ID: 1007051290

View in Genome Browser
Species Human (GRCh38)
Location 6:38833004-38833026
Sequence TAGTGAGAATGCAAAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007051290_1007051291 -2 Left 1007051290 6:38833004-38833026 CCATTGATTTTGCATTCTCACTA 0: 1
1: 0
2: 4
3: 21
4: 329
Right 1007051291 6:38833025-38833047 TAACTCTTAGAGAACCAAAAAGG No data
1007051290_1007051295 30 Left 1007051290 6:38833004-38833026 CCATTGATTTTGCATTCTCACTA 0: 1
1: 0
2: 4
3: 21
4: 329
Right 1007051295 6:38833057-38833079 ATAAATAATAGATGTCATACTGG 0: 1
1: 1
2: 0
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007051290 Original CRISPR TAGTGAGAATGCAAAATCAA TGG (reversed) Intronic
901706913 1:11080924-11080946 TAGAGAACATTCAAAATCAACGG + Intronic
901779854 1:11586769-11586791 CAGTGAGAAGGCAGAATAAATGG + Intergenic
902073868 1:13766882-13766904 TAGAGAGAATGCAAAATTCTGGG - Intronic
907086223 1:51677378-51677400 TACAGACAATCCAAAATCAAGGG - Intronic
908083097 1:60601351-60601373 TGGTGAGGATGCAAAGTAAAGGG + Intergenic
908615279 1:65913846-65913868 TATTGAGAATGCAGAATCTCAGG + Intronic
908972058 1:69848105-69848127 CACTCAGAATGCAAAATCTATGG - Intronic
909632414 1:77780860-77780882 TAGTTAGAATGCAAAAATAGAGG + Intronic
909931893 1:81506022-81506044 TGGTGAGCATGCAAAATTACAGG + Intronic
910000105 1:82331151-82331173 TTGTGAGTATGCAAAAAAAAAGG + Intergenic
910357050 1:86371017-86371039 TCTTGAGAATACAAAATTAAAGG - Exonic
911963733 1:104338864-104338886 TGGTGAGAATGCAAAAAAAGAGG - Intergenic
912003796 1:104868246-104868268 TAGTGAAAATGCAGACTCTAAGG + Intergenic
915988616 1:160490895-160490917 TACTCAGAACCCAAAATCAAAGG - Intronic
916300436 1:163267714-163267736 GAGTGGGAATACAAATTCAAAGG + Intronic
916446701 1:164879350-164879372 TATTTAGAAGGCAAAATCAGTGG + Intronic
916724781 1:167513363-167513385 AAGTGAGAATGCAATATTATTGG + Intronic
916880666 1:169016907-169016929 CAGTGAGAATGGAAGATGAAAGG - Intergenic
916919176 1:169444691-169444713 TAGTGACAATCCAAAAGCAGTGG + Intronic
918332934 1:183476537-183476559 AAGAGAGAATTCAACATCAAGGG + Intronic
918746688 1:188210351-188210373 TTGTGAGATTGCTGAATCAATGG - Intergenic
919614933 1:199795047-199795069 TAATGATGATGCAAAAGCAATGG - Intergenic
920703367 1:208234357-208234379 TATTTAGAAAGGAAAATCAAGGG + Intronic
920726155 1:208437025-208437047 TAGGAAGAAAGCAAAATGAATGG - Intergenic
921113357 1:212061524-212061546 TAATGAGACTGCTAGATCAATGG - Intronic
921658765 1:217773992-217774014 CAGTTAGAATACAAAATGAATGG + Intronic
921956225 1:220985806-220985828 TAGTCAGAATGAAAAATAAATGG - Intergenic
923275701 1:232393841-232393863 TAGTGAAAAAACAAAATGAAGGG - Intergenic
1063728012 10:8660949-8660971 TATTGGTAATGCAAAATAAATGG - Intergenic
1064698611 10:17993598-17993620 TACTCAGAATGCAAAGGCAAAGG - Intronic
1067990718 10:51208809-51208831 TAGTGAGAATCTAAAATCCTAGG - Intronic
1068532494 10:58205557-58205579 TGGTGGGAATGTAAAATGAACGG + Intronic
1069248282 10:66236130-66236152 AAGTAAGAATGGAAAAACAAAGG + Intronic
1070212371 10:74338278-74338300 TGGTGAGAATACAGAATGAATGG + Intronic
1070375183 10:75823594-75823616 TAGTGGGATTGCAAGATCAAAGG - Intronic
1071343700 10:84671367-84671389 TAGTGACAGGGGAAAATCAATGG - Intergenic
1071505759 10:86230448-86230470 CAGTGACAATGCACAACCAAAGG + Intronic
1073227879 10:101939198-101939220 TTGAGAAAATGAAAAATCAAAGG + Intronic
1073730012 10:106276613-106276635 AAGTGAGAAATCAAATTCAAGGG + Intergenic
1078973682 11:16446189-16446211 ATGTAAGAATGCAAAATGAAGGG + Intronic
1080219440 11:29883491-29883513 TAGTCAAAATGATAAATCAAAGG - Intergenic
1083024419 11:59537907-59537929 TAATGACAATGCAAAATCCTAGG + Intergenic
1084926793 11:72520241-72520263 TAGTGAAAATACAAAATCAGCGG + Intergenic
1085866156 11:80296126-80296148 TACTGATGGTGCAAAATCAATGG - Intergenic
1086600991 11:88633312-88633334 TAATGAGAATGGAAAAGAAAAGG - Intronic
1086764922 11:90684680-90684702 TACTGATGATGCAAAAACAATGG - Intergenic
1086788825 11:91008169-91008191 TAGTGAGCATTCAATAGCAATGG - Intergenic
1087585068 11:100108944-100108966 TAGAAAAAATGCAAAATCAGTGG + Intronic
1087725423 11:101710325-101710347 TAATCAAAATGCAAATTCAATGG + Intronic
1088327990 11:108621320-108621342 AAGTGAAAATTCAAAATTAAAGG - Intergenic
1088421751 11:109656160-109656182 TAGTGAGAATTGATAATCCATGG - Intergenic
1089718878 11:120393200-120393222 TAGTGAGAGAGCCAAATTAACGG + Intronic
1092699471 12:11211614-11211636 TGGTGGGAATGCAAAATGATAGG + Intergenic
1093001147 12:13997798-13997820 CAGTAACAAAGCAAAATCAATGG + Intergenic
1094736532 12:33240912-33240934 TAGTGAGACTGCAAACCCACCGG - Intergenic
1095522243 12:43081288-43081310 GAGTGAGAATGTAAAAAGAAGGG + Intergenic
1096663739 12:53148361-53148383 TAATGCTAATGCTAAATCAAGGG + Intergenic
1096893710 12:54798179-54798201 TTTTGAGAATGTCAAATCAATGG + Intergenic
1098492367 12:71096839-71096861 CATTGAGATTGCAAAATGAAAGG + Intronic
1099318028 12:81108725-81108747 TAGTAACAATGCAAAATAACAGG - Intronic
1100952084 12:99862800-99862822 GTATGAGAATGCAAAATCTAGGG + Intronic
1101094693 12:101325433-101325455 TACTGACAAGGCAAAAACAATGG + Intronic
1101095253 12:101332172-101332194 TACTGAAAATACAAAATGAACGG + Intronic
1101127148 12:101647936-101647958 CAGTGAGAAAGCAACATCTATGG - Intronic
1102736844 12:115169521-115169543 TAGTGAGAATGAAGAATAAATGG - Intergenic
1105555392 13:21443277-21443299 AACTGAGAATGCAAAAGAAAAGG - Intronic
1106164113 13:27227008-27227030 TAGTGAGAATGTTAAATAAGTGG - Intergenic
1106652712 13:31708885-31708907 TAGTGAGATTGCTAGATTAAAGG - Intergenic
1106930693 13:34660906-34660928 TAGTCTGAATGGAAAATCAGTGG + Intergenic
1106998394 13:35515201-35515223 TAGAGGGAAAGCAAAAGCAAAGG + Intronic
1107553357 13:41496898-41496920 TGGTGGGAATGCAATACCAATGG + Intergenic
1107612598 13:42131130-42131152 TACTGTGAATGCAAAGTGAAAGG + Intronic
1107668189 13:42714991-42715013 TAGTGAGGATGCAAAGTAACTGG - Intergenic
1109037891 13:57289071-57289093 TAATTATAATACAAAATCAATGG + Intergenic
1109896070 13:68692341-68692363 TAGTGAGGATGCAAAGGAAATGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112492066 13:99875803-99875825 TAGTGAAAATGAAAGATAAAGGG + Intronic
1114126747 14:19736588-19736610 TAGTGAGAATGCAGAGAAAAGGG - Intronic
1114898787 14:27029634-27029656 TAATCAGAATGAAAAATAAAGGG - Intergenic
1115089956 14:29562533-29562555 TAGTGAGAATGCAGAAAAACTGG + Intergenic
1115248327 14:31319483-31319505 TAGGGACAAAGCAAAATGAAGGG - Intronic
1115428985 14:33294214-33294236 TAGAGAGAAAGCAAAAGCTAGGG - Intronic
1115492608 14:33972762-33972784 CAGAGAGAAACCAAAATCAATGG + Intronic
1115680816 14:35735953-35735975 TAGTGATAATGGAAAGTCACTGG + Intronic
1115746348 14:36441555-36441577 TAGTGAGAATAGAAAAAAAATGG - Intergenic
1115885011 14:37961590-37961612 TAGTGAGAATGCAAGAGTAGAGG + Intronic
1116099727 14:40418041-40418063 TAATGAGACTGCTAAAACAATGG - Intergenic
1117580154 14:57143800-57143822 TCCTGAGAGTGCTAAATCAAGGG - Intergenic
1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG + Intronic
1118795049 14:69135204-69135226 TACTGACAATGCAAAAGCAATGG + Intronic
1119147516 14:72330537-72330559 TAGGGAGGTTGAAAAATCAAGGG + Intronic
1120947793 14:90014360-90014382 TACAGAGAATGCAAAATGGAAGG + Intronic
1121889792 14:97578881-97578903 TAGTTAAGATGCAAAATCCATGG - Intergenic
1123390786 15:19869774-19869796 TAGTGAGGATTCAGAGTCAATGG + Intergenic
1123725735 15:23099681-23099703 TATAGAGAATCCTAAATCAATGG - Intergenic
1124799297 15:32814594-32814616 TAGTGAAATTTCAAAAGCAATGG + Intronic
1127200633 15:56645893-56645915 TAGTGTGAATGAAACCTCAAAGG - Intronic
1127223633 15:56907252-56907274 TAATGAGAAATCAAAATCATAGG - Intronic
1129100925 15:73262984-73263006 TAGTGACAAAGCAAGATCAGTGG + Intronic
1129562421 15:76585684-76585706 AAGAAAGAATGCCAAATCAAGGG + Intronic
1130119323 15:81033636-81033658 CAGTGAGACTGCAAACTCCAAGG - Intronic
1130447081 15:84013399-84013421 TAGTGAGAATGGAGAAGCCATGG - Intronic
1131570909 15:93535214-93535236 AAGTGTGAATGCATAATTAAAGG + Intergenic
1135115597 16:19720646-19720668 TAGAGAGAAAGCAAAGACAAAGG + Intronic
1136238336 16:28928652-28928674 TAGTGAGAAAGGAGAATAAAAGG + Intronic
1137378982 16:47980360-47980382 TAATGAGAAATCAAAATGAAAGG - Intergenic
1137932121 16:52598882-52598904 TGGTGAAAATGCAAATTTAAAGG + Intergenic
1138871360 16:60891373-60891395 TAGAGAGAAGGCAAAATCCTTGG - Intergenic
1138913174 16:61428073-61428095 AAGTGAGAAATCAAAATTAATGG + Intergenic
1138927582 16:61611321-61611343 TTGAGATGATGCAAAATCAAAGG + Intergenic
1138936011 16:61724143-61724165 TTTTGAGAATACAAATTCAAGGG + Intronic
1139232198 16:65294502-65294524 TAGAGATAATGCCAAATTAATGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1143279790 17:5744832-5744854 TAATTAGAATGAAAAAGCAATGG - Intergenic
1146511343 17:33451612-33451634 TAGTGAGAAGGCAACTGCAATGG - Intronic
1147513025 17:41088549-41088571 AAGTGAGAATTCAAAATTATGGG + Intronic
1147515096 17:41108552-41108574 AAGTGAGAATTCAAAATTACGGG + Intergenic
1148523420 17:48304846-48304868 TGGTGAGAATGCAGAGTAAAGGG - Intronic
1150516240 17:65812339-65812361 CAGAGAAAATGAAAAATCAAGGG - Intronic
1151773601 17:76181968-76181990 TAGTGAGAGTGCTGAATGAATGG - Intronic
1153861404 18:9212626-9212648 AAGTGAAATTGCTAAATCAATGG + Intronic
1154477670 18:14780073-14780095 ATGTGAAAATGCAAAATCAGAGG + Intronic
1154530608 18:15340883-15340905 TAGTGAGGATTCAGAGTCAATGG - Intergenic
1155107033 18:22677385-22677407 TAGTGATACTGCAAAATAGAAGG + Intergenic
1155378766 18:25192842-25192864 TAGAGAGAATGCAAAAACCAAGG - Intronic
1155749921 18:29409120-29409142 TGGTGAGAATGCAAAAAAACTGG - Intergenic
1156173845 18:34519049-34519071 TAGTGAGAAGGAAGAGTCAAAGG + Intronic
1156177948 18:34569477-34569499 TAGTGAGAAAAAAAAAGCAAGGG + Intronic
1157733189 18:50022508-50022530 TAGTAAGAAGGCAAAGACAAGGG + Intronic
1158003436 18:52645073-52645095 CAATGTAAATGCAAAATCAATGG - Intronic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1158585712 18:58732190-58732212 TATTGAGAGAGCAAAATCAGTGG + Intronic
1159326310 18:66924034-66924056 TAGAGTGAATGAACAATCAAGGG + Intergenic
1159779429 18:72644003-72644025 TAGTGAGAAATCAAAGACAATGG - Intergenic
1162859132 19:13492379-13492401 TGGTGAAGATGTAAAATCAAGGG + Intronic
1164135492 19:22411335-22411357 TACTTACAATGCAAAAGCAAGGG - Intronic
1166608512 19:44167013-44167035 TAGTGGGAAAGAAAAATCACTGG - Intronic
926267034 2:11332640-11332662 TAGTGAGAATGTAAAATGGTAGG + Intronic
926313419 2:11691964-11691986 TAGTTAGATTGGCAAATCAAGGG - Intronic
927058734 2:19392639-19392661 ATATGAGTATGCAAAATCAAGGG - Intergenic
928783425 2:34852972-34852994 TAGTGAGATTGCTGAATCATAGG + Intergenic
929356360 2:41029461-41029483 AAGTGAGAATTAAAAATAAATGG + Intergenic
929627875 2:43428626-43428648 AAGTGAGACTCCACAATCAAGGG + Intronic
930402966 2:50914218-50914240 TGCTGAGAAAGAAAAATCAAAGG + Intronic
930509568 2:52327177-52327199 CAGTGAGAAGCCAAAATCACTGG - Intergenic
930880595 2:56265766-56265788 TAGTGAGACTGCTGGATCAAAGG - Intronic
931021981 2:58056220-58056242 CAGTGAAAAAGCAAAAGCAACGG - Intronic
931575910 2:63718275-63718297 TAGTGAGATTGCTGGATCAAGGG + Intronic
932655008 2:73602801-73602823 TAGTGAGAAAACTGAATCAAAGG + Intronic
932663150 2:73674426-73674448 TAGTGAGAAAACTGAATCAAAGG + Intergenic
933164735 2:79063753-79063775 TTGTTAGAATGCAAAATCTTAGG + Intergenic
933745380 2:85567068-85567090 TACTGATGATGCAAAAGCAATGG - Intronic
935033757 2:99347526-99347548 TATTGAAAATGCAAAATCTCAGG - Intronic
935145818 2:100394623-100394645 GAGTGAGGATGCAAAAGCAGCGG - Intronic
935469946 2:103446852-103446874 TGGTGAGAATGAAAAATGTAAGG + Intergenic
936510397 2:113140598-113140620 TAGTGGGATTGCTGAATCAAAGG + Intergenic
936680261 2:114761874-114761896 TAGGTAAAATGAAAAATCAATGG - Intronic
936771201 2:115915448-115915470 GAGGGAGAGTGCAAAATGAAGGG - Intergenic
936945063 2:117922737-117922759 TGGTGAGAAGGCAAAATAGAGGG + Intronic
939148725 2:138447796-138447818 TAATAAGAATACAAATTCAAGGG + Intergenic
939417416 2:141917379-141917401 TATTGATAAAGCAAAATCAAAGG - Intronic
940477698 2:154186543-154186565 TACTGATGATGTAAAATCAATGG - Intronic
940558674 2:155265510-155265532 TAGTAAGAATTAAACATCAAAGG + Intergenic
941367485 2:164624852-164624874 TAGAGACACTGCAAAATAAAAGG - Intergenic
941432996 2:165434487-165434509 TAGTAAGAACCCAAAAACAAAGG + Intergenic
941542186 2:166800680-166800702 TAGGGTGTATGCCAAATCAATGG - Intergenic
942932592 2:181513584-181513606 TGTTAATAATGCAAAATCAAAGG - Intronic
943424167 2:187708678-187708700 AAGGGAGAACACAAAATCAAAGG - Intergenic
943814947 2:192241465-192241487 TAGTCCAAATGCAAAATCAATGG - Intergenic
945532784 2:210976944-210976966 TAGACAGAATGCAACATCAGAGG - Intergenic
945939908 2:215938220-215938242 TAGTGAAATTGCAGAATCAAAGG - Intergenic
946729417 2:222694046-222694068 TACTTAGAATGCAATATAAATGG + Intronic
946788997 2:223280490-223280512 TATTAAAAATGAAAAATCAATGG - Intergenic
948360101 2:237413781-237413803 AAGTGAGAAAGAAAAATCAGCGG + Intronic
948821610 2:240552334-240552356 TTGTGAGAATGCCATATTAATGG - Intronic
1174494997 20:50932953-50932975 TAGTGATAATACAAATACAAGGG + Intergenic
1174757766 20:53176472-53176494 TTGTTAGAATGAAAAACCAAGGG + Intronic
1175292558 20:57886592-57886614 TAGTGGGATTGCTAGATCAAAGG + Intergenic
1176661556 21:9640074-9640096 GAGTGAGAATGCAAAATCCAGGG + Intergenic
1176766802 21:13027569-13027591 TAGTGAGGATTCAGAGTCAATGG + Intergenic
1177338630 21:19767324-19767346 TAGTGAGAGTGCTAAAAAAAGGG - Intergenic
1178193352 21:30313113-30313135 TGGGGAGAATGCAGAATAAAAGG - Intergenic
1180513927 22:16121856-16121878 TAGTGAGGATTCAGAGTCAATGG + Intergenic
1183044605 22:35209784-35209806 TACTGTGAATGCAACATTAAGGG - Intergenic
1185121154 22:48971880-48971902 TAGTGGGATTGCTGAATCAAAGG - Intergenic
949301322 3:2586948-2586970 TAATTAGACTGAAAAATCAAAGG - Intronic
950213931 3:11144173-11144195 TAGTGAGATTGCTGGATCAAAGG - Intronic
951670669 3:25178227-25178249 AAGTCAGAATGCAAAGACAAGGG - Intronic
951671279 3:25185015-25185037 AAGTTAGAATGCATAATTAATGG - Intronic
952324393 3:32307799-32307821 TTGTTAGAATGCAAATTCTATGG - Intronic
953204702 3:40814883-40814905 TACTGGCAATGAAAAATCAAGGG + Intergenic
953819447 3:46191990-46192012 AAGTGAGAATGGGAAATGAAAGG + Intronic
954543022 3:51408341-51408363 TAATGAAAAGGCAAATTCAAAGG + Intronic
955826628 3:62953998-62954020 TAGCAAGTATTCAAAATCAAAGG - Intergenic
958832218 3:99103272-99103294 TAGAGAGAAAGAACAATCAAAGG - Intergenic
959463444 3:106654908-106654930 TAGTGAGAAAGTAAATTTAATGG - Intergenic
959782371 3:110250327-110250349 TAGTTGGAATTCAAACTCAATGG + Intergenic
959784133 3:110273233-110273255 CAGTGAGAACACAAAATGAATGG - Intergenic
959900507 3:111656029-111656051 GAGAGAGAAAGCAAAGTCAAAGG + Intronic
960855912 3:122102064-122102086 CAGTGAGAACACATAATCAAGGG - Intronic
961959909 3:130844154-130844176 TAGTGAGAAAAAAAAATCAGGGG + Intergenic
963512935 3:146271761-146271783 AAGTGTGAATCCACAATCAAGGG + Intergenic
963581443 3:147130625-147130647 TTGTGATGATGCAAAATTAAAGG - Intergenic
963628627 3:147705976-147705998 TAATGAGAATGCCAAAAAAAAGG + Intergenic
963908309 3:150792473-150792495 TTGTGAGAAGGCAAGATCAGGGG - Intergenic
964329603 3:155587752-155587774 TAGTGAGAATGCAGATGAAATGG + Intronic
964377286 3:156060706-156060728 TAGTGAAAATACAAAATGAAAGG - Intronic
965637630 3:170800304-170800326 TTGTGAGGATGCAAAAGCATAGG - Intronic
965762775 3:172097254-172097276 TAGTGAGCATGCCTAATCTAAGG + Intronic
966022426 3:175231910-175231932 CAGAGAGAATGCAATAGCAATGG + Intronic
967231403 3:187340871-187340893 TAAGAAGAATGCAAAATGAAAGG - Intergenic
969224810 4:5788655-5788677 TAGACGGAAGGCAAAATCAATGG - Intronic
970653818 4:18208298-18208320 TAGTGAGAATGCAGATAAAAGGG - Intergenic
970744087 4:19274389-19274411 TGGTGAGAACACAAAATTAAAGG + Intergenic
971822250 4:31572681-31572703 ATGTGAGAATGAAAATTCAAAGG + Intergenic
971953920 4:33391252-33391274 AAGTGAGAATGCAAAATTCATGG + Intergenic
973088121 4:46094636-46094658 TAGTGACAAGGAAAAGTCAAGGG + Intronic
973601889 4:52550548-52550570 TAGTGTGATTGCAAGATAAAAGG - Intergenic
974078745 4:57191838-57191860 TTGTCAAAATGCAACATCAAAGG + Intergenic
974094448 4:57347469-57347491 TAATGGGATTGCTAAATCAAAGG + Intergenic
974314355 4:60258496-60258518 TAGTTAGAATGCAAAATAAAAGG + Intergenic
974815741 4:67001171-67001193 TAGTGAGATTCCTCAATCAAAGG + Intergenic
975009458 4:69330931-69330953 AAATGTGAATGCAAAAGCAATGG + Intronic
975960129 4:79892729-79892751 TTGTGAGAATGAAAAATAAATGG - Intergenic
976263832 4:83171822-83171844 TAGAGAGGAAGCAAAAACAATGG + Intergenic
977061443 4:92262290-92262312 TAGTGACAATCCAAAGACAATGG - Intergenic
978293123 4:107169972-107169994 GAGTGGGCATTCAAAATCAAAGG + Intronic
978439426 4:108717753-108717775 TAGCGAGATTTCAAAATAAAAGG - Intergenic
978863546 4:113480319-113480341 CAGTCAGAATGCATATTCAATGG + Intronic
980065230 4:128180851-128180873 TGGTGAGAATGCAAAATGATAGG - Intronic
980220170 4:129903252-129903274 TACTGAGAATGCAAAGGCAGAGG + Intergenic
981734040 4:147930677-147930699 CAGGGAGAATACAAAATAAAAGG - Intronic
983614121 4:169682846-169682868 TACTGAAAATGCAAAACCAGTGG - Intronic
984100405 4:175477653-175477675 TAGTGTGAATGGAAAATCTTGGG + Intergenic
984230791 4:177096352-177096374 CAGTGAGAATGCAAGGACAATGG + Intergenic
984498265 4:180526073-180526095 TAGTGAGAAGGCAAATAAAATGG - Intergenic
985413839 4:189716473-189716495 GTGTGAGAATGCAAAATCCAGGG - Intergenic
985751163 5:1676553-1676575 TAGTGAGAATACAAGAAAAAGGG + Intergenic
986074152 5:4317226-4317248 CATTAAGAATGCAAAAACAATGG - Intergenic
986205013 5:5615473-5615495 TGGTGGGAATGCAAAATATAGGG + Intergenic
986793967 5:11191399-11191421 TAGAGGAAATCCAAAATCAAAGG + Intronic
988217322 5:28291918-28291940 TACTGAAAATGCAAAATTAGCGG + Intergenic
988757092 5:34267118-34267140 GAGTGTGGATGGAAAATCAATGG - Intergenic
989523500 5:42427175-42427197 CAATGAGAATGTACAATCAAGGG - Intronic
989564114 5:42884466-42884488 AGGTGAGAGTGCAAGATCAAAGG - Intronic
989616124 5:43338409-43338431 CAGTAAGAATGCTAAATCAATGG - Intergenic
990171866 5:53060359-53060381 TAGTAAGTCTGCAAAATCAGTGG - Intronic
992336521 5:75775843-75775865 AAGTGAGATTGCAGAATTAAGGG - Intergenic
992467714 5:77023687-77023709 TCTTTAGAAGGCAAAATCAATGG - Intergenic
993542299 5:89167030-89167052 TAATGAAAATGCAAAAACCAAGG - Intergenic
993842581 5:92898912-92898934 TAGAGAGATTGCAAATGCAAAGG + Intergenic
994427462 5:99609202-99609224 AAGTGATAATACAAAATGAATGG - Intergenic
995456353 5:112356787-112356809 TGGTGAAAAAGAAAAATCAAAGG + Intronic
995601345 5:113800254-113800276 TTGTCAAAATGCAAAATAAAAGG + Intergenic
995651076 5:114369061-114369083 CAGTGAGACTGCTGAATCAAAGG + Intronic
995918835 5:117286012-117286034 TAGTGAGAGGGCAAAATCTGTGG - Intergenic
996256041 5:121403805-121403827 CAATGAGAATGCAAATTCTAAGG + Intergenic
996556468 5:124783874-124783896 TAGTGAAAATCCAAACTCAGGGG + Intergenic
997142242 5:131394893-131394915 TAGTCAGAATGAAAATTAAATGG + Intronic
997922735 5:137998215-137998237 CAATGATGATGCAAAATCAATGG + Intronic
998691924 5:144596470-144596492 TAGTGATTAGGTAAAATCAATGG - Intergenic
998792920 5:145785257-145785279 AAGTGAGAAAGCCTAATCAAGGG + Intronic
1000595213 5:163207761-163207783 TAGTGAGAAAACAAGTTCAATGG + Intergenic
1004860095 6:19795186-19795208 TATTGAGAATACAAAATGATAGG - Intergenic
1005937124 6:30531844-30531866 AAGTGGAAATGCTAAATCAAAGG - Intergenic
1007051290 6:38833004-38833026 TAGTGAGAATGCAAAATCAATGG - Intronic
1007105104 6:39278394-39278416 TATTGAGAAGGAAAGATCAAAGG + Intergenic
1010063583 6:71653938-71653960 TAGTGAGAATGAGACATCTAGGG - Intergenic
1010542841 6:77113292-77113314 TCGTGTGAAAGAAAAATCAAAGG - Intergenic
1010561967 6:77361936-77361958 TAGTGAGAACTCAAACCCAAAGG - Intergenic
1011925253 6:92635014-92635036 TTATGTGAATGCAAAATCATAGG - Intergenic
1012298663 6:97556645-97556667 TTGTAAGAATGCACAAACAATGG - Intergenic
1012423227 6:99087268-99087290 TGCTGAGGATGCAAAATTAAAGG - Intergenic
1013657925 6:112264758-112264780 TATTGTGAATGTTAAATCAATGG + Intergenic
1014257873 6:119182013-119182035 TAGTGAGGATGCAGAATAAAGGG - Intronic
1014661168 6:124174219-124174241 TAGTTAGAATTCAAAATTCATGG + Intronic
1015612375 6:135037914-135037936 TACTGAGCTAGCAAAATCAAAGG + Intronic
1016008344 6:139112215-139112237 TATTTAGAAAGCAAATTCAAGGG + Intergenic
1017797734 6:157862628-157862650 GAGTTAGAATGCAAAAGCTAAGG - Intronic
1018097635 6:160405452-160405474 TGGTGAGAATGCAAAATGAAAGG + Intronic
1018843401 6:167535622-167535644 TACTGAGACTGCAAAGTAAATGG + Intergenic
1019863238 7:3680217-3680239 TTTTGAGAATGCAATATAAATGG - Intronic
1020606479 7:10344306-10344328 TATTGAAAATGCAAAAGAAATGG - Intergenic
1020678706 7:11209843-11209865 TAGTGAAATTGCATGATCAAAGG - Intergenic
1020757478 7:12221597-12221619 TCCTGAGAAAGCAAAAACAAAGG + Intronic
1020992353 7:15215540-15215562 TATAGAGACTGCAAAATGAAGGG + Intronic
1021514492 7:21469004-21469026 AAGTGAGATTACTAAATCAAAGG - Intronic
1023562160 7:41487539-41487561 TAGTAATAATGCAATATAAATGG + Intergenic
1024573294 7:50743255-50743277 TGCTGAGAATAAAAAATCAAAGG - Intronic
1026384759 7:69835311-69835333 TAGAGAGATGGCAAAATCCATGG + Intronic
1027684203 7:81261678-81261700 TAGTGAGAATGTGGAATAAAAGG - Intergenic
1027721846 7:81752625-81752647 TAGTGAGATTTCAAAATCAGTGG - Intronic
1029854464 7:103500924-103500946 TATTGACAATGCAAAAGCAAAGG + Intronic
1030853589 7:114522196-114522218 TTGTGCTAATGCAAAATGAAGGG + Intronic
1031318878 7:120295618-120295640 TTGAGAGAATGGCAAATCAAAGG + Intronic
1031435374 7:121726510-121726532 GAGAAAGAATGCAAAAGCAAAGG - Intergenic
1032788905 7:135227391-135227413 AATTGAAAATGCTAAATCAAAGG - Intergenic
1032796967 7:135285615-135285637 TTGTGAGAATGTAAAATAACTGG + Intergenic
1032840891 7:135712750-135712772 TATTGTGAAAGAAAAATCAATGG - Intronic
1032897329 7:136265641-136265663 CAGTGAGAATGCATAAACACAGG - Intergenic
1033013974 7:137652749-137652771 TAGTGACAATGCAAAAGGATTGG - Intronic
1033338402 7:140472686-140472708 TTGTAACAATGCAAAAACAAGGG - Intronic
1033647153 7:143314433-143314455 TAGTGAGAATGCAGAGAAAAGGG - Intergenic
1035714410 8:1743174-1743196 TACAGAGAATACAAAATAAATGG + Intergenic
1038268285 8:26052765-26052787 AAGTAAAATTGCAAAATCAAAGG + Intergenic
1038338720 8:26666121-26666143 TAGTGAAAAGGCAGAATGAATGG - Intergenic
1039668601 8:39567215-39567237 TAGTGAGAATGCCAAAAAATTGG - Intergenic
1039677200 8:39682366-39682388 TAAAGAGAATACAAAATGAAAGG + Intronic
1041392939 8:57363512-57363534 TAGCCAGATTGCAAAATAAAGGG - Intergenic
1041413309 8:57580408-57580430 AAGGGTGAAAGCAAAATCAAAGG + Intergenic
1042426614 8:68656592-68656614 TATTGATAATGCAATATTAATGG - Intronic
1043832869 8:85011106-85011128 GAGTGAAGATGTAAAATCAAAGG + Intergenic
1043932974 8:86111604-86111626 TAGTGAGATTGCTAGATCATAGG + Intronic
1044383102 8:91556990-91557012 TACTGAGAAAGCAGACTCAATGG - Intergenic
1045631270 8:104126214-104126236 TTGTCAAAATGCAAAATAAAAGG + Intronic
1046028886 8:108759525-108759547 AAGTGAATATGCAAAATGAATGG + Intronic
1046137866 8:110053878-110053900 TATTGATTGTGCAAAATCAATGG - Intergenic
1048278795 8:133089398-133089420 CACTGAGAATGCAAAGACAAAGG + Intronic
1048315952 8:133362245-133362267 TTGTTAGAATGCAAACTCATAGG - Intergenic
1048489432 8:134879051-134879073 TAGTTAGTATTCAAAATTAAGGG + Intergenic
1050613320 9:7375836-7375858 TAGTGAGTATTCTAATTCAATGG - Intergenic
1051240088 9:15045137-15045159 TACTGAAAATGCAAAACCAATGG + Intergenic
1053271757 9:36754821-36754843 TAAGGAAAATGAAAAATCAAGGG - Intergenic
1053708311 9:40778619-40778641 TAGTGAGGATTCAGAGTCAATGG - Intergenic
1054418220 9:64899409-64899431 TAGTGAGGATTCAGAGTCAATGG - Intergenic
1055698077 9:78910103-78910125 CATTGAGAATGCAGAATAAAGGG + Intergenic
1055867152 9:80828613-80828635 TGGTGAGTATGCAAAAAAAATGG - Intergenic
1057452124 9:95174022-95174044 AAATGAGAATGGAAAAACAATGG + Intronic
1057467765 9:95331273-95331295 TAGTGAGAATTCTAAATTATGGG - Intergenic
1058277225 9:103059513-103059535 TAGTGAGAATGCAGAGAAAAAGG - Intergenic
1058420353 9:104827597-104827619 TTGTGGGAATGCAGAATCCATGG - Intronic
1058608209 9:106746172-106746194 TGGTGACAATCCAAAATGAAAGG - Intergenic
1060372460 9:123087401-123087423 TATTCAGAATGCAAAAGCACTGG + Intronic
1062642164 9:137524705-137524727 TGGTGAGAATGCAAAACACAGGG - Intronic
1203639119 Un_KI270750v1:141917-141939 GAGTGAGAATGCAAAATCCAGGG + Intergenic
1187806285 X:23124950-23124972 TAGAGAGAATGGAAAATAAAGGG - Intergenic
1188615436 X:32152715-32152737 TATTGAAATTGTAAAATCAAGGG + Intronic
1188749078 X:33883900-33883922 TATTGAGAATGCAGAATCTTGGG + Intergenic
1188840773 X:35014345-35014367 GAGTGAGAAAGCAAGAGCAATGG - Intergenic
1191867287 X:65714450-65714472 TAGTGAGATTGCAAAGAAAAGGG - Intronic
1192636272 X:72822395-72822417 TAGTGAGAAGTCACAGTCAAAGG - Intronic
1192645442 X:72898419-72898441 TAGTGAGAAGTCACAGTCAAAGG + Intronic
1192947195 X:75977260-75977282 GAGTAAGACTGCAAAATCACAGG - Intergenic
1193654249 X:84179964-84179986 TAGTCAAAATTCAAAATTAAGGG - Intronic
1194453862 X:94078598-94078620 TAGTGAGGATGCAAAAAAAGGGG + Intergenic
1194692343 X:97002917-97002939 TAGTGAGAAGGCATAGTTAATGG - Intronic
1195246176 X:102997433-102997455 GAGTGAGAATAGAAAATCCAGGG + Intergenic
1198391265 X:136177132-136177154 TTGTCAGAATACCAAATCAATGG + Intronic
1198509295 X:137333308-137333330 TAGGGAAAAGGCAAAATCCAGGG + Intergenic
1198810937 X:140535659-140535681 TAGTTAGAATGAAAGAACAAAGG - Intergenic
1198874308 X:141206415-141206437 TATTGAAAATGCAAAATCACCGG + Intergenic
1199734364 X:150670619-150670641 TAGTGAGAATGCAGAACAATGGG + Intronic
1199805205 X:151293006-151293028 TTGTCAGCATACAAAATCAAAGG - Intergenic
1199891154 X:152083570-152083592 GAGAGAGAATGTAAAACCAAAGG + Intergenic
1201401309 Y:13607248-13607270 CAGTGAGAATGCCAAGCCAATGG + Intergenic