG + Intronic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1018109535 6:160521691-160521713 CTGTTGGCCAGGTATTAAGTTGG + Intergenic
1019099083 6:169612797-169612819 CTGGTGGCATAAGATTATGATGG - Intronic
1022972331 7:35529649-35529671 CTGGTGCCCTAAGAATATGTGGG - Intergenic
1023687952 7:42755803-42755825 CTGATGGTCTATGATTATGTAGG + Intergenic
1026744627 7:73001494-73001516 CTTATGGCCTAGTATTGAGTTGG - Intergenic
1027030735 7:74886159-74886181 CTTATGGCCTAGTATTGAGTTGG - Intergenic
1027099110 7:75363598-75363620 CTTATGGCCTAGTATTGAGTTGG + Intergenic
1029376971 7:100184303-100184325 CTTATGGCCTAGTATTGAGTTGG + Intronic
1029400210 7:100340378-100340400 CTTATGGCCTAGTATTGAGTTGG + Intronic
1029722602 7:102378994-102379016 CTTATGGCCTAGTATTGAGTTGG - Intronic
1030892539 7:115016729-115016751 CTGGTTCCCAACTATTATGTGGG - Exonic
1032884745 7:136125190-136125212 CTGGTGGCCTCTTATTCTCTTGG + Intergenic
1034595580 7:152187770-152187792 CAGGTGGCAAAGAATTATGTGGG + Exonic
1038641226 8:29330555-29330577 CTTGTGGCCTAGTGATATTTGGG + Intergenic
1044550798 8:93510397-93510419 CTGGTGGCATTGTATCATGGTGG + Intergenic
1052196538 9:25723329-25723351 CTGGTGGCCCATCATTTTGTAGG - Intergenic
1058223686 9:102334241-102334263 CTGCTGGCCAAGTATTTTGTAGG - Intergenic
1059486882 9:114633905-114633927 CTGATGGCCCAGTTTTATGTTGG + Intronic
1186639699 X:11442424-11442446 CTGGCTGCCCAGTCTTATGTGGG - Intronic
1188732089 X:33661801-33661823 TGGGTGTCCTAGTATTTTGTTGG - Intergenic
1195442469 X:104914438-104914460 ATGGTTGTATAGTATTATGTGGG - Intronic
1197085692 X:122471798-122471820 CTGTTGGCCTAATATTAGGTTGG - Intergenic
1200932996 Y:8714173-8714195 TGGGTGGCCTAGGGTTATGTAGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic